PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2009 July 15.
Published in final edited form as:
PMCID: PMC2670887
NIHMSID: NIHMS102609
Parenchymal Cell Tumor Necrosis Factor Receptors Contribute to Inflammatory Cell Recruitment and Respiratory Failure in Pneumocystis Carinii Induced Pneumonia1
Gloria S. Pryhuber,*2 Heidie L. Huyck,* Samir Bhagwat,* Michael A. O'Reilly,* Jacob N. Finkelstein,* Francis Gigliotti,* and Terry W. Wright*
*Department of Pediatrics, University of Rochester Medical Center, Rochester, New York
Department of Environmental Medicine, University of Rochester Medical Center, Rochester, New York
Department of Microbiology and Immunology, University of Rochester Medical Center, Rochester, New York
2 Corresponding Author: Gloria S. Pryhuber, MD, Assoc Professor, Pediatrics and Environmental Medicine, Box 850, 601 Elmwood Avenue, Rochester, NY, 585-273-4120, gloria_pryhuber/at/urmc.rochester.edu
The opportunistic organism Pneumocystis carinii (Pc) produces a life-threatening pneumonia (PcP) in patients with low CD4+ T cell counts. Animal models of HIV-AIDS-related PcP indicate that development of severe disease is dependent on the presence of CD8+ T cells and the tumor necrosis factor receptors (TNFR), TNFRsf1a and TNFRsf1b. To distinguish roles of parenchymal and hematopoietic cell TNF signaling in PcP-related lung injury, murine bone marrow transplant chimeras of wild-type, C57Bl6/J, and TNFRsf1a/1b double null origin were generated, CD4+ T-cell depleted, and inoculated with Pc. As expected, C57→C57 chimeras (donor marrow→recipient) developed significant disease as assessed by weight loss, impaired pulmonary function (lung resistance and dynamic lung compliance) and inflammatory cell infiltration. In contrast, TNFRsf1a/1b-/-→TNFRsf1a/1b-/- mice were relatively mildly affected despite carrying the greatest organism burden. Mice solely lacking parenchymal TNFRs (C57→TNFRsf1a/1b-/-) had milder disease than C57→C57 mice. Both groups of mice with TNFR deficient parenchymal cells had low BALF total cell counts and fewer lavagable CD8+ T cells than C57→C57 mice, suggesting that parenchymal TNFR signaling contributes to PcP-related immunopathology through the recruitment of damaging immune cells. Interestingly, mice with WT parenchymal cells but TNFRsf1a/1b-/- hematopoietic cells (TNFRsf1a/1b-/-→C57) displayed exacerbated disease characterized by increased MCP-1 and KC production in the lung and increased macrophage and lymphocyte numbers in the lavage, indicating a dysregulated immune response. This study supports a key role of parenchymal cell TNFRs in lung injury induced by Pc and a potential protective effect of receptors on radio-sensitive, marrow derived cells.
Keywords: cytokine receptors, fungal, immunodeficiency disease, lung
Pneumocystis carinii (Pc) is an opportunistic pathogen that is widely disseminated in the general population (1, 2). Under normal circumstances, Pc produces a mild, sub-clinical pulmonary infection. In the immunocompromised host however, Pc becomes a pathogen capable of inducing significant morbidity and mortality. Pc pneumonia (PcP) is a predominant presenting complaint in a majority of AIDS patients, in association with reduced CD4+/CD8+ T-lymphocyte ratio, and is a common complication for other immunosuppressed patients. Mortality rates reported for PcP remain as high as 50% and have changed little in recent years (3). Despite the prevalence and severity of PcP, the pathophysiological mechanisms by which Pc produces disease are poorly understood. Although the organism itself can be directly toxic to cells of the lung, eventually resulting in death of lymphocyte deficient mice or globally immunodeficient patients, PcP occurs most rapidly and severely in those mice or humans in which partial lymphocytic immune function remains or is restored. In the absence of functional CD4+ and CD8+ T-cell-mediated immunity, lung injury becomes apparent when the number of Pc organisms becomes overwhelming. However, if either CD4+ or CD8+ T-cells are present in the absence of the other, lung injury in response to smaller Pc burdens is profound, typically characterized by necrosis and sloughing of type I alveolar cells, accumulation of alveolar edema, foamy alveolar exudates and inflammatory cell infiltration. For example, a recent study indicates that in AIDS patients with profound reductions in CD4+ T cell number, the remaining CD8+ T cells mediate PcP-related lung injury (4). Also, preferential reconstitution of CD4+ T cells, as in recovery from chemotherapy or successful HAART treatment of AIDS, can induce an intense pulmonary response to Pc or Pc antigen and lead to PcP-related immune reconstitution inflammatory syndrome (IRIS). The pathogenic potential of CD4+ and CD8+ T cells has also been demonstrated in animal models of PcP in which treatment with either anti-CD4 or anti-CD8 antibodies exacerbated inflammatory injury in an immune reconstitution model of PcP (5, 6). An unbalanced or overzealous host response to Pc is now recognized as largely responsible for PcP-related lung injury.
The cytokine tumor necrosis factor alpha (TNF) is centrally involved in the generation of both innate and adaptive immune responses, and has been extensively studied in the context of PcP. Clinical reports indicate that long-term anti-TNF therapy can render previously resistant patients susceptible to Pc infection (7). Similar findings have been reported in animal models (8). However, TNF signaling through its receptors is also directly involved in the immunopathogenesis of PcP. During PcP, peak lung concentrations of TNF correlated temporally to rapid progression of lung injury. The importance of TNF signal transduction in PcP was further supported by observations of Pc infection in mice genetically null for both TNF receptors. CD4+ T-cell depleted TNFRsf1a/1b-/- mice displayed reduced inflammatory cell recruitment to the lung when compared to CD4-depleted WT mice similarly infected with Pc (9). Quantitatively, the TNFR-deficient mice had significantly reduced pulmonary RANTES, monocyte chemoattractant protein-1 (MCP-1), macrophage-inflammatory protein-2 (MIP-2), and cytokine-induced neutrophil chemoattractant (CINC) responses, as well as reduced histological evidence of PcP-related alveolitis as compared with infected wild-type mice. Less severe pulmonary inflammation correlated with improved surfactant activity and improved pulmonary function in the TNFR-deficient mice.
While robust TNF responses have been documented in both bronchoalveolar lavage fluid (BALF) from Pc-infected mice and culture supernatants of Pc-stimulated alveolar macrophages, the relevant cellular target of TNF action during PcP has not been determined. TNFRsf1a and TNFRsf1b are ubiquitously expressed at varying, cell-type dependent ratios. Ligand binding of the TNFRs has pleiotropic effects depending on cell type and cell priming, ranging from induction of apoptosis or proliferation to induction of secondary cytokines. TNFRs are present on most cells and lung parenchymal (including epithelial), as well as classical immune, cells respond to both Pc and TNF. The current study was performed to determine if PcP-related lung injury is dependent on TNF receptor function on lung parenchymal cells, which are largely radio-resistant at low dosage, or in radiosensitive, bone marrow derived immune cells. Sub-lethal total body irradiation followed by bone marrow transplantation was utilized to create chimeric mice in which either hematogenous cells (radiosensitive, donor morrow) or parenchymal cells (radio-resistant, recipient), or both, are null for TNFRs. The chimeric mice were CD4+ T cell depleted prior to Pc infection and the progression of disease was assessed.
Generation of C57BL6/J TNFRsf1a/1b Double Null Mice
The original studies of PcP in TNFR null mice were performed in commercially available TNFRItm1Imx/IItm1Imx double null mice generated as intercrosses of TNFRItm1Imx-/-, created by homologous recombination in C57BL/6-derived ES cells, and TNFRIItm1Imx-/- generated in AB1 (129S5/SvEvBrd) ES cells (Jackson Laboratories). C57BL/6.129SF2 hybrids were the recommended controls (10). In order to reduce potentially confounding genetic differences in the current experiments, TNFRsf1a/1b double null mice were regenerated in a C57BL6/J background. TNFRItm1mak/j-/- and TNFRIItm1Mwm/J-/- single knockout mice were each backcrossed 12 generations onto C57BL/6J and then interbred to produce double deficient mice. Wild-type C57BL/6J mice were used as controls (Jackson Laboratories). Mice utilized in the current protocol were bred and maintained in micro-isolator cages in specific pathogen free rooms in the animal care facility at the University of Rochester Medical Center, Rochester, NY. Sentinel animals maintained in the same rooms, on bedding mixed with bedding taken from other cages within the room, routinely tested negative for common murine pathogens including murine hepatitis, pinworm and Sendai virus. All animal care and experimental protocols were approved by the University of Rochester Committee on Animal Research and follow the guidelines of IUCAC.
Generation of Chimeras by Bone Marrow Transplantation (BMT)
In order to distinguish the role of parenchymal cell TNFR signaling in Pc-induced lung injury, bone marrow transplant chimeras (BMT, Donor→Recipient) C57→C57, C57→TNFRsf1a/1b-/-, TNFRsf1a/1b-/-→C57 and TNFRsf1a/1b-/-→TNFRsf1a/1b-/-, were generated by radio-ablation of female recipients (total body irradiation, 6 Gy × 2 doses, Shepherd Irradiator, 6000 Ci 137Cs source) followed by reconstitution with male donor bone marrow. The radiation dose was previously demonstrated to induce agranulocytosis without evidence of radiation induced injury at greater than 3-4wk. Bone marrow was extracted from a minimum of 3 donors of the appropriate mouse strain by flushing femurs and tibias into HBSS with 1% FCS, dispersing through a 21g needle and pooling. Erythrocytes were removed by hypotonic lysis. The cells were counted, resuspended in media at 5 × 107/ml and delivered to recipient mice by tail vein injection (1×107 per mouse). Following BMT, animals were allowed to reconstitute for 8 weeks under micro-isolator conditions, supplied with HEPA-filtered air, sterilized food, acid water and bedding. To confirm chimerism, fluorescent in situ hybridization (FISH) with a probe directed against a region of Sry, the sex determining gene of the Y chromosome, was used on cells obtained by bronchoalveolar lavage in some mice to confirm the male origin of cells transplanted to female recipients (11). In addition, analysis of soluble TNFR present in peripheral blood and FACS analysis of cells isolated from spleens and BAL were consistent with the chimeric design (Table 1).
Table 1
Table 1
Surface markers of cells in BAL and spleen confirm TNF receptor chimera constitution and CD4 ablation (n=3-8, mean +/-SD, # indicates p < 0.05 vs WT donor chimeras)
Induction of PCP in Mice After BMT
Eight weeks after reconstitution, the BMT chimeras were made susceptible to Pc infection by twice-weekly intraperitoneal injections of anti-CD4+ monoclonal antibody (0.25 mg, clone TIB 207; American Type Culture Collection, Manassas, VA) as previously described (9). Injections were begun at least 4 days before Pc inoculation and were continued for the duration of the experiment. After initiation of CD4 depletion, each experimental mouse was anesthetized with a mixture of ketamine (68 mg/kg body weight) and xylazine (6 mg/kg body weight) and then intranasally inoculated with Pc, 5×105 as determined by cyst count, in 100 μl of sterile saline. Mice were then housed under standard, microisolator technology until sacrifice at approximately 28 days after Pc inoculation. The timing of end-point analysis was determined by appearance of illness and elevated respiratory rates. Despite close observation, ten mice died prior to harvest as detailed in the Results. The results of four independent experiments, each with all chimera groups included, were combined and are presented in aggregate.
Physiologic Assessment of Pulmonary Compliance and Resistance
Dynamic lung compliance and resistance was measured in live mice, anesthetized by sodium pentobarbital injection (100 mg/kg body weight, i.p.), using a previously described method with modifications (5). A tracheotomy was performed and a 20-gauge cannula was inserted 3 mm into an anterior nick in the exposed trachea. To assure that the mice tolerated the procedure, they were examined for spontaneous respirations before proceeding further. Mice were immediately placed into a plethysmograph designed for anesthetized mice (Buxco Electronics) and connected to a Harvard rodent ventilator (Harvard Apparatus, Southnatick, MA). Mice were ventilated with a tidal volume of 0.01 ml/g body weight at a rate of 150 breaths per minute. Data were collected and analyzed using the Biosystems XA software package (Buxco Electronics). Dynamic lung compliance (ml/cm H2O), normalized for peak body weight, and lung resistance (ml/cm H2O/sec) were calculated by the method of Amdur and Mead (12) from air flow and pressure signals transduced from the chamber and passed through an analogue-to-digital converter.
Analysis of Bronchoalveolar Lavage and Cells Isolated from Spleen and BAL
Pretreatment serum was collected by mandibular bleed. At peak PcP in the most severely affected, all mice were euthanized by injection with pentobarbital (130 mg/kg IP). Serum was collected by cardiac puncture and allowed to clot in serum separator microtainers. Single-cell suspensions from spleen were obtained by homogenization in DMEM medium and successive filtration through 100- and 40 μm cell strainers and through 25 μm nylon gauze. For bronchoalveolar lavage, the trachea was intubated, the anterior chest wall removed and the lungs were lavaged with normal saline (RT, 2 ml). The lavage fluid (BALF) was centrifuged at 250 × g for 10 min at 4°C. The supernatant was placed on ice prior to assay for lactate dehydrogenase and then frozen at -80°C until assayed for total protein by bicinchoninic acid (BCA) assay (Pierce, Inc., Rockford, IL) as well as for MIP-2, MCP-1, TNF and soluble TNFRs by ELISA (DuoSet, R&D Systems, Minneapolis, MN), utilizing commercial reagents and protocols. The pelleted BALF cells were resuspended in 1ml 0.15 M NH4Cl, 0.01 M NaHCO3 solution for 10 minutes to lyse red blood cells, then washed twice with Hank's balanced salt solution and resuspended in DMEM. A total cell count of resuspended BALF cells was performed by hemocytometer. BALF cellular differential was determined on 50 μl cytospins stained with Diff-Quik (Dade, Dudingen, Switerland) as previously described. MIP-2, MCP-1, KC and TNF were also assessed by ELISA in lung homogenate prepared in anti-protease buffer and normalized to total protein concentration of the samples.
Flow Cytometry
CD4, CD8 and TNFRsf1b positive leukocyte populations in BAL and spleen were identified by multiparameter flow cytometry as previously described (13). Cells obtained from lung lavage were washed, resuspended in phosphate-buffered saline (PBS) containing 1% bovine serum albumin-0.1% sodium azide and stained for 30 minutes at 4°C with anti-CD4-FITC (clone RM4-4), anti-CD8a-peridinin chlorophyll-a protein (clone 53-6.7, perCP) and anti-TNFRsf1b-PE (BD PharMingen, San Diego, CA). The anti-CD4 clone RM4-4 was used to confirm that CD4+ T-cells were depleted in experimental mice because it is not blocked by the anti-CD4-depleting antibody used (TIB207). Surface marker phenotypes were detected on a FACS Caliber cytofluorometer and analyzed using CellQuest (Becton Dickinson, San Jose, CA) and FlowJo (Tree Star, Inc., Ashland, OR) software. At least 10,000 events were routinely analyzed from the BAL of each Pc-infected experimental mouse. At least 5,000 events were analyzed from uninfected control mice. Where indicated, analysis was confined to the lymphocyte population gate based on forward and side scatter characteristics.
Isolation and Analysis of RNA and Proteins
Lung tissue was harvested, homogenized in guanidine isothiocyanate buffer, immediately frozen on liquid nitrogen and stored at −80°C. RNA was isolated by extraction with acid/phenol, resuspended in RNase-free water and quantified by absorbance at 260 nm. Changes in the abundance of specific RNAs were assessed by RNase protection analyses (data not shown) using riboprobes radio-labeled to high specific activity with [proportional, variant]32P-UTP as previously described (14) and confirmed by quantitative rtPCR performed by commercial protocol. Total mouse lung mRNA (1ug) was used to synthesize first strand cDNA following the GeneAMP protocol (Applied Biosystems). Quantitative real time PCR was performed with Assays-on-Demand Primer/MGB Probes (ABI) for MCP1, MIP-2, KC and rpL32. Standard curves were made with serial dilutions of a mixed pool of all cDNA assayed. All chemokine values were normalized to the rpL32 mRNA content of each sample.
Quantification of Intra-Pulmonary Pc Burden at Time of Harvest
The intensity of infection in mouse lungs was determined by real-time PCR and by Pc cyst count in mice at the time of experimental harvest. For real-time PCR, crude lung homogenates were boiled for 15 min and centrifuged at 13,000 × g for 15 min. Portions (2.5μl) of the supernatants, used fresh or stored at -70°C, were diluted 1:3 to minimize PCR inhibition, then assayed by quantitative PCR using TaqMan primer-fluorogenic probe chemistry (Applied Biosystems, Foster City, CA). The primer-probe set used was obtained from Integrated DNA Technologies (Coralville, IA) and is specific for a 96-bp region of the P. carinii kex1 gene (GenBank accession number AF093132) (15). The PCR reactions (total volume, 25 μl) consisted of universal PCR master mixture (Applied Biosystems), 900 nM forward primer (5′-GCACGCATTTATACTACGGATGTT-3′ sequence positions 1192 to 1215), 900 nM reverse primer (5′-GAGCTATAACGCCTGCTGCAA-3′ sequence positions 1268 to 1288), 150 nM Taqman kex1 probe (5′-/56-FAM/CAGCACTGTACATTCTGGATCTTCTGCTTCC/36-TAMSp/-3′ sequence positions 1230 to 1260), and 2.5 μl diluted lung sample. To generate a standard curve for the assay, a section of the mouse Pc kex1 gene was sub-cloned into the pRSET B plasmid (Invitrogen Corp., Carlsbad, CA). The copy number of the plasmid vector was calculated from the DNA concentration determined by A260 spectrophotometric measurement. The thermocycler profile used was 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60° for 1 min. Quantization of the organism burden was performed with the ABI Prism 7000 sequence detection system and its associated SDS software (version 1.0; Applied Biosystems), extrapolating the amplification curve threshold cycle against the threshold cycles of a standard curve constructed with serial 10-fold dilutions of predetermined copy numbers of the pRSETB: kex1 vector. The qRT-PCR method was found in our laboratory to give results that closely approximated enumerations of P. carinii cysts determined by conventional staining techniques. The Pc counts reported are those obtained by quantitative PCR, normalized for each experiment to the mean Pc count measured in the WT to WT chimera lungs in order to account for inter-experimental variability in organism burden. The mean and standard error of Pc counts measured in each chimera group are also reported.
Statistical Analysis
Where appropriate, statistical significance was determined by Student's t-test or by ANOVA with Fischer's PLSD post hoc test (StatView, SAS Institute Inc, Cary, NC).
Histological Assessment of Pc-induced Lung Injury
At peak injury, approx 28 days after Pc instillation, the left lung was inflation fixed with 10% buffered formalin overnight, dehydrated to 70% ethanol and paraffin embedded. Paraffin sections (4-5 μm thick) were deparaffinized and rehydrated through graded ethanol and stained with hemotoxylin and eosin. Photomicrographs were taken by a SPOT-RT digital camera. Representative low and high power fields are presented from three mice for each chimera group.
Previous study of TNFR null mice demonstrated a significant reduction in inflammatory cell recruitment, chemokine production and histological evidence of PcP in the global absence of TNFRs (9). In order to begin to define the cells that, via the TNFRs, mediate the inflammatory response leading to lung injury, chimeric WT/ TNFRsf1a / sf1b double null mice, expressing receptors either on radio-resistant parenchymal cells or on radio-sensitive bone-marrow donor derived cells, were generated. Following reconstitution, the bone marrow chimeras were treated with anti-CD4 antibody to induce susceptibility to Pc. Flow cytometry of the BALF cells demonstrated that less than 1% of the recruited lymphocytes were CD4 positive confirming the uniform CD4 depleted state of the chimeras (Table 1). The absence of CD4+ T-cells was confirmed in FACS analysis of splenocytes. FACS analysis of splenocytes and BALF cells for TNFRsf1b receptor also confirmed the design and success of the BMT induced chimerism. Less than or equal to 1% of lymphocytes in BALF or spleen were TNFRsf1b positive in KO to WT and KO to KO chimeras where these cells should have originated from donor receptor null bone marrow. In contrast, there was no significant difference between percentage of spleen and BALF lymphocytes that were TNFRsf1b positive in WT to WT and WT to KO chimeras, nor between these chimeras and non-transplanted WT animals, demonstrating full reconstitution (Table 1). The percentage of splenocytes and BALF cells that were CD8 positive did not differ significantly between the chimera groups and did not correlate with severity of illness.
Maximal Pc-induced impairment of pulmonary function and weight loss requires TNFRs on radio-resistant cells
Pc-induced pulmonary inflammation has been shown to correlate well with surfactant dysfunction and physiologic impairment of lung function as measured by lung resistance and dynamic compliance in mice (9). Lung resistance and compliance where slightly altered by the BMT procedure with both resistance and compliance tending to be lower in transplanted WT to WT and KO to KO as compared to non-transplanted WT and KO mice respectively. These subtle (p>0.05) BMT effects were not TNF receptor dependent. In the current study, resistance and compliance measures in all Pc infected chimeric mice were significantly impaired as compared to non-infected, non-transplanted WT and KO controls, as well as non-infected, transplanted WT-WT and KO-KO controls (Fig 1, grey bars in C and D versus non-infected represented in A and B), consistent with a TNF receptor independent component of PcP. However, pulmonary function of WT to WT mice was significantly more compromised by Pc infection compared to KO to KO mice reinforcing the importance of TNFR signal transduction in the development of PcP. Consistent with the hypothesis that parenchymal cell TNFR function has an important role in PcP, the greatest decrement in lung function, measured as reduced compliance and increased resistance, was noted in the KO to WT chimeras, trending greater than that measured in WT to WT and significantly greater than all other chimera groups (Fig 1, C and D). The obtained measurements on WT donor to KO recipient chimeras showed slight improvement in lung function over WT to WT animals that did not reach statistical significance (p>0.05). However, the mortality rate in the WT to WT group was significantly greater than in either KO recipient group consistent with more severe disease. While overall mortality rate was fairly low in these experiments, ten mice died, all within days of the four-week experimental end-point. Five were WT to WT chimeras out of 20 tested (25%), four were KO to WT out of 19 tested (21%), only one was WT to KO out of 14 (7%), and none were KO to KO, reinforcing the increased severity of disease in mice whose parenchymal cells expressed TNFRs as compared to recipient mice who were receptor null. When average lung function measurements of all surviving mice with WT parenchymal cells (WT to WT and KO to WT) were compared to the average measurements of all mice with KO parenchymal cells (WT to KO and KO to KO), the role of parenchymal TNFRs was unmistakable. The mean lung compliance for mice with WT parenchymal cells was 0.68 +/- 0.04 as compared to 0.93 =/- 0.05 for the mice with KO parenchymal cells (mean +/- SEM, p <0.0001). Similarly, mean lung resistance values for the two groups were 2.36 +/- 0.9 and 1.84 +/- 0.04, respectively (p <0.0001). This data is also supported by the overall mortality rates of approximately 23% for mice with WT parenchymal cells and 3% for mice with KO parenchymal cells.
Figure 1
Figure 1
Pulmonary function in TNFR WT, KO and BMT chimeric mice. Lung resistance (A, C) and specific dynamic lung compliance (B, D) measurements were made in live, intubated mice four weeks after (A, B) saline instillation or (C, D) Pc infection. Black bar: Non-transplanted, (more ...)
Weight loss following Pc infection is another clinically significant marker of pneumonia severity. As seen in Figure 2, the mice expressing TNFRs only on radio-resistant, parenchymal cells demonstrated significantly greater weight loss than any of the other Pc exposed chimeric mice (p<0.01). Importantly, both groups of mice with TNFR expressing parenchymal cells (WT to WT and KO to WT) exhibited significantly greater weight loss than mice lacking parenchymal TNFR (KO to KO and WT to KO), again highlighting the role of parenchymal TNFRs during PcP-related injury. As with the pulmonary function measurements, accounting for those mice that died prior to harvest at four weeks of infection, average weight loss would be expected to be even greater in the groups with WT parenchymal cells. Thus, considering morbidity and mortality, the presence of TNFRs on only radio-resistant cells was sufficient to induce clinically significant PcP.
Figure 2
Figure 2
Percentage of pretreatment weight loss or gain in TNFR BMT chimeric mice. The change in body weight was determined from measurements made at the time of harvest, 4 weeks after intratracheal Pc infection (grey bars) or control saline instillation (black (more ...)
No significant difference was measured in resistance, compliance or weight loss in WT to KO as compared to WT to WT chimeras. The values for these measures fell between that of the WT to WT and KO to KO, demonstrating that TNF receptors restricted to marrow derived cells are capable of generating PcP similar although, considering the difference in mortality, milder than globally TNF responsive mice.
Accumulation of inflammatory cells, LDH and protein in the bronchoalveolar space was TNFR location dependent
Total cell count and differential of cells available by bronchoalveolar lavage were determined in order to quantify differences in the alveolar inflammatory cell recruitment in the presence or absence of parenchymal TNFRs (Fig 3). There was a marked recruitment of lavagable cells in the WT to WT chimeras, as well as a significantly greater increase in the lavaged cell count of the KO to WT mice. In comparison, the remaining two chimera groups with receptor null parenchymal cells had significantly reduced total BALF cell counts not different from saline treated chimeric controls. Differential cell counts on lavaged cells demonstrated a small, TNFR independent, increase in lymphocytes in saline control chimeras as compared to non-transplanted, non-infected mice (p <0.05). The increase in total cell number in Pc-infected mice with WT parenchymal cells was accounted for mainly by increases in lymphocytes and neutrophils (Fig 3B). Furthermore, KO to WT mice showed a dramatic increase in the number of lavagable AMs compared to all other Pc-infected groups. That the number of BALF alveolar macrophages in all other chimeras were reduced from baseline, saline treated, suggests margination of resident and, potentially, recruited macrophages. Although the percentage of BALF cells that were CD8+ did not differ between the chimeras (Table 1), the absolute numbers of CD8+ T-cells recruited by the WT to WT and KO to WT mice were significantly greater than that recruited by the WT to KO or the KO to KO mice suggesting that the presence of TNFRs on radio-resistant, parenchymal cells, is sufficient for CD8+ T-cell recruitment and is necessary for peak recruitment.
Figure 3
Figure 3
Analysis of lavagable white blood cells in BALF of TNFR BMT chimeric mice. BALs were performed 4 weeks after intratracheal saline (black bars) or Pc (grey bars) instillation. Total cell count per ml of BALF (A) and WBC differential cell count (B) were (more ...)
As with the pulmonary function tests, there was a small but in this case significant increase in BALF protein content, and a trend toward increased LDH, in non-infected control chimeras compared to non-infected, non-transplanted controls, which was TNFR independent (Fig A and B). Consistent with enhanced capillary leak and cell death, the bronchoalveolar lavage total protein was elevated more than 10-fold in the WT (see ref (9)) and chimeras after Pc; no distinction could be made between chimeras based on protein concentration in the alveolar space although the trend was lower in KO recipient lungs as compared to WT recipient (Fig 4C). LDH concentrations in BALF, were also elevated in all Pc treated mice; in this case LDH was significant higher in the WT to WT chimeras and trended higher in the KO to WT suggesting enhanced cellular necrosis and release of LDH dependent on parenchymal cell response to TNF (Fig 4B). The average BALF protein and LDH concentrations were greater in the TNFR WT recipients than in the receptor null recipients; 1.45 +/- 0.55 vs 1.08 +/- 0.58, p = 0.01 and 304.5 +/- 46.5 vs 132.1 +/-20.8, p<0.005, respectively.
Figure 4
Figure 4
Analysis of BALF for (A&C) total protein and (B&D) lactate dehydrogenase indicating capillary leakage and cellular death in (A&B) saline treated chimeras (grey bars) versus non transplanted controls (black bars) and in (C&D) (more ...)
Severe Pc-induced alveolitis occurred in TNFR WT recipient chimeras in comparison to TNFR null recipient chimeras
Analysis of lung sections from the Pc infected TNFR chimeras by light microscopy demonstrated differences in degree of lung injury that were consistent with that suggested by the physiologic and cellular indices (Fig 5). Both the WT to WT and KO to WT lungs demonstrated dense, mononuclear cell infiltration maximal around distal bronchioles and pulmonary vessels; the pattern was somewhat more intense, interstitial and diffuse in the absence of TNF receptors in the marrow derived cells of the KO to WT mice. Inflammation was also present in the absence of parenchymal cell TNFRs but cellularity was markedly reduced when compared to parenchymal WT lungs. The architecture of the WT to KO chimera lungs, and especially the alveolar spaces, were relatively spared in comparison to all other chimeras. Interestingly, the TNF receptor null mice, KO to KO, were not free of injury but demonstrated a relatively disorganized cellular infiltration and large amounts of bland alveolar debris that may be related to direct injury resulting from the high Pc burden.
Figure 5
Figure 5
PcP in TNFR chimera mice demonstrated by hematoxylin and eosin stain in representative sections (4 μm) of inflation fixed left lung of three mice per chimera group. Grey bar = 100 μm.
Increased sTNF receptors measured in BAL and serum of WT animals with PcP
TNFRs, active as cell surface transmembrane receptors, are solubilized by enzyme cleavage in response to inflammatory stimuli (For review, (16, 17). Elevated serum sTNFRs in patients with acute respiratory distress syndrome correlated with mortality (18). In the current study, soluble TNFRsf1a and TNFRsf1b were analyzed in serum and BALF to test the hypothesis that TNF receptors are also shed and accumulate in response to Pc infection. As controls, soluble TNF receptor (sTNFR) levels were measured in serum harvested eight weeks after bone marrow reconstitution, just prior to beginning CD4+ T-cell depletion, and were consistent with the desired chimeric composition (Fig 6A and B, black bars). In these pretreatment samples, sTNFRsf1a and sTNFRsf1b concentrations in WT to WT transplants were comparable to WT, non-irradiated, non-transplanted mice demonstrating that solubilization was not an artifact of bone marrow transplantation. TNFRsf1a/1b-/- to TNFRsf1a/1b-/- chimeras had no detectable sTNFRs in serum. Serum sTNFR concentrations of the mixed chimeras were, as expected, intermediary between WT and KO animal levels. The relative levels of the two receptors were dependent on the genotype of the donor and recipient mice. Comparable serum sTNFRsf1a levels were detected in non-infected WT, WT to WT and KO to WT chimeras. The receptor was very low in the WT to KO chimeras suggesting that the primary origin of this soluble receptor, constitutively in circulation, is the parenchyma. Serum TNFRsf1b was comparable to WT control in the WT to KOs but reduced in the KO to WTs, suggesting that bone marrow derived cells are a significant basal source of this circulating receptor. Four weeks after Pc infection, sTNFRsf1a and sTNFRsf1b concentrations were increased in both serum and BALF of WT mice when compared to saline treated controls (Fig 6), suggesting that sTNFRs could be a marker of PcP. There was minimal elevation of serum sTNFRsf1a in KO to WT but a significant rise in WT to KO chimeras in response to Pc consistent with the majority of stimulated serum sTNFRsf1a originating from bone marrow derived cells. An increase in BAL sTNFRsf1a after Pc in both mixed chimeras suggests stimulated release of the receptor from both marrow derived and parenchymal cells in the airways. All chimeras except KO to KO (undetectable) had an increase in serum and BALF sTNFRsf1b in response to Pc suggesting that although much of basal serum sTNFRII originates from circulating, marrow-derived cells, Pc induced shedding originates from both donor marrow and recipient parenchymal sources in the BMTs.
Figure 6
Figure 6
Soluble TNFRs in serum and BALF of chimeric TNFR mice prior to, and four weeks after, Pc infection. Serum sTNFRsf1a (A) and sTNFRsf1b (B) concentrations were assessed pre-infection (black bars) and at four weeks after Pc instillation (grey bars). BALF (more ...)
Severity of lung injury was not directly related to Pneumocystis burden
Although KO to KO mice were the healthiest of the TNFR chimera mice, determination of Pc burden in the lungs at four weeks after infection demonstrated the highest number of organisms in this group, 10.1 ± 2.3 × 106 per lung vs. 6.6 ± 1.8 × 106 per lung in WT to WT averaged across four experiments, a two fold difference when normalized to WT to WT burden in each experiment (Figure 7). This data is consistent with previous reports that TNF exerts some control over Pc growth in SCID mice (19) and in CD4-depleted mice (8), and also demonstrates that the host's immune response, and not Pc burden, is the critical factor in determining the severity of PcP. Also of interest is that while KO to WT mice had the most intense pulmonary inflammatory response and most severe PcP, they did not have reduced Pc burden (6.4 ± 2.0 × 106 per lung). This indicates that an inappropriate immune response can exacerbate disease without the beneficial effect of killing Pc. The lowest Pc burden was detected in the mice with WT bone marrow but TNFR-deficient parenchymal cells, the WT to KO chimeras (1.6 ± 0.5 × 106 per lung). These mice consistently maintained a significantly lower Pc burden than the remaining chimeras.
Figure 7
Figure 7
Relative Pc burden determined by quantitative real time-PCR for kex1 gene copies in Pc infected TNFR BMT chimeric mice at the time of harvest, 4 weeks after Pc infection. kex1 gene copies are presented normalized to the average kex1 gene copy number in (more ...)
Differential chemokine induction dependent on cell specific TNFR expression
Recruitment of inflammatory cells to the lung during PcP has been correlated to chemokine production, in particular MIP-2, MCP-1, KC and CINC, in addition to TNF (9). The chemokine elevation was largely dependent on TNFR expression as it was blunted in TNFR null mice (9). In order to determine if the variation in PcP severity observed in the presence or absence of parenchymal cell TNFRs correlated with altered chemokine production, both lung tissue homogenates and BALF from TNFR chimeric mice were analyzed for chemokine protein. Previous studies demonstrated MCP-1, MIP-2, KC and TNF were below the limit of detection in lung and BALF of uninfected mice. No significant difference in homogenized lung tissue TNF was detected between chimeras, while MCP-1 was modestly, and KC was markedly, increased in KO to WT mice in comparison to TNFR null recipient chimeras (Fig 9B). MIP-2 protein concentration was significantly increased in all mice expressing TNFRs on either, or both, marrow derived or parenchymal cells with relatively reduced levels in fully null chimeras. Measurement of the cytokines in BALF detected chemokine concentration differences dependent on TNFR distribution (Fig 9A). MCP-1 protein was significantly elevated in BALF of KO to WT chimeras, those animals also documented to have more severe PcP (Figs 1 and and6)6) and a dramatic increase in lavagable macrophages (Fig 3). BALF TNF levels were highest in the KO-to-KO mice and lowest in the WT to WT mice, with TNF levels in the mixed chimeras falling between. This likely reflects alteration of TNF negative feedback loops that require the expression of TNFRs on both compartments for normal control of TNF production. Relatively low concentrations of MIP-2 were detected in the BALF with the greatest levels in the WT to TNFR null mice suggesting dysregulation of the chemokine with stimulation of marrow derived cells in the absence of parenchymal TNF response.
Analysis of mRNA for the cytokines MIP-2, MCP-1 and KC in whole lung preparations by quantitative RT-PCR demonstrated patterns of expression similar to the protein concentrations measured in BAL and lung homogenates. MCP-1 and KC mRNA concentrations were significantly elevated in KO to WT chimeras when compared to all Pc treated chimeras and controls, while MIP-2 mRNA was significantly less concentrated in the TNFR null, intermediate in the mixed and several fold greater in the WT to WT chimeras (Fig 9C). RANTES, also previously shown to be stimulated in response to Pc (9), was increased in all cases from non-infected controls (0.2 ± 0.1 ratio to rpL32) but with no significant difference between chimeras. The expression of IL-10, an anti-inflammatory cytokine, was also tested as a potential explanation for differences in PcP severity. There were significant differences in IL10 mRNA levels between the chimeras, in part correlated with severity of disease as highest concentrations were measured in fully TNFR null chimeras. Yet those most injured, the KO to WT, had IL10 mRNA comparable to WT while it was significantly lower in moderately injured WT to KO.
Many lines of evidence support the importance of TNF in the development of PcP. Pc stimulates TNF production and release from alveolar macrophages in both immunocompetent and immuno-suppressed mice and from monocytes and macrophages in culture (20, 21). Release of TNF from alveolar epithelial cells in response to the organism has also been demonstrated (22). In the reconstituted SCID model of PcP, the onset of reduced compliance and hypoxia is temporally related to peak TNF mRNA in lung tissue and TNF protein in bronchoalveolar lavage fluid, in association with the influx of neutrophils, macrophages and lymphocytes. TNF protein is likewise increased in CD4+ T-cell depleted, Pc infected mice in a CD8+ T-cell dependent manner (9). Our previous studies using TNFR deficient mice demonstrated that maximal Pc-induced chemokine production, lung injury and pulmonary dysfunction required intact TNFR signal transduction (9). The current study demonstrates that TNFRs on cells resistant to split dose irradiation are sufficient to mount an inflammatory response to Pc, comparable or in excess of that generated when all cells express the receptors. Limitation of TNFR distribution to marrow-derived cells improved control of Pc burden and reduced Pc-induced injury.
Pulmonary function and inflammatory markers were analyzed in the TNFR chimeric mice when the sickest treatment group reached clinically peak disease, approximately four weeks after Pc treatment in the chimeric mice; at and beyond this point mortality increased markedly in the KO to WT and WT to WT chimeras. Each of the transplanted mice that expressed TNFRs either on radiosensitive marrow derived cells or radio-resistant parenchymal cells or both (WT to WT, WT to KO or KO to WT) demonstrated some evidence of pneumonia at this time-point. However, the greatest mortality, decrement in pulmonary function, weight loss and inflammatory cell recruitment occurred in those mice expressing TNFRs on radio-resistant but not on marrow derived cells. TNFR null chimeras (KO to KO) were least injured despite having a relatively greater Pc burden than the remaining chimeras. Interestingly, in vitro Pc-dependent induction of chemokines in alveolar epithelial cells occurs independently of TNFRs (23), which may explain the inflammation and physiologic impairment observed even in the TNFR null mice. In vivo, TNFR deficient models indicate that maximal inflammation that correlates with clinically significant loss of weight, pulmonary function and in death requires parenchymal TNFR responses. TNFR expression limited to marrow derived cells was sufficient to generate Pc-stimulated lung injury and to augment loss of pulmonary function and weight loss but was much less apt to cause mortality, and was associated with reduced MCP-1, KC and TNF production, intra-alveolar cell death (by LDH) and recruitment of lavagable cells. As previously observed, the severity of lung injury was not directly related to Pneumocystis burden (24, 25). Reduction in lung compliance weakly correlated with Pc burden but only in the presence of parenchymal TNFR function, which may reflect inhibition of surfactant production or function (9). The global TNFR null mice carried the greatest Pc burden but the least evidence of injury consistent with a role for TNF in clearance of Pc as previously demonstrated (9). In the current study, the parenchymal cell null, marrow WT animals maintained the lowest burden of organism suggesting that TNF stimulates immune cells to remove the organism. It has also been suggested that adherence of Pc to lung epithelial cells enhances proliferative growth of the organism (26). The absence of parenchymal TNFRs may reduce Pc-epithelial cell adherence, reducing the organism's growth potential and, potentially, leaving it more accessible to immune cell clearance. Further study is necessary to clarify this observation.
Accumulation of inflammatory cells and LDH in the bronchoalveolar space was parenchymal cell TNFR dependent. Although each of the chimeras developed some degree of lung injury there was a marked increase in numbers of inflammatory cells recruited to the lavagable air space in WT recipient mice, particularly when the bone-marrow derived, recruited inflammatory cells did not express the TNFRs. No increase in total lavagable cell counts was detected in the absence of parenchymal TNF signal transduction. The differential of the BALF cells was altered in response to Pc; infiltration by neutrophils and lymphocytes occurred in all chimeras but was exacerbated by the presence of parenchymal TNFRs. Flow cytometry suggested marked increases in the percentage of lymphocytes that are CD8+ in all Pc exposed groups with no difference between chimera groups. However, when considered as absolute number of lavagable cells, maximal increase in recruitment of CD8+ T-cells was seen in the TNFR WT recipient chimeras. This is consistent with a significant role for parenchymal TNFR signal transduction in the recruitment of these cells that have been shown to mediate Pc-induced lung injury in this CD4+ T-cell depleted model. It is noted that despite markedly increased inflammatory cell infiltration mediated by parenchymal TNFRs, the KO to WT chimeras were unable to control the Pc burden any better than the fully WT mice. This is consistent with the failure of sensitized CD8+ T cells to control organism burden, however the failure of enhanced macrophage numbers in this chimera to control the Pc again supports the role of TNF stimulation of the immune cells in Pc clearance
A significant contribution of parenchymal cell TNF responses to lung injury induced by pathogens has been previously demonstrated. For example, CD8+ T-cell recognition of alveolar cells expressing a specific viral antigen triggered MCP-1 and MIP-2 expression by the lung epithelial cells in large part due to T-cell transmembrane TNF (tmTNF) and the presence of TNFRsf1a on the epithelium (27, 28). In addition, a study of alveolar macrophages in patients with acute respiratory distress syndrome (ARDS) demonstrated enhanced tmTNF correlated with severity of disease although soluble TNF concentrations in the BAL did not (29), suggestive of the importance of inflammatory cell bound TNF interacting with parenchymal receptors. Since tmTNF is an active signaling molecule, the expression of TNFRs on parenchymal cells constitute a mechanism for intercellular communication with tmTNF expressing immune cells. In this way, TNF expressed by inflammatory cells may have enhanced capacity to either induce cytotoxicity or to stimulate pro-inflammatory protein production by the structural cells of the lung. In the case of Pc, the epithelial cells are anchors for the organism and so are best positioned to stimulate or amplify a local host response. Prior studies also suggest that CD8+ T-cell mediated Pc-induced lung damage is dependent on MHC class I expression by radio-resistant cells (6). Intracellular Pc antigen processing or presentation by alveolar epithelial cells has not yet been demonstrated but is feasible. Intercellular TNF-TNFR interactions may enhance such lymphocyte-epithelial cell interactions.
As well as TNFα, the TNF receptors also bind and transduce signal of the homotrimeric ligand, lymphotoxin alpha, previously known as TNFβ. LTα also signals by forming heterotrimers with LTβ that bind the LTβ receptors. Removal of the TNF receptors therefore prevents signal transduction by homotrimeric LTα, as well as by TNFα. The phenotypes observed in the current study are then the result of manipulating both TNFα and LTα activity. Due to the strong relationship previously established between TNFα and progression of PcP it is thought likely that it is primarily the effect of TNFα signal transduction via TNF receptor activity that has been altered in this study. No regulation or role of LTα in PcP has been clearly demonstrated to date. Whether or not PcP is altered by LTα binding of TNF receptors on parenchymal or bone marrow cells however remains to be studied potentially by anti-ligand antibody or ligand specific knockout transgenic models.
The TNF sf1a receptor has been demonstrated to be necessary for normal development and maintenance of splenic B cell follicles and germinal centers (30-32). In mice deficient in either lymphotoxin-alpha (LT-alpha) or the type I tumor necrosis factor (TNF) receptor, but not the type II TNF receptor, germinal centers failed to develop in peripheral lymphoid organs. While the chimeras in the current study have not been tested for germinal centers, it is highly unlikely that a reduction or failure of antibody production in response to Pc accounts for the differences in PcP between the CD4+Tcell depleted chimeras studied given the known role of these lymphocytes in producing anti-Pc antibodies. Even when Pc-infected SCID mice are given Pc-sensitized lymphocytes, CD4+ T cells are required for an antibody response to be generated (25). In addition, non-immunized, CD4-depleted mice, directly analogous to the animals tested in the current study, do not make an antibody response to Pc (33). Therefore, none of the chimeras tested in this study would have had antibody response to Pc regardless of presence or absence of TNF receptors.
Macrophage predominance persisted and was amplified in the BALF of KO to WT mice, in contrast to the other chimeras. This occurred in association with exaggerated production of the CC chemokine MCP-1, documented by increased tissue mRNA as well as BAL protein concentrations. Since MCP-1 is a chemoattractant for lymphocytes as well as macrophages, it is possible that parenchymal response to TNF results in enhanced induction of MCP-1 from epithelial cells, for example, that in turn would increase recruitment of these cells. This model would be consistent with the viral model in which CD8+ T-cell tmTNF stimulates alveolar epithelial cells to produce MCP-1 (34). It is also possible that activation of parenchymal cells by Pc-induced TNF causes release of other chemo-attractants that enhance the recruit of inflammatory cells that become the source of MCP-1. Further analysis of the current model will determine the source of the CC chemokine. Previous studies suggest that CD8+ T-cells, even stimulated by specific recognition of alveolar epithelial cells, do not produce MCP-1 while the target cells do (28). In contrast, in situ hybridization in the SCID mouse model of PcP demonstrated the primary location of MCP-1 mRNA to be the type II epithelial cells (23). Maximal MCP-1 production occurs in the absence of hematogenous cell TNFRs so direct TNF stimulation of macrophages is not the source.
The alveolar macrophage numbers and MCP-1 induction was not as marked in the WT to WT chimera as in the KO to WT which is suggestive not only of a role for TNFR stimulation of parenchyma in production of this chemokine in response to Pc but also of a suppressive effect of TNFRs in the marrow derived cells. One potential explanation for immune cell TNFR mediated suppression of Pc-induced lung inflammation is that in the absence of TNFRs, inflammatory cells recruited to the lung fail to undergo TNF induced apoptosis, an important system of regulation of inflammation. Further studies of cellular turn-over in the current model are indicated.
MCP-1 and MIP-2 have both been implicated in the pathogenesis of PcP having been shown to be induced by Pc and by TNF, as well as correlating with severity of disease in WT and TNFRKO mice. In this Pc-chimera model however, independent regulation of the two chemokines was observed. In vitro studies with Pc stimulated primary alveolar type II cells suggested that MCP-1 was induced by Pc directly and that this induction was dependent on both NF-κB and JNK activity (23). Preliminary data suggests a synergistic induction of MCP-1 from lung epithelial cells exposed to both Pc and TNF (data not shown). In contrast, MIP-2, similarly induced by direct Pc interaction with epithelial cells was unaffected by JNK inhibitors, consistent with differential regulation of the two chemokines and perhaps greater dependence of MIP-2 gene expression on NF-κB of which TNF is a most potent stimulant. Considering the RNA measurements, while maximal MCP-1 induction was dependent on parenchymal cell signaling in the absence of immune cell receptors, MIP2 induction was maximal when both cell compartments could respond to TNF, inducing a three-fold increase over that in the mixed chimeras.
One or both of the two distinct receptors, TNFRsf1a and TNFRsf1b receptors have been identified on the majority of lung cells tested, including type II pneumocytes, although their relative ratio varies by cell type and can be altered by stimulation (35-38). In most studies, TNFRsf1a is constitutively expressed while TNFRsf1b expression is inducible. The predominant receptor, by mRNA, in mouse and human lung is TNFRsf1a, although TNFRsf1b is induced by many stimuli including TNF delivery and Pc infection (9). A differential role of the two receptors in PcP has not yet been clarified. Like TNF, the TNFRs are also targets for matrix metalloproteinases. Soluble TNFRs (sTNFR) may act as a reservoir of soluble TNF or as circulating inhibitors of both soluble and tmTNF. In this study, we demonstrated that Pc infection induces shedding of these receptors and accumulation of soluble (s)TNFRsf1a and TNFRsf1b both in serum and BAL of mice. Whether soluble TNFR levels may be useful as biomarkers reflecting the severity of PcP, or may have a physiological role in disease, is not yet determined. Interestingly, BMT chimera experiments suggest that in the basal, healthy state, the majority of circulating sTNFR sf1a originates from parenchyma while bone marrow derived cells appear to be the source of >50% of sTNFRsf1b. In PcP, both sTNFRsf1a and sTNFRsf1b originated from both parenchymal and marrow derived cells. Although the quantity of soluble TNFR present in serum or BALF have been shown to mirror the severity of other diseases, the regulation and function of TNFR solubilization remain unclear. sTNFRs may be involved in controlling the TNF response during the generation of an immune response. The KO to WT chimeras had reduced sTNFR and enhanced inflammatory response relative to WT to WT. It is possible that the lack of soluble receptors acting as competitive inhibitors contributes to the enhanced injury documented in the mixed chimeras. Alternatively, expression of membrane-bound TNFRs may create a feedback loop that regulates TNF transcription. Increased TNF production was documented in this study but only in the KO to KO mice, suggesting that TNF feedback on either marrow derived or parenchymal cells is sufficient to regulate the ligand.
The current study demonstrates that TNFRs on parenchymal cells, those resistant to split dose irradiation, are sufficient to mount an inflammatory response to Pc even if marrow derived cells are receptor null, comparable or in excess of that generated when all cells express the receptors. The relative importance of epithelial, endothelial or mesenchymal cell TNFR responses, as well as the source of the stimulating TNF, remains to be determined. Limitation of TNFR distribution to marrow-derived cells improved control of Pc burden and reduced the injurious host response, best demonstrated in this study by improved survival and cellular recruitment as compared to normal receptor expression. Limitation of TNFR distribution to parenchymal cells markedly worsened the inflammatory response and resulting injury. The results of this study support the notion that therapeutic interventions that inhibit parenchymal cell TNF signal transduction, while maintaining or enhancing immune cell TNFR responses, analogous to the WT to KO chimeras, could be effective both in limiting Pc burden and in limiting the injurious host inflammatory response. Alternatively, global anti-TNF treatment, if given as an adjunctive therapy to the currently used and effective anti-Pc drugs, could also have benefit for patients with severe PcP by reducing the immune aspects of PcP-related lung injury.
Figure 8
Figure 8
Cytokines in BALF and whole lung isolated from Pc infected TNFR chimeric mice four weeks after infection. TNF, MIP-2, MCP-1 and KC were assessed by ELISA in A) BAL fluid and B) homogenized lung tissue. C) MIP-2, MCP-1, KC, RANTES and IL-10 were measured (more ...)
Acknowledgments
The technical assistance of Jane Malone and Min Yee is greatly appreciated.
Footnotes
1The authors gratefully acknowledge funding of this work by NIH grants P01HL71659, R01HL077415, R01HL064559 and P30ES01247 and the Strong Children's Research Center.
1. Dei-Cas E. Pneumocystis infections: the iceberg? Med Mycol. 2000;38 1:23–32. [PubMed]
2. Mansharamani NG, Garland R, Delaney D, Koziel H. Management and outcome patterns for adult Pneumocystis carinii pneumonia, 1985 to 1995: comparison of HIV-associated cases to other immunocompromised states. Chest. 2000;118:704–711. [PubMed]
3. Randall Curtis J, Yarnold PR, Schwartz DN, Weinstein RA, Bennett CL. Improvements in outcomes of acute respiratory failure for patients with human immunodeficiency virus-related Pneumocystis carinii pneumonia. Am J Respir Crit Care Med. 2000;162:393–398. [PubMed]
4. Vahid B, Bibbo M, Marik PE. Role of CD8 lymphocytes and neutrophilic alveolitis in Pneumocystis jiroveci pneumonia. Scand J Infect Dis. 2007;39:612–614. [PubMed]
5. Wright TW, Gigliotti F, Finkelstein JN, McBride JT, An CL, Harmsen AG. Immune-mediated inflammation directly impairs pulmonary function, contributing to the pathogenesis of Pneumocystis carinii pneumonia. J Clin Invest. 1999;104:1307–1317. [PMC free article] [PubMed]
6. Meissner NN, Lund FE, Han S, Harmsen A. CD8 T cell-mediated lung damage in response to the extracellular pathogen pneumocystis is dependent on MHC class I expression by radiation-resistant lung cells. J Immunol. 2005;175:8271–8279. [PubMed]
7. Kaur N, Mahl TC. Pneumocystis jiroveci (carinii) pneumonia after infliximab therapy: a review of 84 cases. Dig Dis Sci. 2007;52:1481–1484. [PubMed]
8. Kolls JK, Lei D, Vazquez C, Odom G, Summer WR, Nelson S, Shellito J. Exacerbation of murine Pneumocystis carinii infection by adenoviral-mediated gene transfer of a TNF inhibitor. Am J Respir Cell Mol Biol. 1997;16:112–118. [PubMed]
9. Wright TW, Pryhuber GS, Chess PR, Wang Z, Notter RH, Gigliotti F. TNF receptor signaling contributes to chemokine secretion, inflammation, and respiratory deficits during Pneumocystis pneumonia. J Immunol. 2004;172:2511–2521. [PubMed]
10. Peschon JJ, Torrance DS, Stocking KL, Glaccum MB, Otten C, Willis CR, Charrier K, Morrissey PJ, Ware CB, Mohler KM. TNF Receptor-Deficient Mice Reveal Divergent Roles for p55 and p75 in Several Models of Inflammation. J Immunol. 1998;160:943–952. [PubMed]
11. Theise ND, Badve S, Saxena R, Henegariu O, Sell S, Crawford JM, Krause DS. Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology. 2000;31:235–240. [PubMed]
12. Amdur MO, Mead J. Mechanics of respiration in unanesthetized guinea pigs. Am J Physiol. 1958;192:364–368. [PubMed]
13. Meissner NN, Swain S, Tighe M, Harmsen A, Harmsen A. Role of type I IFNs in pulmonary complications of Pneumocystis murina infection. J Immunol. 2005;174:5462–5471. [PubMed]
14. Pryhuber GS, O'Brien DP, Baggs R, Phipps R, Huyck H, Sanz I, Nahm MH. Ablation of tumor necrosis factor receptor type I (p55) alters oxygen-induced lung injury. Am J Physiol Lung Cell Mol Physiol. 2000;278:L1082–1090. [PubMed]
15. Lee LH, Gigliotti F, Wright TW, Simpson-Haidaris PJ, Weinberg GA, Haidaris CG. Molecular characterization of KEX1, a kexin-like protease in mouse Pneumocystis carinii. Gene. 2000;242:141–150. [PubMed]
16. Wallach D, Engelmann H, Nophar Y, Aderka D, Kemper O, Hornik V, Holtmann H, Brakebusch C. Soluble and cell surface receptors for tumor necrosis factor. Agents Actions. 1991;35:51–57. [PubMed]
17. Wajant H, Pfizenmaier K, Scheurich P. Tumor necrosis factor signaling. Cell Death Differ. 2003;10:45–65. [PubMed]
18. Parsons PE, Matthay MA, Ware LB, Eisner MD. Elevated plasma levels of soluble TNF receptors are associated with morbidity and mortality in patients with acute lung injury. Am J Physiol Lung Cell Mol Physiol. 2005;288:L426–431. [PubMed]
19. Chen W, Havell EA, Harmsen AG. Importance of endogenous tumor necrosis factor alpha and gamma interferon in host resistance against Pneumocystis carinii infection. Infect Immun. 1992;60:1279–1284. [PMC free article] [PubMed]
20. Kolls JK, Beck JM, Nelson S, Summer WR, Shellito J. Alveolar macrophage release of tumor necrosis factor during murine Pneumocystis carinii pneumonia. Am J Respir Cell Mol Biol. 1993;8:370–376. [PubMed]
21. Hoffman OA, Standing JE, Limper AH. Pneumocystis carinii stimulates tumor necrosis factor-alpha release from alveolar macrophages through a beta-glucan-mediated mechanism. J Immunol. 1993;150:3932–3940. [PubMed]
22. Evans SE, Hahn PY, McCann F, Kottom TJ, Pavlovic ZV, Limper AH. Pneumocystis cell wall beta-glucans stimulate alveolar epithelial cell chemokine generation through nuclear factor-kappaB-dependent mechanisms. Am J Respir Cell Mol Biol. 2005;32:490–497. [PMC free article] [PubMed]
23. Wang J, Gigliotti F, Bhagwat SP, Maggirwar SB, Wright TW. Pneumocystis stimulates MCP-1 production by alveolar epithelial cells through a JNK-dependent mechanism. Am J Respir Cell Mol Biol. 2007;292:L1495–1505. [PubMed]
24. Gigliotti F, Wright TW. Immunopathogenesis of Pneumocystis carinii pneumonia. Expert Rev Mol Med. 2005;7:1–16. [PubMed]
25. Gigliotti F, Crow EL, Bhagwat SP, Wright TW. Sensitized CD8+ T cells fail to control organism burden but accelerate the onset of lung injury during Pneumocystis carinii pneumonia. Infect Immun. 2006;74:6310–6316. [PMC free article] [PubMed]
26. Kottom TJ, Kohler JR, Thomas CF, Jr, Fink GR, Limper AH. Lung epithelial cells and extracellular matrix components induce expression of Pneumocystis carinii STE20, a gene complementing the mating and pseudohyphal growth defects of STE20 mutant yeast. Infect Immun. 2003;71:6463–6471. [PMC free article] [PubMed]
27. Zhao MQ, Amir MK, Rice WR, Enelow RI. Type II pneumocyte-CD8+ T-cell interactions. Relationship between target cell cytotoxicity and activation. Am J Respir Cell Mol Biol. 2001;25:362–369. [PubMed]
28. Zhao MQ, Stoler MH, Liu AN, Wei B, Soguero C, Hahn YS, Enelow RI. Alveolar epithelial cell chemokine expression triggered by antigen-specific cytolytic CD8(+) T cell recognition. J Clin Invest. 2000;106:R49–58. [PMC free article] [PubMed]
29. Armstrong L, Thickett DR, Christie SJ, Kendall H, Millar AB. Increased expression of functionally active membrane-associated tumor necrosis factor in acute respiratory distress syndrome. Am J Respir Cell Mol Biol. 2000;22:68–74. [PubMed]
30. Alexopoulou L, Pasparakis M, Kollias G. Complementation of lymphotoxin alpha knockout mice with tumor necrosis factor-expressing transgenes rectifies defective splenic structure and function. J Exp Med. 1998;188:745–754. [PMC free article] [PubMed]
31. Matsumoto M, Mariathasan S, Nahm MH, Baranyay F, Peschon JJ, Chaplin DD. Role of lymphotoxin and the type I TNF receptor in the formation of germinal centers. Science. 1996;271:1289–1291. [PubMed]
32. Pasparakis M, Kousteni S, Peschon J, Kollias G. Tumor necrosis factor and the p55TNF receptor are required for optimal development of the marginal sinus and for migration of follicular dendritic cell precursors into splenic follicles. Cell Immunol. 2000;201:33–41. [PubMed]
33. Harmsen AG, Chen W, Gigliotti F. Active immunity to Pneumocystis carinii reinfection in T-cell-depleted mice. Infect Immun. 1995;63:2391–2395. [PMC free article] [PubMed]
34. Zhao MQ, Foley MP, Stoler MH, Enelow RI. Alveolar epithelial cell chemokine expression induced by specific antiviral CD8+ T-cell recognition plays a critical role in the perpetuation of experimental interstitial pneumonia. Chest. 2001;120:11S–13S. [PubMed]
35. Abdolrasulnia R, Shepherd VL. Purification of type I and type II tumor necrosis factor receptors from human lung tissue. Am J Respir Cell Mol Biol. 1992;7:42–48. [PubMed]
36. Schimomoto H, Hasegawa Y, Nozaki Y, Takagi N, Shibagaki T, Nakao A, Shimokata K. Expression of Tumor Necrosis Factor receptors in human lung cancer cells and normal lung tissues. Am J Resp Cell Mol Biol. 1995;15:271–278. [PubMed]
37. Brockhaus M, Schoenfeld HJ, Schlaeger EJ, Hunziker W, Lesslauer W, Loetscher H. Identification of two types of tumor necrosis factor receptors on human cell lines by monoclonal antibodies. Proc Natl Acad Sci U S A. 1990;87:3127–3131. [PubMed]
38. Pryhuber GS, Huyck HL, Staversky RJ, Finkelstein JN, O'Reilly MA. Tumor necrosis factor-alpha-induced lung cell expression of antiapoptotic genes TRAF1 and cIAP2. Am J Respir Cell Mol Biol. 2000;22:150–156. [PubMed]