Search tips
Search criteria 


Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Int J Oncol. Author manuscript; available in PMC 2010 May 1.
Published in final edited form as:
PMCID: PMC2668130

Stat3-siRNA Induces Fas-mediated Apoptosis in vitro and in vivo in Breast Cancer


Stat3, a member of the signal transducer and activator of transcription family, has the potential to mediate cell survival, growth and differentiation. Stat3 is constitutively activated in numerous cancers, including more than 50% of breast cancers. Previous studies demonstrated that constitutively activated Stat3 plays an important role in breast cancer development and progression by promoting cell proliferation and inhibiting apoptosis. The present study was designed to investigate the potential use of RNA interference (RNAi) to block Stat3 expression and activation, as well as the subsequent effect on human breast cancer cell growth. Our studies show that knockdown of STAT3 expression by siRNA reduced expression of Bcl-xL and survivin in MDA-MB-231 cells, and also led to Fas mediated intrinsic apoptotic pathway by activating Caspases -8, -9, -3 and PARP 1 cleavage. In nude mice, pRNAi-Stat3 significantly suppressed tumor growth compared with controls. It also suppressed Stat3 expression, and downregulated BcL-xL and upregulated Fas, Fas-L and cleaved Caspase 3 expression within the tumor, which significantly induced apoptosis and led to tumor suppression. Thus, targeting Stat3 signaling using siRNA may serve as a novel therapeutic strategy for the treatment of breast cancers expressing constitutively activated Stat3.

Keywords: Stat3, apoptosis, Fas/Fas-L


The STAT (signal transducer and activator of transcription) family of proteins are transcription factors known for their role as integrators of cytokine and growth factor receptor signaling and are required for cell growth, survival, differentiation, motility and survival (1-3). Among the seven members of the mammalian STAT family, Stat3 has been most strongly implicated in oncogenesis. Stat3 is ubiquitously expressed in mammalian cells and activated by cytokines (e.g., IL-6 family members), growth factors (e.g., EGF, PDGF), and the plasminogen activator system (4,5). Tyrosine phosphorylation is pivotal for STAT activation, which in turn, leads to dimerization and translocation into the nucleus. The translocated activated Stat3 binds to the consensus promoter sequences of target genes and initiates their transcription (6,7). This tyrosine phosphorylation is transient in normal, non-transformed cells. In contrast, it is constitutively activated in the majority of cancer cell lines and a large number of primary tumors (6).

The expression of a constitutively active form of Stat3 (STAT3C) into immortalized human breast epithelial cells mediated de novo tumorigenesis, thereby demonstrating the sufficiency of this transcription factor in promoting cellular transformation (8). Stat3 is constitutively activated in more than 50% of primary breast tumors and tumor-derived cell lines. Abundant evidence shows that constitutively activated Stat3 is frequently found in breast cancer samples (9). Thus, the Stat3 signaling pathway may represent a new molecular target for novel therapeutic approaches for breast cancer.

Strategies that target Stat3 signaling have been proposed including tyrosine kinase inhibitors (e.g., tyrphostin AG490 and cucurbitacin I), antisense oligonucleotides, decoy oligonucleotides, and dominant negative Stat3 protein (10-15). A more recent study demonstrated that Stat3 knockdown by RNA interference (RNAi) induced apoptosis in human neuron tumor cells and prostate cancer cells (16,17). Stat3 participates in oncogenesis through the upregulation of genes encoding apoptosis inhibitors (Bcl-xL, Bcl2 and survivin) (18). Inhibition of Stat3 activity reduced the expression of survivin in primary effusion lymphoma-induced cell apoptosis (19). Proteins of the Bcl-2 family are important regulators of the decision between survival or death in response to an apoptotic stimulus (20). Many studies have repeatedly demonstrated that the inhibition of STAT results in growth inhibition and induction of apoptosis in tumor cells harboring constitutive activation of Stat3 (21,22). One possible explanation for the increased sensitivity of transformed cells to apoptosis compared with normal cells is that tumor cells may have become irreversibly dependent on STAT signaling to sustain their survival. The observed dependence of certain tumors, but not normal cells, on constitutive STAT activation for survival offers the potential for preferential tumor cell killing, and therefore, STAT inhibition has broad implications for cancer therapy

Small interfering RNA (siRNA) are short double-stranded RNA molecules that can target complementary mRNA for degradation via a cellular process termed RNA interference (RNAi). RNAi is usually accomplished by introducing long double-stranded RNA molecules into cells. These RNA molecules are then cleaved into 21-nt to 23-nt RNA (known as siRNA) by an endonuclease (Dicer) in animal cells. The siRNA molecules then serve as a guide for sequence-specific degradation of homologous mRNA (23). The present study was designed to investigate the potential use of siRNA to block Stat3 expression and the subsequent effect on growth of human breast cancer cells. We identified siRNA specific for Stat3 and expressed the siRNA in breast cancer cells. Our results demonstrate that siRNA-mediated downregulation of Stat3 expression inhibits the growth of human breast cancer cells and induces apoptotic cell death. These results demonstrate that targeting Stat3 signaling using the siRNA technique may serve as a novel therapeutic strategy for the treatment of breast cancers expressing constitutively activated Stat3.


Construction of plasmids that contain DNA templates for the synthesis of siRNAs were constructed under the control of the CMV promoter

pDNR-CMV (Clontech Laboratories, Inc. CA, USA) was used for DNA vector-based siRNA synthesis under the control of CMV promoter in vivo. In brief, first, the double stranded DNA template encoding siRNA oligonucleotides (GeneBank: access numbers for the human Stat3: NM003150) that contained a sense strand of 19 nucleotide sequences followed by a short space (TTCAAGAGA), the reverse complement of the sense strand, and five thymidines as a RNA polymerase III transcriptional stop signal were synthesized. The sequences were forward 5′-TCGAGTCAGGTTGCTGGTCAAATTCGAGTCGTCGGAATTTGACCAGCAACCT GACTTTTT-3′ and reverse 5′ CTAGAAAAAGTCAGGTTGCTGGTCAAATTCCGACGACTCGAATTTGACCAGC AACCTGAC-3' (locate on SH2 domain). The oligonucleotides were annealed in a buffer (potassium actate 100 mmol/L, 30 mmol/L HEPES-KOH pH 7.4, and magnesium acetate 2 mmol/L) and the mixture was incubated at 90 °C for 3 min and then at 37 °C for 1 h. The double stranded oligos were cloned into the ApaI-EcoR I sites of the pDNR-CMV vector (Ambion Inc) where short hairpin RNAs (shRNA) were expressed under the control of the CMV promoter.

Antibodies and reagents

Primary antibodies against Stat3, MMP-2, MMP-9, PARP-1, GAPDH, HRP/FITC/Texas Red conjugated secondary antibodies were obtained from Biomeda (Foster City, CA); anti-caspases 8, 3 and 9 were from Cell Signaling (Boston, MA); cleaved Bid, Bax, Bcl-xL, Fas-L, FADD and mouse IgG were from Santa Cruz Biotechnology (Santa Cruz, CA); and Fas and cytochrome c were from Calbiochem (San Diego, CA). BCA reagent (Pierce, Rockford, IL), ECL reagent (Amersham Pharmacia, Piscataway, NJ), DAPI nuclear staining mounting solution (Vector Laboratories, Burlingame, CA), DAB peroxidase substrate (Sigma, St Louis, MO), TUNEL Detection kit (Roche Molecular Biochemicals Indianapolis, IN) and Annexin-V-FITC Apoptosis Detection Kit (BioVision Mountain View, CA) were used for this study. pStat3-C (constructs of constitutively activated Stat3) was purchased from Addgene Inc. (Cambridge, MA) (Addgene plasmid 8722)

Cell culture and treatments

MDA-MB-231 human breast cancer cells were purchased from the American Type Culture Collection (Manassas, VA) and cultured in DMEM supplemented with 10% FBS in a humidified CO2 incubator at 37°C. MDA-MB-231 cells were serum-starved for 12-18 h, transfected with a plasmid siRNA construct against STAT3 using FuGENE HD transfection reagent according to the manufacturer's protocol (Roche Diagnostics Corporation, Indianapolis, IN), and incubated in humidified CO2 atmosphere at 37°C for 6-8 h. The necessary amount of culture medium was then added and cells were returned to the incubator for 36h for few of the initial experiments and 48h for remaining experiments. For blocking Fas-L on MDA-MB-231 cells, the serum-starved cells were treated with 10 ug/ml of anti-Fas-L antibody or non-specific IgG for 1h prior to the treatment of pRNAi-Stat3 treatment.

Cytosolic and mitochondrial protein extraction

Cytosolic and mitochondrial fractions were isolated from control, pSV and pRNAi-Stat3-treated cells as described elsewhere (24). Cross-contamination of cytosol and mitochondria was determined on the basis of the amount of activity of marker enzymes for cytosol (lactate dehydrogenase [LDH] and mitochondria (succinate dehydrogenase [SDH]. Protein levels in the samples were determined with Bio-Rad protein assay kit and analyzed by immunoblot using anti-cytochrome-C and anti-smac/DIABLOantibodies.

Western blot analysis

MDA-MB-231 cells were transfected with pSV or pRNAi- Stat3 as described above. After incubation, the cells were washed with ice-cold PBS and lysed in RIPA buffer containing protease inhibitors. Whole cell extracts were subjected to SDS-PAGE and subsequently transferred to a polyvinylidene difluoride membrane (PVDF) (Bio-Rad, Hercules, CA). The membranes were blocked with 7% nonfat dry milk and probed with antibodies [anti- Stat3, p Stat3]. Appropriate antibody conjugated with horseradish peroxidase was used as the secondary antibody, and membranes were developed according to an enhanced chemiluminescence protocol according to manufacturer's instructions.

Immunocytochemical analysis

MDA-MB-231 cells were transfected with pSV or pRNAi-Stat3 as described above. After incubation, cells were fixed with 4% formaldehyde and incubated with 3% bovine serum albumin in PBS at room temperature for 1 h for blocking. After the coverslips were washed with PBS, anti-STAT3 mouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA) was added at a concentration of 1:200. The slides were incubated at 4°C overnight and washed 3 times with PBS to remove excess primary antibody. Cells were then incubated with anti-mouse Texas red conjugate or anti-mouse FITC conjugates IgG (1:500 dilution) for 1 h at room temperature. The slides were then washed 3 times and covered with glass coverslips using Vectashield HardSet mounting medium with DAPI (Vector Laboratories, Burlingame, CA). Cells were viewed under a fluorescent microscope.

Electromobility shift assay (EMSA) and Western blotting

Nuclear extracts were prepared from MDA-MB-231 cells transfected with pSV or pRNAi-Stat3 as described above. Cells were detached with EDTA and resuspended in buffer A (10 mM HEPES [N-2-hydroxyethylenepiperazine-N'-2-ethanesulfonic acid], pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol [DTT]) containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride [PMSF], 5 mM iodoacetamide, 0.1 mM quercetin, 10 μg/mL aprotinin, 10 μg/mL leupeptin, 0.3 mM sodium vanadate) and incubated on ice for 15 min. After homogenization using a Wheaton 0.1-mL homogenizer, the nuclei were collected by centrifugation. The pellet was resuspended in buffer B (20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.5 mM DTT) containing protease inhibitors and was incubated on ice for 30 min, followed by centrifugation at 13,000g (5 min, 4°C). The supernatant was dialyzed against buffer C (20 mM HEPES, 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT) containing protease inhibitors for 2 h at 4°C, followed by centrifugation at 13,000g (5 min at 4°C). The supernatant proteins were used immediately or aliquoted and stored at -80°C.

Binding reaction was performed for 30 min on ice in a volume of 20 μL, which contained 4 μg nuclear protein extracts, 40 ng poly(dI-dC), 4 μL 5X binding buffer (1X binding buffer: 20 mM HEPES, pH 7.9, 50 mM KCl, 5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 10% glycerol) with or without 20- to 50-fold excess of cold competitor or of unrelated competitor and a 32P-labeled probe (3×104 cpm). For the supershift electrophoretic mobility shift assay (EMSA), protein extracts were incubated with 6 μg STAT3 and HIF-1α monoclonal antibody or non-specific IgG as control before the addition of the 32P-labeled probe. DNA-protein complexes were separated on 5% polyacrylamide gel in Tris/glycine buffer at 4°C. The following double-stranded oligonucleotides purchased from Santa Cruz Biotechnology (Santa Cruz, CA) were used in this study: Stat3 CONSENSUS OLIGONUCLEOTIDE: sc-2571 5' - GAT CC T TCT GGG AAT TCC TAG ATC - 3' 3' - CTA GGA AGA CCC TTA AGG ATC TAG - 5' Five end-labeled probes were prepared with 40 μCi (1480 MBq) [γ-32P] adenosine triphosphate (ATP) using T4 polynucleotide kinase. Probes were gel-purified on NAP-5 Sephadex G-25 DNA-grade columns.

Animal experiments

MDA-MB-231 cells were cultured in complete medium until 70-75% density was reached. Then, cells were trypsinized, washed once with serum-free medium and counted. Cells were injected bilaterally into the second mammary fat pads of athymic, female, 4 to 6-week-old nu/nu mice (5×106/100 μL serum-free culture medium). Tumor growth was monitored daily. Once a tumor reached a size of approximately 6-8 mm, three doses of 150 μg/animal of either pSV or pRNAi-Stat3 were given intraperitoneally on alternate days. One set of animals were sacrificed for tumors after of treatment while a second set of animals was kept under observation for a period of 6 weeks. Finally, the tumor volume was calculated using the formula V = pi/6 (a × b × c).

Immunohistochemical analysis

Tumor samples fixed in 10% neutral buffered formalin were embedded in paraffin using automatic embedding equipment. Five μm sections were prepared. Paraffin-embedded breast tumor sections of control mice and mice treated with pSV and pRNAi-Stat3were analyzed for Stat3, Fas and Fas-L using immunohistochemistry.

Apoptosis assay

Apoptosis was determined through the analysis of externalization of plasma membrane phosphatidylserine (PS) and TUNEL assay.

Annexin V-FITC apoptosis detection assay

An increase in the plasma membrane PS externalization occurs early in apoptosis and can be detected by annexin V staining. MDA-MB-231 cells were treated with pRNAi-Stat3 as described above. After 96 h, cells were isolated and stained with annexin V-FITC (BioVision Research Products, Mountain View, CA). Cells were analyzed using FACS for fluorescence of annexin V-positive cells.

TUNEL assay

TUNEL assay was performed with paraformaldehyde-fixed, MDA-MB-231 cells as per the manufacturer's protocol (Roche Diagnostics Corporation, Indianapolis, IN). Briefly, the TUNEL (Terminal deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling) method identifies apoptotic cells in situ by using terminal deoxynucleotidyl transferase (TdT) to transfer biotin-dUTP to the free 3'-OH of cleaved DNA. The biotin-labeled cleavage sites are then visualized by reaction with fluorescein-conjugated avidin (avidin-FITC). The cells were visualized using a fluorescent microscope with appropriate filter sets. DNA fragmentation in these treated tumors is indicative of apoptotic cell population. Additionally, TUNEL assay was performed with paraformaldehyde-fixed, paraffin-embedded breast tumor sections.

Statistical Analysis

Statistical comparisons were performed using analysis of variance for analysis of significance between different values using GraphPad Prism software (San Diego, CA). Values are expressed as mean ± S.E. from at least three separate experiments, and differences were considered significant at a p value of <0.05. Densitometric analysis was performed using ImageJ software (National Institutes of Health) was used to quantify the band intensities.


pRNAi-Stat3 specifically reduces Stat3 expression in MDA-MB-231 cells

Since Stat3 levels are significantly higher in tumor cells (including breast tumor) than in normal cells, we attempted to determine whether synthetic Stat3 siRNA could inhibit the expression of Stat3 gene in MDA-MB-231 cells. Treatment of MDA-MB-231 cells with pRNAi-Stat3 (vector expressing siRNA for Stat3) for 36h only resulted in a significant decrease of Stat3 expression (by more than 70%) at both protein and mRNA levels compared to the untreated and the vector-treated MDA-MB-231 cells (Fig. 1A & B). Further, we analysed the phosphorylation status of Stat3 in our pRNAi-Stat3-treated MDA-MB-231 cells using sub-cellular fractions. Figures 1A & B showed that in pRNAi-Stat3-treated MDA-MB-231 cells, Stat3-ser-727 phosphorylation was significantly reduced (by more than 75%) in the nuclear extract (NE). Similarly, Stat3-Tyr-705 phosphorylation was significantly reduced (by more than 85%) in the nuclear extract (NE) in cells treated with pRNAi-Stat3 indicating that pRNAi-Stat3 also inhibited the activity of Stat3. In contrast, pTyr705 and pSer727- Stat3 (activated Stat3) was markedly expressed in the untreated and the vector-treated MDA-MB-231 cells (Fig. 1A & B), thereby supporting previous reports that Stat3 is highly activated in the majority of cancer cell lines and in human cancers. So the western analysis revealed that pRNAi-Stat3 inhibited the translocation of Stat3 into the nucleus in MDA-MB-231 cells. The immunocytochemical (ICC) analysis revealed the localization of the majority of Stat3 in the nucleus of the control and vector-treated cells (Fig. 1C). In contrast, total expression including nuclear localization was reduced in the pRNAi-Stat3-treated cells. Furthermore, as shown by EMSA, treatment of MDA-MB-231 cells with pRNAi-STAT3 resulted in reduced DNA-binding activity of Stat3 as compared to the control and vector-treated cells (Fig. 1D). The specificity of the protein-DNA complex was demonstrated by a decrease in the intensity of the Stat3 signal in the nuclear extracts from the control MDA-MB-231 cells treated with anti-Stat3 antibody (as reported by the manufacturer) in the supershift assay.

Figure 1
pRNAi- Stat3 specifically reduces Stat3 expression in MDA-MB-231 cells

pRNAi-STAT3 induces apoptosis in breast cancer cells

In tumors Stat3 is known to regulate the expression of anti-apoptotic genes and to transcriptionally regulate components of the apoptotic pathway (25). We analyzed the effect of treatment of MDA-MB-231 cells with pRNAi-Stat3 on apoptosis. We assessed apoptosis by looking for phosphatidylserine externalization using annexin-V binding and DNA fragmentation (TUNEL) assays. To quantify early and late events in the course of apoptosis, MDA-MB-231 cells were stained with annexin-V-FITC 36 h after pRNAi- Stat3 treatment. As shown by fluorescence-activated cell sorting analysis (Fig. 2A), transfection of MDA-MB-231 cells with pRNAi-Stat3 induced annexin-V expression on the cell surface as compared to control and vector-treated cells. These results confirmed that the cells were undergoing apoptosis. Furthermore, the TUNEL assay results for cells at about 48 h post-transfection indicated a significant increase—nearly 70%— in TUNEL-positive cells in pRNAi-Stat3-treated MDA-MB-231 cells as compared to the controls (Figs. 2B & 2C). In fact, very few TUNEL-positive cells were present in both the control and vector-treated cells. Taken together, these data indicate that Stat3 plays a pivotal role as an anti-apoptotic molecule in breast cancer and targeting Stat3 activity led to the induction of apoptosis.

Figure 2
pRNAi-STAT3 induces apoptosis in breast cancer cells

Inhibition of STAT3 expression downregulates survival genes and induces the activation of Fas/Fas-L and recruitment of Fas-associated death domain (FADD) in MDA-MB-231 cells

The activation of Stat3 has been shown to protect cancer cells from apoptotic stimuli emanating from the Fas (CD95/Apo-1) receptor or chemotherapeutic agents (26). This is accomplished as Stat3 activation results in the transcriptional induction of the Bcl-x gene promoter and high levels of the anti-apoptotic protein Bcl-xL. Thus, elevated levels of Stat3 appear to contribute directly to malignancy in multiple cancer cells by the prevention of apoptosis (25,26). To determine whether these anti-apoptotic molecules are involved in the inhibition of apoptosis in MDA-MB-231 cells, we analyzed the expression of Bcl-xL/S. Using Western blotting, we found significant decreased expression of Bcl-xL (~70%) and increased expression of Bcl-xS (~50%), a pro-apoptotic molecule at the protein level (Fig. 3A and 3B) in MDA MB 231 cells treated with pRNAi-Stat3. Also, the expression of survivin (~60%) was significantly reduced in MDA-MB-231 cells treated with pRNAi-Stat3 (Fig. 3A and 3B). This is noteworthy as survivin, a member of the IAP family, has recently been identified as a novel modulator of the cell death/viability balance in cancer (27). Thus, these data show that Stat3 regulates the expression of anti-apoptotic genes in MDA-MB-231 cells.

Figure 3
Inhibition of STAT3 expression downregulates survival genes and induces the activation of Fas/Fas-L and recruitment of Fas-associated death domain (FADD) in MDA-MB-231 cells

We sought to further elucidate the molecular signaling involved in the apoptotic pathway. Cell membrane death receptor-induced apoptosis is widely studied in breast cancer, particularly in relation to hormonal disturbances (28). We investigated the involvement of death ligands including the Fas ligand (FasL). We found a significant increase in the expression of Fas (~60%) and Fas-L (~50%) in the pRNAi-Stat3-treated cells as compared to the untreated and vector-treated MDA-MB-231 cells (Fig. 3C and 3D). We also assessed the immediate downstream molecule in the death receptor-involved apoptotic pathway. An early event in Fas activation of the apoptosis signaling cascade is the interaction or recruitment of FADD, the adaptor protein, following the interaction of Fas and Fas-L (29,30). We found that pRNAi-Stat3-treated MDA-MB-231 cells showed a significant increase in FADD expression (~30%) as compared to the control and vector-treated MDA-MB-231 cells (Fig. 3C and 3D). To confer the role of Fas/Fas-L in apoptosis in Stat3 downregulated cells, we treated the MDA-MB-231 cells with Fas-L antibody prior to the pRNAi-Stat3 treatment. Figure 3D shows pretreatment of MDA-MB-231 cells with Fas-L antibody followed by pRNAi-Stat3 treatment reduced apoptotic cells by >45% as determined by TUNEL staining.

Downregulation of Stat3 alters pro- and anti-apoptotic gene expression and induces cleavage of PARP-1 and caspases 3, 8 and 9

Some members of the Bcl2 family of proteins suppress apoptosis whereas other members promote apoptosis when activated by phosphorylation [Dai, 2000]. An excess of Bax promotes cell death, but expression of Bcl2 can neutralize this effect [Dai, 2000]. Figure 4A shows that Bax expression increased in pRNAi-Stat3-treated MDA-MB-231 cells as compared to the control and vector-treated cells. On the other hand, Bcl2 expression decreased in pRNAi-Stat3-treated MDA-MB-231 cells while Bcl2 expression was significantly higher in the control and vector-treated cells (Fig. 4A). The functional significance of these expression patterns derives from the potential for heterodimer formation between Bax and Bcl2. A high Bax:Bcl2 ratio enhances the probability for Bax homodimer formation and cell death signaling, whereas a relative abundance of Bcl2 favors formation of Bax/Bcl2 heterodimers and Bcl2 homodimers, which promote cell survival [Dai, 2000]. Hence, we calculated the ratio of Bax expression to Bcl2 expression in the present study. The densitometric analysis showed a high Bax:Bcl2 ratio in the pRNAi-Stat3-treated MDAMB-231 cells (Fig. 4B).

Figure 4
Downregulation of Stat3 alters pro- and anti-apoptotic gene expression and induces cleavage of PARP-1 and caspases 3, 8 and 9

Because the high Bax: Bcl2 ratio enhances cell death signaling, we next determined whether members of the caspase family were activated. Treatment with pRNAi-Stat3 resulted in the cleavage of the effector caspase 3 and the initiator caspases 8 and 9 as compared to the control and vector treatments. Further, we found the cleavage of PARP1 in pRNAi-Stat3-treated MDA-MB-231 cells, in particular, the 85 kDa cleaved fragment was significantly higher in these cells as compared to the control and vector-treated cells (Fig.4C).

The cleavage of caspases is aided by the release of caspase-activating factors, particularly cytochrome C and Smac/Diablo from the mitochondrial membrane into the cytosol (31). In the present study, we found increased signaling for cytochrome C and Smac in the cytosolic fraction of pRNAi-Stat3-treated MDA-MB-231 cells (Fig. 4D). Once released into the cytosol, cytochrome C activates apoptotic protease-activating factor 1 (Apaf-1), which together with pro-caspase 9, forms an active ~700 kDa holoenzyme complex known as the apoptosome (31). Figure 4D shows significantly increased Apaf-1 expression in pRNAi-Stat3-treated MDA-MB-231 cells.

Constitutively activated Stat3 plays a pivotal role in regulating the apoptosis in MDA MB 231 cells

Groner et, al., (26), has shown that Stat3 protects the cancer cells by regulating the expression of Fas. To show that Stat3 plays an important role in regulating the apoptotic cascade in MDA-MB-231 cells, we used the constructs for constitutively activated Stat3 (pStat3-C). To accomplish this, we co-transfected MDA- MB-231 cells with pRNAi-Stat3 and pStat3-C. Figures 5 A & B show the expression of Stat3 is similar to that of control cells in pRNAi-Stat3-treated MDA-MB-231 cells when cotransfected with pStat3-C. Western analysis revealed reduced expression of Fas, Fas-L (by more than 45%), and Bax (by more than 50%) in the co-transfected cells when compared to the pRNAi-Stat3 transfected cells. Additionally, the expression of BcL2 drastically increased (reduced only by 10%) in the co-transfected cells almost equaling the expression the pRNAi-Stat3-treated cells. This represents the importance of activated Stat3 in breast cancer cells in protecting the cells from getting appoptosed and aiding in the growth of the tumor.

Figure 5
Constitutively activated Stat3 plays a pivotal role in regulating the apoptosis in MDA MB 231 cells

pRNAi-Stat3 regresses orthotopic breast tumors in nude mice

After 18 days, pRNAi-Stat3 treatment of orthotopic breast tumors reduced tumor size by more than 60% as compared to the control and vector treatments. Notably, we observed complete tumor regression after 6 weeks of treatment (Figs. 6A). We next determined whether the regression was a result of the induction of apoptosis. To show the efficacy of pRNAi-Stat3 treatment, we used the tumors harvested 18 days after treatment. The tumor tissue was fixed in 10% phosphate buffered formaldehyde and sectioned. The tumor sections were stained with H&E. Quantification of H&E-stained breast tumor sections by a pathologist (blind review) revealed no difference between the control and empty vector-treated groups as well as the presence of a high number of mitotic cells and more aggressive tumor characteristics. However, in the case of pRNAi-Stat3-treated tumor sections revealed nearly a three-fold increase in apoptotic cells (Fig. 6B). TUNEL assay of the tissue sections showed that few TUNEL-positive cells were present in the control and vector-treated tumors. In contrast, more than 4-fold more TUNEL-positive cells were present in the pRNAi-Stat3-treated tumors (Fig. 6B). Western blot analysis revealed that pRNAi-Stat3-treated tumors showed decreased Stat3 expression, increased expression of Fas and Fas-L, increased signal for cleaved Caspase 3 and decreased expression of Bcl-xL when compared to control and pSV-treated tumors (Fig. 6C). In addition, the immunohistochemical analysis of tumor tissue sections revealed increased expression of Fas and Fas-L and decreased expression of Stat3 in pRNAi-Stat3-treated tumors as compared to the control and vector-treated tumors (Fig. 6D).

Figure 6
pRNAi-Stat3 regresses orthotopic breast tumors in nude mice


The evidence that activated Stat3 has a pivotal role in breast tumorigenesis is based on studies of cell lines that express high levels of pStat3 (32). Knocking out Stat3 or blocking the phosphorylation of Stat3 leads to increased apoptosis, chemosensitivity, and decreased angiogenesis in both cell culture and xenograft models (33). Thus, inhibiting Stat3 activity or expression is likely to be an important therapeutic tool for a number of malignancies, including breast cancer.

RNAi represents a promising new technology that could have therapeutic applications for the treatment of diseases by blocking the action of transcription factors and oncogenes with selective silencing of gene expression with exquisite precision and high efficacy (34). In this study, we have identified the Stat3 siRNA that specifically inhibits constitutively activated Stat3 and suppresses cell proliferation and induces apoptosis. One mechanism by which Stat3 participates in tumorigenesis is by inhibiting apoptosis through the induction of anti-apoptotic genes.

The Fas/Fas ligand (Fas L) death pathway is an important mediator of apoptosis. Deregulation of the Fas pathway is reported to be involved in the immune escape of breast cancer and the resistance to anti-cancer drugs. Defects in the Fas/Fas L apoptotic signaling pathway provide a survival advantage to cancer cells and may be implicated in tumorigenesis (35). Significantly, constitutive downregulation of Fas is involved in drug resistance and associated with a poor prognosis in breast cancer. The expression of Fas is downregulated and the expression of Fas-L is upregulated in human breast invasive ductal carcinomas (36).

Numerous investigations have shown apoptosis is mediated by Fas/FasL system in cancer cells treated with anti-cancer agents (37,38). Moreover, anti-cancer drugs are known to enhance FasL expression (39). FasL, which functions as an autocrine/paracrine mediator of apoptosis induced by DNA damaging anti-cancer chemotherapeutic agents, is a member of the TNF superfamily. It induces apoptosis in susceptible cells upon cross-linking to its own receptor, Fas (Apo-1/CD95). Once Fas interacts with Fas-L, it associates with the Fas-associated death domain (FADD) protein through the death domain-death domain interaction. Fas-bound FADD can physically associate with caspase 8. The interaction of caspase 8, an initiator caspase, with FADD results in the activation of caspase 8. This in turn leads to the activation of downstream caspases, including caspases 9 and 3 (40-42), as well as the translocation of Bax to mitochondria and translocation of cytochrome C and Smac/Diablo from the mitochondrial membrane to the cytosol (43-45). Finally, the activated caspases result in the cleavage of PARP-1 (46,47). In the present study, Western blot analysis showed increased expression of Fas and Fas-L in pRNAi-Stat3-treated MDA-MB-231 cells as compared to the control and vector-treated cells. Further, our results showed increases in the expression of Bax in the mitochondrial fraction, Smac/Diablo in the cytosolic fraction, and Apaf-1 in pRNAi-Stat3-treated MDA-MB-231 cells as compared to the control and vector-treated cells.

Moreover, emerging evidence suggests that constitutive activation of Stat3 appears to be ubiquitous in tumors where there is an imbalance in expression levels of anti-apoptotic and apoptotic genes that render tumor cells resistant to apoptosis (17,48). Recent reports indicate Stat3 siRNA can induce apoptosis in astrocytomas and human prostate cancer (16,49). The induction of apoptosis in all of these studies occurs via inhibition of the anti-apoptotic genes survivin and Bcl-xL (a member of the Bcl-2 family of proteins), which play vital roles in cell survival (16,17). Our results show that expression levels of the anti-apoptotic genes survivin and Bcl-xL were downregulated in pRNAi-Stat3-treated MDA-MB-231 cells as compared to the control and vector-treated cells. Additionally, we found a significant increase in the expression of Bcl-xS in pRNAi-Stat3-treated MDA-MB-231 cells; Bcl-xS is a pro-apoptotic gene induced during apoptosis. The expression of Bcl-xS was negligible in the control and vector-treated cells. Our results strongly supports that the constitutively activated Stat3 protects the breast cancer cells from apoptosis.

We suggest a new strategy for treating breast cancer through downregulation of Stat3 using pRNAi-Stat3 (Fig. 7). The tumors' decreased Stat3 activity increased the expression of Fas and Fas-L. Additionally, released the Cytochrome-C and SMAC into the cytoplasm from the mitochondria activating intrinsic apoptotic pathway. This in turn led to increased apoptosis, thereby regressing the tumor. Our schematic is based on our in vitro and in vivo model data showing an increase in apoptosis and tumor reduction.

Figure 7
Schematic representation of the effect of pRNAi-Stat3 on apoptotic cascade in breast tumor affecting the growth.

These results strongly suggest that simultaneous activation of extrinsic and intrinsic pathways is involved in the phenomenon of apoptotic induction. These events are associated with multiple perturbations in apoptotic regulatory proteins including the following: cleavage/degradation of caspase 8, caspase 9, caspase 3, and PARP; cytosolic depletion of Bax; and the release of the mitochondrial proteins Smac/Diablo and Apaf-1. As STAT3 signaling is important for the survival of a number of human tumors, Stat3 siRNA could become an effective therapeutic agent for Stat3-dependent tumors.


We thank Shellee Abraham for preparing the manuscript, and Diana Meister and Sushma Jasti for reviewing the manuscript. We thank Noorjehan Ali for technical assistance.

This research was supported by National Cancer Institute Grant CA 75557, CA 92393, CA 95058, CA 116708, N.I.N.D.S. NS47699, NS57529 and NS61835, and Caterpillar, Inc., OSF Saint Francis, Inc., Peoria, IL (to J.S.R.).

Abbreviations used

RNA interference
short interfering RNA
signal and transducer of transcription 3
plasmid for small interfering RNA (siRNA) specific for Stat3
plasmid for constitutively active form of Stat3
plasmid for scrambled vector
phosphate-buffered saline
fluorescein 5-isothiocyanate
hematoxylin & eosin
glyceraldehyde-3-phosphate dehydrogenase
Terminal deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling

Reference List

1. Clevenger CV. Roles and regulation of stat family transcription factors in human breast cancer. Am J Pathol. 2004;165:1449–1460. [PubMed]
2. Takeda K, Akira S. STAT family of transcription factors in cytokine-mediated biological responses. Cytokine Growth Factor Rev. 2000;11:199–207. [PubMed]
3. Yu H, Jove R. The STATs of cancer--new molecular targets come of age. Nat Rev Cancer. 2004;4:97–105. [PubMed]
4. Shushakova N, Tkachuk N, Dangers M, Tkachuk S, Park JK, Hashimoto K, Haller H, Dumler I. Urokinase-induced activation of the gp130/Tyk2/Stat3 pathway mediates a pro-inflammatory effect in human mesangial cells via expression of the anaphylatoxin C5a receptor. J Cell Sci. 2005;118:2743–2753. [PubMed]
5. Zhong Z, Wen Z, Darnell JE., Jr. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science. 1994;264:95–98. [PubMed]
6. Bromberg J. Stat proteins and oncogenesis. J Clin Invest. 2002;109:1139–1142. [PMC free article] [PubMed]
7. Darnell JE., Jr. STATs and gene regulation. Science. 1997;277:1630–1635. [PubMed]
8. Dechow TN, Pedranzini L, Leitch A, Leslie K, Gerald WL, Linkov I, Bromberg JF. Requirement of matrix metalloproteinase-9 for the transformation of human mammary epithelial cells by Stat3-C. Proc Natl Acad Sci USA. 2004;101:10602–10607. [PubMed]
9. Garcia R, Yu CL, Hudnall A, Catlett R, Nelson KL, Smithgall T, Fujita DJ, Ethier SP, Jove R. Constitutive activation of Stat3 in fibroblasts transformed by diverse oncoproteins and in breast carcinoma cells. Cell Growth Differ. 1997;8:1267–1276. [PubMed]
10. Blaskovich MA, Sun J, Cantor A, Turkson J, Jove R, Sebti SM. Discovery of JSI-124 (cucurbitacin I), a selective Janus kinase/signal transducer and activator of transcription 3 signaling pathway inhibitor with potent antitumor activity against human and murine cancer cells in mice. Cancer Res. 2003;63:1270–1279. [PubMed]
11. Leong PL, Andrews GA, Johnson DE, Dyer KF, Xi S, Mai JC, Robbins PD, Gadiparthi S, Burke NA, Watkins SF, Grandis JR. Targeted inhibition of Stat3 with a decoy oligonucleotide abrogates head and neck cancer cell growth. Proc Natl Acad Sci USA. 2003;100:4138–4143. [PubMed]
12. Meydan N, Grunberger T, Dadi H, Shahar M, Arpaia E, Lapidot Z, Leeder JS, Freedman M, Cohen A, Gazit A, Levitzki A, Roifman CM. Inhibition of acute lymphoblastic leukaemia by a Jak-2 inhibitor. Nature. 1996;379:645–648. [PubMed]
13. Mora LB, Buettner R, Seigne J, Diaz J, Ahmad N, Garcia R, Bowman T, Falcone R, Fairclough R, Cantor A, Muro-Cacho C, Livingston S, Karras J, Pow-Sang J, Jove R. Constitutive activation of Stat3 in human prostate tumors and cell lines: direct inhibition of Stat3 signaling induces apoptosis of prostate cancer cells. Cancer Res. 2002;62:6659–6666. [PubMed]
14. Nakajima K, Yamanaka Y, Nakae K, Kojima H, Ichiba M, Kiuchi N, Kitaoka T, Fukada T, Hibi M, Hirano T. A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO J. 1996;15:3651–3658. [PubMed]
15. Ni Z, Lou W, Leman ES, Gao AC. Inhibition of constitutively activated Stat3 signaling pathway suppresses growth of prostate cancer cells. Cancer Res. 2000;60:1225–1228. [PubMed]
16. Konnikova L, Kotecki M, Kruger MM, Cochran BH. Knockdown of STAT3 expression by RNAi induces apoptosis in astrocytoma cells. BMC Cancer. 2003;3:23–31. [PMC free article] [PubMed]
17. Lee SO, Lou W, Qureshi KM, Mehraein-Ghomi F, Trump DL, Gao AC. RNA interference targeting Stat3 inhibits growth and induces apoptosis of human prostate cancer cells. Prostate. 2004;60:303–309. [PubMed]
18. Buettner R, Mora LB, Jove R. Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clin Cancer Res. 2002;8:945–954. [PubMed]
19. Aoki Y, Feldman GM, Tosato G. Inhibition of STAT3 signaling induces apoptosis and decreases survivin expression in primary effusion lymphoma. Blood. 2003;101:1535–1542. [PubMed]
20. Reed JC. Bcl-2 family proteins. Oncogene. 1998;17:3225–3236. [PubMed]
21. Bromberg J, Darnell JE., Jr. The role of STATs in transcriptional control and their impact on cellular function. Oncogene. 2000;19:2468–2473. [PubMed]
22. Catlett-Falcone R, Dalton WS, Jove R. STAT proteins as novel targets for cancer therapy. Signal transducer an activator of transcription. Curr Opin Oncol. 1999;11:490–496. [PubMed]
23. Zamore PD, Tuschl T, Sharp PA, Bartel DP. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell. 2000;101:25–33. [PubMed]
24. Li N, Ragheb K, Lawler G, Sturgis J, Rajwa B, Melendez JA, Robinson JP. Mitochondrial complex I inhibitor rotenone induces apoptosis through enhancing mitochondrial reactive oxygen species production. J Biol Chem. 2003;278:8516–8525. [PubMed]
25. Desrivieres S, Kunz C, Barash I, Vafaizadeh V, Borghouts C, Groner B. The biological functions of the versatile transcription factors STAT3 and STAT5 and new strategies for their targeted inhibition. J Mammary Gland Biol Neoplasia. 2006;11:75–87. [PubMed]
26. Groner B, Hennighausen L. Linear and cooperative signaling: roles for Stat proteins in the regulation of cell survival and apoptosis in the mammary epithelium. Breast Cancer Res. 2000;2:149–153. [PMC free article] [PubMed]
27. Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med. 1997;3:917–921. [PubMed]
28. Song RX, Santen RJ. Apoptotic action of estrogen. Apoptosis. 2003;8:55–60. [PubMed]
29. Chinnaiyan AM, O'Rourke K, Tewari M, Dixit VM. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell. 1995;81:505–512. [PubMed]
30. Schaub FJ, Liles WC, Ferri N, Sayson K, Seifert RA, Bowen-Pope DF. Fas and Fas-associated death domain protein regulate monocyte chemoattractant protein-1 expression by human smooth muscle cells through caspase- and calpain-dependent release of interleukin-1alpha. Circ Res. 2003;93:515–522. [PubMed]
31. Lademann U, Cain K, Gyrd-Hansen M, Brown D, Peters D, Jaattela M. Diarylurea compounds inhibit caspase activation by preventing the formation of the active 700-kilodalton apoptosome complex. Mol Cell Biol. 2003;23:7829–7837. [PMC free article] [PubMed]
32. Diaz N, Minton S, Cox C, Bowman T, Gritsko T, Garcia R, Eweis I, Wloch M, Livingston S, Seijo E, Cantor A, Lee JH, Beam CA, Sullivan D, Jove R, Muro-Cacho CA. Activation of stat3 in primary tumors from high-risk breast cancer patients is associated with elevated levels of activated SRC and survivin expression. Clin Cancer Res. 2006;12:20–28. [PubMed]
33. Berishaj M, Gao SP, Ahmed S, Leslie K, Al-Ahmadie H, Gerald WL, Bornmann W, Bromberg JF. Stat3 is tyrosine-phosphorylated through the interleukin-6/glycoprotein 130/Janus kinase pathway in breast cancer. Breast Cancer Res. 2007;9:R32. [PMC free article] [PubMed]
34. Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW. Specificity of short interfering RNA determined through gene expression signatures. Proc Natl Acad Sci USA. 2003;100:6347–6352. [PubMed]
35. Toillon RA, Descamps S, Adriaenssens E, Ricort JM, Bernard D, Boilly B, Le B,X. Normal breast epithelial cells induce apoptosis of breast cancer cells via Fas signaling. Exp Cell Res. 2002;275:31–43. [PubMed]
36. Xia C, Zhao H, Tang X. The expressions of Fas and Fas-L in human breast invasive ductal carcinomas and their surrounding tissues. Zhonghua Wai Ke Za Zhi. 1999;37:648–650. [PubMed]
37. Friesen C, Fulda S, Debatin KM. Cytotoxic drugs and the CD95 pathway. Leukemia. 1999;13:1854–1858. [PubMed]
38. Mo YY, Beck WT. DNA damage signals induction of fas ligand in tumor cells. Mol Pharmacol. 1999;55:216–222. [PubMed]
39. Micheau O, Solary E, Hammann A, Martin F, manche-Boitrel MT. Sensitization of cancer cells treated with cytotoxic drugs to fas-mediated cytotoxicity. J Natl Cancer Inst. 1997;89:783–789. [PubMed]
40. Boldin MP, Goncharov TM, Goltsev YV, Wallach D. Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death. Cell. 1996;85:803–815. [PubMed]
41. Cho SG, Choi EJ. Apoptotic signaling pathways: caspases and stress-activated protein kinases. J Biochem Mol Biol. 2002;35:24–27. [PubMed]
42. Hsu H, Shu HB, Pan MG, Goeddel DV. TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell. 1996;84:299–308. [PubMed]
43. Jurgensmeier JM, Xie Z, Deveraux Q, Ellerby L, Bredesen D, Reed JC. Bax directly induces release of cytochrome c from isolated mitochondria. Proc Natl Acad Sci USA. 1998;95:4997–5002. [PubMed]
44. Marzo I, Brenner C, Zamzami N, Jurgensmeier JM, Susin SA, Vieira HL, Prevost MC, Xie Z, Matsuyama S, Reed JC, Kroemer G. Bax and adenine nucleotide translocator cooperate in the mitochondrial control of apoptosis. Science. 1998;281:2027–2031. [PubMed]
45. Narita M, Shimizu S, Ito T, Chittenden T, Lutz RJ, Matsuda H, Tsujimoto Y. Bax interacts with the permeability transition pore to induce permeability transition and cytochrome c release in isolated mitochondria. Proc Natl Acad Sci USA. 1998;95:14681–14686. [PubMed]
46. Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK, Gallant M, Gareau Y, Griffin PR, Labelle M, Lazebnik YA. Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature. 1995;376:37–43. [PubMed]
47. Tewari M, Quan LT, O'Rourke K, Desnoyers S, Zeng Z, Beidler DR, Poirier GG, Salvesen GS, Dixit VM. Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell. 1995;81:801–809. [PubMed]
48. Scott SL, Higdon R, Beckett L, Shi XB, Vere White RW, Earle JD, Gumerlock PH. BCL2 antisense reduces prostate cancer cell survival following irradiation. Cancer Biother Radiopharm. 2002;17:647–656. [PubMed]
49. Gao L, Zhang L, Hu J, Li F, Shao Y, Zhao D, Kalvakolanu DV, Kopecko DJ, Zhao X, Xu DQ. Down-regulation of signal transducer and activator of transcription 3 expression using vector-based small interfering RNAs suppresses growth of human prostate tumor in vivo. Clin Cancer Res. 2005;11:6333–6341. [PubMed]