PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Clin Virol. Author manuscript; available in PMC 2010 April 1.
Published in final edited form as:
PMCID: PMC2663017
NIHMSID: NIHMS93002
Use of a universal virus detection assay to identify human metapneumovirus in a hematopoietic stem cell transplant recipient with pneumonia of unknown origin
Christine Uhlenhaut, PhD,1 Jeffrey I. Cohen, MD,2 Daniel Fedorko, PhD,3 Santosh Nanda, PhD,1 and Philip R. Krause, MD1*
1Division of Viral Products, Center for Biologics, Evaluation and Research, Food and Drug Administration, Bethesda, MD, 20892-4555, USA
2Medical Virology Section, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-1888, USA
3Microbiology Laboratory, Clinical Center, National Institutes of Health, Bethesda, MD 20892, USA
* Corresponding author: Philip R. Krause, Food and Drug Administration, Building 29A, Room 1C16, HFM-457, 29 Lincoln Drive, Bethesda, MD 20892-4555, USA, Phone: 301-827-1914; Fax: 301-496-1810, E-mail: philip.krause/at/fda.hhs.gov
Background
Development of uncommon viral infections in immunocompromised transplant recipients can pose major diagnostic challenges. We present a case report of an immunocompromised patient suffering from pneumonia, for which the causative agent was not identified by routine methods.
Objectives
To identify the potential cause of the pneumonia using a degenerate oligonucleotide primer (DOP) PCR assay which is designed to detect all viruses.
Study Design
DOP-PCR was applied to bronchoalveolar lavage fluid from this patient. Generic PCR products were cloned and sequenced.
Results
The novel universal virus assay detected human metapneumovirus in the clinical sample. The finding was confirmed by two independent metapneumovirus specific PCRs targeting independent regions of the viral genome.
Conclusions
The DOP PCR was used to detect and identify the sequence of an unidentified virus. This study provides proof of concept for the use on clinically relevant specimens of this unbiased universal assay, which requires no previous viral sequence information.
Keywords: Virus discovery, virus detection, immunocompromised host, virus disease diagnosis, virus disease etiology
Detection of unknown viruses remains one of the most challenging problems in virology. When classical methods fail to detect viruses, development of molecular tests depends upon the availability of accurate sequence information. Generic virus detection tests allow for the simultaneous detection of multiple (if not all) virus sequences. We previously developed and optimized an improved universal virus detection method that sensitively and broadly detects DNA and RNA viruses in infected cell cultures and spiked cells with limiting amounts of nucleic acid or viruses1. This technique requires no prior sequence information from the virus being detected, implying promise for virus discovery and detection of virus in samples for which other methods have failed.
A case of pulmonary infiltrates and fever of unknown origin occurring in a hematopoietic stem cell transplant (HSCT) recipient was investigated using a modified version of the generic virus detection assay after conventional methods failed to identify a pathogen. Preceding studies of bronchoalveolar lavage (BAL) fluids were negative for typical respiratory pathogens using standard microbiological techniques, including bacteria (including nocardia, legionella, mycoplasma, chlamydophila and mycobacteria), fungi, and pneumocystis. Routine viral studies for influenza A and B, adenovirus, parainfluenza, herpes simplex virus, cytomegalovirus, and respiratory syncytial virus were also negative. An aliquot of the previously tested BAL was obtained after it was stored at refrigerator temperatures for several days. Because the storage conditions might have damaged virus capsids (and thus made the viral nucleic acid vulnerable to nuclease digestion) we modified the previously described purification procedure1 by eliminating the use of nucleases.
This method is based on physical separation of host and virus nucleic acids followed by a degenerate oligonucleotide primer PCR (DOP-PCR) that is optimized for virus-sized genomes and permits non-specific nucleic acid amplification at a high degree of sensitivity (100-1000 copies of viral nucleic acid). The PCR uses a single primer population with a short conserved 3’ sequence (TGTGG) and is several logs more sensitive than a previously described non-specific viral PCR assay2. The DOP-PCR was experimentally shown to amplify a range of viral genomes, including the DNA viruses SV40, HSV, VZV, EBV, and adeno-associated virus, and the RNA viruses poliovirus, influenza virus, HTLV-1, and HTLV-21.
Research was deemed exempt by the Offices of Human Subjects Research at NIH and performed in accordance with the ethical standards of FDA and NIH institutional review boards, and with the Helsinki Declaration of 1975, as modified in 1983. Two 200 μL BAL aliquots were centrifuged at 18,000 × g for 2 hrs at 4°C. DNA and RNA were separately extracted from 100 μL of each supernatant and pellet (AllPrep DNA/RNA kit, Qiagen, Valencia, CA). The cDNA syntheses were carried out using a first strand kit and random hexamer primer (Invitrogen, Carlsbad, CA). DOP-PCR was carried out separately on DNA and cDNA purified from one BAL aliquot in a reaction containing 1.5 mM MgCl2, 10 mM KCl, 10 mM Tris pH 8.4, 200 μM dNTP, 2.4 μM DOP primer (5’-CCGACTCGAGINNNNNNTGTGG-3’) and 2.5 U Low DNA Taq (Applied Biosystems, Foster City, CA); cycling conditions were 5 min at 95°C; 5 cycles of 1 min at 94°C, 1.5 min at 30°C, slow ramping to 72°C at 0.2°C/sec, and 3 min extension at 72°C; and 35 cycles of 1 min at 94°C, 1 min at 55°C, and 2 min extension at 72°C, with the addition of 14 seconds per cycle to each extension step. DOP-PCR products were analyzed and purified by gel electrophoresis (results for cDNA are shown in Figure 1a). Four individual bands were purified from the cDNA amplification and ligated into a TOPO-TA cloning vector and transformed into competent bacteria (Invitrogen, Carlsbad, CA). DOP-PCR of DNA extracted from the BAL yielded a non-discrete smear consistent with non-specific amplification of cellular nucleic acids, and was not analyzed further. Sequencing was performed using a 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA). Sequences from the obtained clones were compared with the non-redundant (nr) database in GenBank using TBLASTX (NCBI, Bethesda, MD).
Figure 1
Figure 1
A: Gel electrophoresis of DOP-PCR amplification products of cDNA prepared from the BAL of a patient with unexplained pneumonia. Frames indicate PCR products that were gel-purified. The arrows indicate the DOP-PCR products that were homologous to HMPV. (more ...)
Primer sequences for HMPV specific PCR were: N-gene forward primer: GGYRACYTTRCTWAARGAATCATCAGG; N-gene reverse primer: CAGATTCRGGRCCCATYTCTC; L-gene forward primer: CTTGAGATGGTATTAAATGA; L-gene reverse primer: CCTACACTTAATTCTCTTTC; PCR cycling conditions were 94°C for 2 min, 40 cycles of 94°C 20 sec, 55°C 1 min, 72°C 1 min followed by 10 min 72°C.
We sequenced DNA from four bands representing DOP-PCR products derived from cDNA. Five out of 63 clones from the DOP-PCR yielded sequence that matched the known sequence of the G-gene from human metapneumovirus (Figure 1b). The largest band (~620 bp) yielded human mitochondrial sequence, the second band (~480 bp) yielded two human mitochondrial sequences and two HMPV sequences, the third band (~420 bp) yielded one human sequence, and the smallest band (~250 bp) yielded four human and three HMPV sequences. The HMPV sequences were all derived from the G-gene, with some overlap. Other clones contained vector sequences only.
To confirm the presence of HMPV in this sample, duplicate BAL samples were subjected to independent PCRs targeting nucleoprotein and polymerase gene genomic regions. Primer sequences were chosen (with some degeneracy) to permit detection of all seven HMPV full length genomes in GenBank. The RT-PCRs for the nucleoprotein gene tested positive for two independent supernatant and pellet samples each, while the L-gene (polymerase) sequence was only detected in the pellet but not in the supernatant samples, implying lower sensitivity for this test (Figure 1c). The relative locations of the DOP-PCR and specific PCR products are shown in Figure 1d.
The detection of HMPV sequences in the clinical sample does not prove conclusively that this virus was the sole cause of the pneumonia; reports indicate that viral sequences may persist for long periods of time in murine lung tissue3. Detected HMPV sequences could represent either viable or non-viable virus particles. However, we detected signals in supernatant as well as in pellets, implying that both virus capsids and free viral nucleic acid were present. The presence of readily-detectable HMPV sequences in BAL fluid using the generic DOP assay as well as two independent PCRs for different regions of the genome imply a high probability of very recent or ongoing HMPV infection in this individual.
We identified different but overlapping DOP-PCR products in the HMPV G-gene, and did not detect other HMPV genes. The HMPV sequence is not biased in a way that would support preferential DOP-PCR amplification of the G-gene; thus, it seems more likely that the sample contained more RNA from the G-gene than from other genes. This may have been related to the refrigerator storage of the sample for five days prior to analysis—conditions that may have caused a significant amount of RNA degradation.
Although identification of HMPV in clinical samples is usually not a major diagnostic challenge, genetic heterogeneity among HMPV strains can lead to false negative RT-PCR assays, leading some investigators to seek further improvement in these assays 4,5. Our findings imply that the DOP-PCR based universal virus assay is useful for finding viruses in patient samples where other methods have failed to identify a pathogen. This can be particularly important when sample quantity is limited, making it difficult to perform many additional tests. A single generic assay that is capable of detecting all DNA and RNA viral genomes, paired with an appropriate purification technique, thus has significant advantages. The major strength of the DOP assay is its ability to amplify viral sequences without prior knowledge of those sequences, increasing the likelihood of finding mutated or novel viruses or viruses with substantial sequence heterogeneity, including as-yet undiscovered, unexpected, or non-human viruses. This is of major importance because most (about 75%) emerging infectious diseases and 80% of select agents are of zoonotic origin6.
Unlike many subtraction-based generic approaches, the non-subtractive DOP assay does not require a non-infected but otherwise genetically identical control. As compared with amplification methodologies using primers based on consensus sequences shared among related viruses7,8,9 (e.g., those that were used to discover new herpes viruses10 and to identify West Nile virus as the etiologic agent of human encephalitis in the New York outbreak11), the DOP assay does not require the performance of multiple assays directed at different virus families, which may be impractical when sample is limited. The DOP assay also does not require accurate sequence information for each virus included in the screening12 in order to establish the assay, as do consensus primer and microarray-based techniques. Other recently described alternatives to classical virological methods used to identify a new arenavirus13, a virus linked to colony collapse disorder of bees14 and a polyomavirus playing a role in human Merkel cell carcinoma15 use a combination of degenerate PCR and high-throughput sequencing, an approach that can be expensive and is not readily available. Enrichment of viral nucleic acids in the present approach permits identification of viral sequences even by traditional sequencing, making this approach accessible to laboratories with access to PCR, cloning, and standard sequencing. The DOP-PCR assay requires three days from sample receipt to sequence.
The DOP-PCR approach is most promising in situations where sample is limited, suspicion of viral disease is high, and standard viral diagnostic tests are negative. Viruses with substantial genetic heterogeneity and those that are not initially suspected based on the clinical presentation would be particularly amenable to detection using this method.
Acknowledgments
This study was supported by the intramural research programs of the National Institute of Allergy and Infectious Diseases and the National Institutes of Health Clinical Center. We gratefully acknowledge the FDA/CBER core facility for sequencing. We also thank Dr. Shuang Tang, Dr. Shasta McClenahan and Amita Patel for helpful comments.
Abbreviations
DOP-PCRdegenerate oligonucleotide primer PCR
HSCThematopoietic stem cell transplant
BALbronchoalveolar lavage

Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1. Nanda S, Jayan G, Voulgaropoulou F, Sierra-Honigmann AM, Uhlenhaut C, McWatters BJ, Patel A, Krause PR. Universal virus detection by degenerate-oligonucleotide primed polymerase chain reaction of purified viral nucleic acids. J Virol Methods. 2008;152:18–24. [PubMed]
2. Allander T, Emerson SU, Engle RE, Purcell RH, Bukh J. A virus discovery method incorporating DNase treatment and its application to the identification of two bovine parvovirus species. Proc Natl Acad Sci U S A. 2001;98:11609–11614. [PubMed]
3. Alvarez R, Harrod KS, Shieh WJ, Zaki S, Tripp RA. Human metapneumovirus persists in BALB/c mice despite the presence of neutralizing antibodies. J Virol. 2004;78:14003–14011. [PMC free article] [PubMed]
4. Chiu CY, Alizadeh AA, Rouskin S, Merker JD, Yeh E, Yagi S, Schnurr D, Patterson BK, Ganem D, DeRisi JL. Diagnosis of a critical respiratory illness caused by human metapneumovirus by use of a pan-virus microarray. J Clin Microbiol. 2007;45:2340–2343. [PMC free article] [PubMed]
5. Hopkins MJ, Redmond C, Shaw JM, Hart IJ, Hart CA, Smyth RL, Semple MG. Detection and characterisation of human metapneumovirus from children with acute respiratory symptoms in north-west England, UK. J Clin Virol. 2008;42:273–279. [PubMed]
6. Taylor LH, Latham SM, Woolhouse ME. Risk factors for human disease emergence. Philos Trans R Soc Lond B Biol Sci. 2001;356:983–989. [PMC free article] [PubMed]
7. Corne JM, Green S, Sanderson G, Caul EO, Johnston SL. A multiplex RT-PCR for the detection of parainfluenza viruses 1-3 in clinical samples. J Virol Methods. 1999;82:9–18. [PubMed]
8. Sampath R, Hofstadler SA, Blyn LB, Eshoo MW, Hall TA, Massire C, Levene HM, Hannis JC, Harrell PM, Neuman B, Buchmeier MJ, Jiang Y, Ranken R, Drader JJ, Samant V, Griffey RH, McNeil JA, Crooke ST, Ecker DJ. Rapid identification of emerging pathogens: coronavirus. Emerg Infect Dis. 2005;11:373–379. [PMC free article] [PubMed]
9. van der Hoek L, Pyrc K, Jebbink MF, Vermeulen-Oost W, Berkhout RJ, Wolthers KC, Wertheim-van Dillen PM, Kaandorp J, Spaargaren J, Berkhout B. Identification of a new human coronavirus. Nat Med. 2004;10:368–373. [PubMed]
10. VanDevanter DR, Warrener P, Bennett L, Schultz ER, Coulter S, Garber RL, Rose TM. Detection and analysis of diverse herpesviral species by consensus primer PCR. J Clin Microbiol. 1996;34:1666–1671. [PMC free article] [PubMed]
11. Briese T, Jia XY, Huang C, Grady LJ, Lipkin WI. Identification of a Kunjin/West Nile-like flavivirus in brains of patients with New York encephalitis. Lancet. 1999;354:1261–1262. [PubMed]
12. Wang D, Coscoy L, Zylberberg M, Avila PC, Boushey HA, Ganem D, DeRisi JL. Microarray-based detection and genotyping of viral pathogens. Proc Natl Acad Sci U S A. 2002;99:15687–15692. [PubMed]
13. Palacios G, Druce J, Du L, Tran T, Birch C, Briese T, Conlan S, Quan PL, Hui J, Marshall J, Simons JF, Egholm M, Paddock CD, Shieh WJ, Goldsmith CS, Zaki SR, Catton M, Lipkin WI. A New Arenavirus in a Cluster of Fatal Transplant-Associated Diseases. N Engl J Med. 2008;358:991–998. [PubMed]
14. Cox-Foster DL, Conlan S, Holmes EC, Palacios G, Evans JD, Moran NA, Quan PL, Briese T, Hornig M, Geiser DM, Martinson V, Vanengelsdorp D, Kalkstein AL, Drysdale A, Hui J, Zhai J, Cui L, Hutchison SK, Simons JF, Egholm M, Pettis JS, Lipkin WI. A Metagenomic Survey of Microbes in Honey Bee Colony Collapse Disorder. Science. 2007;318:283–287. [PubMed]
15. Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science. 2008;319:1096–1100. [PMC free article] [PubMed]