PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of wtpaEurope PMCEurope PMC Funders GroupSubmit a Manuscript
 
Clin Cancer Res. Author manuscript; available in PMC Jun 1, 2009.
Published in final edited form as:
PMCID: PMC2659869
UKMSID: UKMS3656
Perilobar nephrogenic rests are non-obligate molecular genetic precursor lesions of IGF2-associated Wilms tumours
Raisa Vuononvirta,1 Neil J. Sebire,2 Anthony R. Dallosso,3 Jorge S. Reis-Filho,4 Richard D. Williams,1 Alan Mackay,4 Kerry Fenwick,4 Anita Grigoriadis,4,5 Alan Ashworth,4 Kathy Pritchard-Jones,1 Keith W. Brown,3 Gordan M. Vujanic,6 and Chris Jones1
1Paediatric Oncology, Institute of Cancer Research/Royal Marsden NHS Trust, Sutton, UK
2Department of Histopathology, Great Ormond Street Hospital for Children, London, UK
3Department of Cellular and Molecular Medicine, University of Bristol, Bristol, UK
4Breakthrough Breast Cancer Research Centre, Institute of Cancer Research, London, UK
5Ludwig Institute for Cancer Research, London, UK
6Department of Pathology, University of Wales College of Medicine, Cardiff, UK
Correspondence to: Dr Chris Jones, Paediatric Oncology, Institute of Cancer Research, 15 Cotswold Road, Sutton, Surrey, SM2 5NG, UK Tel. +44 (0)20 8722 4416 Fax. +44 (0)20 8722 4321 Email. chris.jones/at/icr.ac.uk
Purpose:
Perilobar nephrogenic rests (PLNRs) are abnormally persistent foci of embryonal immature blastema that have been associated with dysregulation at the 11p15 locus by genetic/epigenetic means, and are thought to be precursor lesions of Wilms tumour. The precise genomic events are, however, largely unknown.
Experimental Design:
We used arrayCGH to analyse a series of 50 PLNRs and 25 corresponding Wilms tumours characterised for 11p15 genetic/epigenetic alterations and IGF2 expression.
Results:
The genomic profiles of PLNRs could be subdivided into three categories: those with no copy number changes (22/50, 44%), those with single, whole chromosome alterations (8/50, 16%), and those with multiple gains/losses (20/50, 40%). The most frequent aberrations included 1p- (7/50, 14%) +18 (6/50, 12%), +13 (5/50, 10%) and +12 (3/50, 6%). For the majority (19/25, 76%) of cases, the rest harboured a subset of the copy number changes in the associated Wilms tumour. We identified a temporal order of genomic changes which occur during the IGF2/PLNR pathway of Wilms tumorigenesis, with large scale chromosomal alterations such as 1p-, +12, +13 and +18 regarded as ‘early’ events. In some of the cases (24%), the PLNRs harboured large-scale copy number changes not observed in the concurrent Wilms tumour, including +10p, +14q and +18.
Conclusions:
These data suggest that although the evidence for PLNRs as precursors is compelling, not all lesions must necessarily undergo malignant transformation.
Keywords: Wilms tumour, perilobar nephrogenic rest, array CGH, IGF2, LOI, LOH
The cell of origin of Wilms tumour (nephroblastoma) is thought to be the metanephric blastemal cell, which forms a pluripotent renal stem cell population that during organogenesis, and in response to penetration by the ureteric bud, induces branching morphogenesis and subsequent kidney development (1, 2). In a paradigm of the links between abrogated organ development and tumorigenesis, these pluripotent cells may persist beyond 36 weeks of gestation, and appear in up to 1% of routine infant post mortems as nephrogenic rests (NRs) (3). These lesions are thought to be precursors of Wilms tumours, as they are reported to be found in 30-40% of kidneys containing a sporadic tumour, and in close to 100% of bilateral cases (3). Their natural history is, however, uncertain: most appear to spontaneously involute, as they are rarely observed in normal kidneys after one year of age (3).
NRs are histologically classified as either perilobar (PLNR) or intralobar (ILNR), and both types may be further described as dormant, sclerosing, adenomatous or hyperplastic (3). PLNRs are usually multifocal, found at the periphery of the renal lobe, are sharply demarcated and usually consist of blastema and tubules (3). In contrast, ILNRs are often unifocal, randomly situated within the renal lobe, show poorly defined, irregular and intermixed margins, and are more commonly composed of stroma (usually predominant), blastema and tubules (3). Clues to the genetic components of their persistence come from their links to developmental syndromes: PLNRs are associated with overgrowth syndromes including hemihypertrophy and Beckwith-Wiedemann-syndrome, whereas ILNRs are commonly found in WAGR (Wilms-aniridia-genital anomaly-mental retardation) and Denys-Drash syndromes (4).
Direct evidence for the genetic link of rests to Wilms tumour evolution is limited, but compelling. Most striking is the identification of heterozygous mutations of the WT1 gene in PLNRs and homozygous mutations in a few hyperplastic ILNRs (5), although this has not been explored further. In an allelic imbalance study, Charles and co-workers observed a more frequent loss of heterozygosity (LOH) at 11p13 (WT1) in ILNRs, with a stronger association of alterations at 11p15 (WT2 locus) with PLNRs (6). It is notable that the LOH on chromosome 11p preferentially involves the maternal chromosome, and results in a uniparental disomy (UPD) of the paternal allele and biallelic IGF2 expression (7). These cases with LOH harboured the same abnormalities in the adjacent Wilms tumour suggesting that aberrations at WT1/WT2 in nephrogenic rests may represent early genetic events in Wilms tumorigenesis.
The occurrence of epigenetic events on chromosome 11p provides the best studied lines of evidence. Loss of imprinting (LOI) at the WT2 locus on 11p15 is found in 33-50% of Wilms tumours (4), shows a marked ethnic variation (8), and has been observed in PLNRs (9). Aberrant imprinting control at this locus appears restricted to the genes IGF2 and H19 (10), with hypermethylation of the H19 differentially methylated region on the maternal allele preventing binding of the CTCF chromatin insulator, resulting in IGF2 LOI and biallelic expression. It has been suggested that sporadic Wilms tumour with IGF2 LOI is part of a spectrum of prenatal and postnatal overgrowth disorders associated with epigenetic mosaicism at the IGF2 locus (8), and that PLNRs are a morphological consequence of the renal IGF2 mosaicism (9).
The Wilms tumours themselves which are thought to arise from PLNRs or ILNRs appear to have distinct morphological features. “ILNR-like” tumours tend to show a spectrum of mesenchymal differentiation with the stromal-predominant histology associated with the underlying genetics (WT1/β-catenin mutation) (11). By contrast, the “PLNR-like” tumours tend to show a limited nephrogenic differentiation with a marked blastemal, and to a lesser extent, epithelial, cell predominance (12). These tumours harbour either LOH and subsequent UPD, or LOI, of the IGF2/H19 locus resulting in a marked overexpression of IGF2 in the tumour cells. Coupled with our recent identification of blastemal cell copy number gain and overexpression of the IGF1 receptor (IGF1R) in chemoresistant Wilms tumours (13), these tumours may be considered to be driven by IGF signalling in an autocrine/paracrine fashion.
We have investigated the genomic events associated with the earliest stages of the development of these IGF2-associated Wilms tumours by examining a series of sporadic PLNRs, characterised for genetic and epigenetic aberrations at 11p15, by applied array-based comparative genomic hybridisation (aCGH), and provide the first genomic evidence of the non-obligate precursor role of PLNRs in Wilms tumorigenesis.
Samples and DNA extraction
Archival pathology specimens of PLNRs and corresponding Wilms tumours from the same patients were obtained from the Royal Marsden and Great Ormond Street Hospitals with full Ethical Committee approval. All cases were reviewed by three pathologists (NJS, GMV, JSRF). In total, 50 formalin-fixed, paraffin-embedded (FFPE) PLNRs were obtained from 42 non-syndromic patients, with matched Wilms tumours from 25 cases. The vast majority (46/50, 92%) exhibited a high degree of WT1 protein expression by immunohistochemistry. There was an over-representation of patients with bilateral disease (17/50, 34%), as rests are known to be more prevalent in these cases. Lesions were subjected to either laser capture microdissection (PixCell LCM system, Arcturus, Mountain View, CA) or manual microdissection according to the relative size and location of the rests. The vast majority of cases were treated with pre-operative chemotherapy, which we have previously demonstrated not to harbour significant genomic differences to those taken at immediate nephrectomy (14). Sections were stained with nuclear fast red to aid in morphological assessment without interfering with downstream amplification protocols. The DNeasy Tissue Kit (Qiagen, Crawley, UK) was used for DNA extraction according to the manufacturer's protocol. For the laser captured samples up to three subsequent rounds of additional proteinase K digestions at 55°C overnight were carried out. DNA quantitation was determined by spectrophotometry (NanoDrop, Wilmington, DE, USA). We have previously reported the GenomePlex whole genome amplification (WGA) technique to be a highly accurate and reproducible method to amplify DNA samples from FFPE material for aCGH analysis using as little as 5ng starting DNA (15). For the WGA of the microscopic, laser captured NRs (up to 3000 cells), an improved version of the kit (“WGA4”, Sigma, Poole, UK) was utilised according to the manufacturer's protocol.
Microarray CGH
All raw and processed data have been deposited in Array Express 1 (E-TABM-436). The array CGH platforms used in this study were constructed at the Breakthrough Breast Cancer Research Centre. Hybridisations were carried out as previously described (16) onto a 5.8K, 0.9Mb-spaced (E-MEXP-213) and/or a 16K, 100kb-spaced (E-MEXP-1040) BAC array. Slides were scanned using an Axon 4000B scanner (Axon Instruments, Burlingame, CA, USA) and images were analysed using Genepix Pro 4.1 software (Axon Instruments). The median localised background slide signal for each clone was subtracted and each clone Cy5/Cy3 ratio normalised by local regression (loess) against fluorescence intensity, print-tip sub-array, and within-block spatial location. Data were further scaled by dividing each clone by its median absolute deviation (MAD). BAC clone replicate spots were averaged, and clones excluded with poor reproducibility between replicates (standard deviation >0.2). In addition, clones with missing/poor values in >70% samples were also excluded, as were those with no mapping information (March 2006 build of the human genome sequence, hg18). In order to allow integration of the two platforms, the 16K-derived data were reduced to the resolution of the 5.8K platform by taking the median value of the nearest clones within 1Mb of the corresponding lower-resolution landmark. In this way, we were left with a final dataset comprising 75 samples with 3342 datapoints each.
Statistical analysis
All data transformation and statistical analysis were carried out in R 2.0.1 2 and BioConductor 1.5 3making extensive use of modified versions of the package aCGH in particular (14). For identification of DNA copy number alterations, data were smoothed using a local polynomial adaptive weights procedure for regression problems with additive errors, with thresholds for assigning ‘gain’ and ‘loss’ derived from the overall MAD of each sample. For visualization purposes, the processed log2 ratios were coloured green (gain) or red (loss) after segmentation and copy number determination. Thresholded data for each clone were used for categorical analysis using a Fisher's exact test and paired statistics in SAM (significance analysis of microarrays), with a correction for multiple testing using the step-down permutation procedure maxT, providing strong control of the family-wise Type I error rate (FWER).
The copy number data-set was converted to wiggle track (WIG) format by a custom Perl script, and displayed on the UCSC genome browser 4 in parallel with the positions of known copy number variations (CNVs) in the HapMap populations (17). Copy number changes in the current data that overlapped with these CNVs were excluded from further analysis.
Statistical analysis of categorical data between different subgroups was carried out by Fisher's exact test, and between continuous variables using the Mann-Whitney U test. A p value of less than 0.05 was considered significant. Concordance and similarity scores were calculated as previously described (18). Briefly, the percent concordance equates to the number of changes in common between a pair of samples, divided by the number in common plus half the sum of the number of changes in only one or other of the pair. The similarity score was calculated as a weighted sum of all observed alterations based upon the frequency of the changes in a larger Wilms tumour population (14). Such similarity scores will be increasingly positive when pairs are more alike.
Methylation analysis of the H19 differentially methylated region (DMR)
300ng genomic DNA was bisulfite-converted using the EZ DNA Methylation-Gold kit (Zymo Research, Orange, CA) according to the manufacturers' instructions. Converted DNA was amplified by PCR using JumpStart REDTaq DNA polymerase (Sigma-Aldrich, St. Louis, MO) for 45 cycles with H19pyroF 5′ GATTTTGATGGGGTTAGGATGT and H19pyroR 3′ CTCCTACTCCAAACATTATAAAA oligonucletoide primers (Eurogentec, Liège, Belgium). Pyrosequencing was carried out using the PyroGold SQA reagent kit (Pyrosequencing AB, Uppsala, Sweden), according to the manufacturers' with the sequencing primer H19pyroS 5′ TATAAACAAATTCACCTCTC.
Loss of heterozygosity
LOH analysis was performed as previously described (19), with the forward primer labelled fluorescently with either tetrachlorofluorescein, or hexachlorofluorescein dyes (Invitrogen, Paisley, UK). Sequences of primers for markers at 11p15 were as follows: D11S4465 – forward TAGCCCAAATATCATGTGCA, reverse TGACTGTCACTTAGTAGATGCTCC ; TH – forward CCTCCCCAGGGCGGCCCGGGGCCCA, reverse CACTTACTTACCCTTGGGGTGGGGG. PLNR, Wilms tumour and corresponding normal DNA were amplified using touchdown 68-50 program for 35 cycles as follows: denaturing at 94°C for 10 min, followed by 95°C for 30 sec, 68°C for 45 sec, decreasing by 1°C with every cycle, followed by incubation at 72°C for 1min for 17 more times. This was then followed by 94°C for 30sec, 50°C for 45 sec and 72°C 1min and repeated for 34 more times, with a subsequent final extension at 72°C for 5mins. Each PCR reaction was performed under standard conditions in a 15μl reaction volume containing 250ng of template DNA, 0.8 μM of each primer, 0.2μM dNTP, 1.5 mM MgCl2, 0.2 units of Taq polymerase (ABGene, Epsom, UK), and 1× PCR buffer. Denatured reaction products were analysed on an ABI 7700 capillary sequencer (Applied Biosystems, Foster City, CA), and visualised with Genotyper software (Applied Biosystems). Allele ratios for PLNR or Wilms tumour compared with normal DNA were calculated as (A1/A2)T/(A1/A2)N and LOH was scored if this ratio was less than 0.5 and greater than 2.0 in one or both markers.
Quantitative RT-PCR
RNA extraction for all FFPE samples was carried out by using RNeasy FFPE kit (Qiagen, Crawley, UK) according to manufacturer's instructions. cDNA was prepared from 10μg RNA by random primed reverse transcription using a High-Capacity cDNA Reverse Transcription kit from Applied Biosystems (Warrington, UK) IGF2 Assay on Demand™ (Hs00171254_m1) was obtained from Applied Biosystems (Warrington, UK). PCRs were performed in a 10μl reaction volume containing 5μl 2× buffer/enzyme mix, 1μl 20× assay mix, 1μl 20× GAPDH (4326317E) or HPRT1 (4326321E) endogenous control assay mix and 1μl input cDNA. Assays were run on an Applied Biosystems 7900 Sequence Detection System and results analysed by the standard curve method. Data were normalised to Universal Human Reference RNA (Stratagene, La Jolla, California, USA).
Immunohistochemistry
Immunohistochemistry was performed on 5μm FFPE sections using a mouse monoclonal antibody either to human Ki-67 clone MIB-1 (M7240, Dako, Ely, United Kingdom), WT1 clone 6FH2 (M3561 DAKO, Ely, United Kingdom) or IGF2 (ab9574, Abcam, Cambridge, UK) using the Envision horseradish-peroxidase system (K4006 DAKO, Ely, United Kingdom) at a dilution of 1:150 for Ki67/WT1 and 1:200 for IGF2 according to the manufacturer's instructions. Antigen retrieval for WT1 was carried out by pepsin digestion in 0.2M HCL at 37°C in a humidified chamber, for Ki-67 the slides were boiled in 10mM Tris/NaOH, 1mM EDTA, pH9 in a pressure cooker for two minutes and for IGF2 in 10mM citric acid (Ph6) in the MW for 9mins. Ki-67 proliferation index was determined by manually counting 1000 cells per slide, of which the positively stained cells determined the percentage of proliferation. Samples with 5-20% positive cells were classified as actively proliferating, with cases >20% positive regarded as highly proliferative. IGF2 expression was classified as negative, weakly or strongly positive relative to normal kidney.
PLNRs overexpress IGF2 due to genetic and epigenetic mechanisms
We examined genetic and epigenetic alterations at the 11p15 locus in our series of PLNRs by means of LOH and methylation analysis. We identified LOH in 10/39 (26%) informative cases (Figure 1A). In only one case (PLNR06) was LOH observed in the rest and not the tumour. H19 hypermethylation by pyrosequencing was present in 37/40 (93%) assessable PLNRs – IGF2 LOI, identified by means of H19 hypermethylation in the absence of allelic imbalance, was observed in 23/33 (70%) cases where data from both assays were available (Figure 1B). We investigated IGF2 expression by quantitative RT-PCR and immunohistochemistry, and observed in all but two cases (40/42, 95%) high levels of the transcript (21/34) and/or the protein (30/42) (Table 1).
Figure 1
Figure 1
Genetic and epigenetic means of IGF2 overexpression in PLNRs
Table 1
Table 1
Summary of genetic and epigenetic alterations in PLNRs and associated Wilms tumours
PLNRs can harbour large-scale changes in DNA copy number
To determine whether additional genomic events were associated with the earliest stages of IGF-driven Wilms tumorigenesis, we carried out aCGH on our series of 50 PLNRs (Table 1). The genomic profiles of PLNRs could be subdivided into three categories: those with no copy number changes, those with single, whole chromosome alterations, and those with multiple gains and losses. In 22/50 (44%) of our cases there were no alterations in DNA copy number detectable by our platform. These include relatively large, hyperplastic PLNRs with WT1 protein expression (Figure 2A). It is of note that in an earlier aCGH study of Wilms tumours, we similarly observed 24% of cases to harbour no such copy number changes (14).
Figure 2
Figure 2
Copy number changes in PLNRs
8/50 (16%) PLNRs exhibited only a single chromosomal alteration. This was loss of 1p and 11p in two cases each, and single examples of −11q, −12q24, −21q and +X (Figure 2B). The remaining rests harboured multiple chromosomal aberrations (Figure 2C). Taken together, the most frequent aberrations included loss of 1p (7/50, 14%) and gains of chromosomes 18 (6/50, 12%), 13 (5/50, 10%), 10p15 (4/50, 8%) and 12 (3/50, 6%) (Figure 3). PLNRs with adenomatous features harboured more copy number changes than those without (3.3 vs 1.0, p<0.001, Fishers exact test). There were no significant differences between rests from bilateral versus unilateral patients.
Figure 3
Figure 3
Summary of copy number changes by aCGH in PLNRs
There were no statistically significant associations of gross copy number changes between PLNRs with LOH versus LOI at 11p15. As allelic imbalances and copy number losses of 11q and 16q have been reported to associate with IGF2 LOI in Wilms tumours (20), we further analysed LOH at these loci in our PLNRs. 11q LOH was observed in three cases (PLNR11, PLNR15 and PLNR22), all of which had LOI in our series. LOH at 16q was observed in only a single, LOI positive rest (PLNR22), intriguingly in a case where the concurrent Wilms tumour was of anaplastic histology.
Evidence for a non-obligate malignant progression from PLNR to Wilms tumour
For a subset of our samples (n=25), we were able to directly compare the aCGH profiles of the PLNRs and their concurrent Wilms tumours. For the majority (19/25, 76%) of cases, the Wilms tumours harboured the same copy number changes as those observed in the associated rest (Table 1). In three cases, the profiles were identical (Figure 4A), however for the most part, the tumours contained further changes in addition to those observed in the PLNR (Figure 4B). There were quantitatively more alterations in Wilms tumours than rests (median 4 vs 1, p<0.001, Mann-Whitney U test), even when those cases with no copy number changes were excluded (median 4 vs 3, p=0.011, Mann-Whitney U test).
Figure 4
Figure 4
Comparison of genomic profiles of PLNRs and Wilms tumours
To probe more rigorously the differences and similarities between PLNRs and Wilms tumours, we took several statistical approaches. Firstly we applied class comparison techniques between our complete series of 50 PLNRs and 25 Wilms tumours (all from FFPE), as well as our larger published series of 76 frozen Wilms tumour specimens (14), to look for widespread differences between the lesions. A Fishers exact test, corrected for multiple testing, revealed few statistically significant differences between rests and Wilms tumours, reflecting the common genetic alterations present between the precursor and the cancer. There were, however, two significantly different loci – gain of 1q and loss of 16q, which were present in Wilms tumours, but not observed in PLNRs in our series (Figure 4C).
In addition, we were able to apply paired statistics for our 25 patient-matched cases in order to reduce between-subject variability, and to track the molecular evolution of specific tumours. Using the paired Significance Analysis of Microarray (SAM) algorithm on our segmented data again highlighted +1q and −16q as significant alterations ‘acquired’ in the development from PLNR to Wilms tumour. This analysis showed that gains of chromosome 6 and losses at 10p and 14q were significantly associated with the later stages of Wilms tumorigenesis, as these were also not seen in rests (Figure 4D).
Furthermore, we calculated both concordance and similarity scores for our PLNR/Wilms tumour pairs, as described by Waldman and co-workers (18). For the majority of rests with detectable genomic alterations (9/15, 60%), the similarity score between a given rest and its associated Wilms tumour was considerably higher than for the remaining tumours (Figure 5, blue filled circles), and the concordance between pairs was high (>50%). In two cases, there was only a single higher score for the PLNR in the series of unmatched tumours. Cases of PLNR with no copy number changes inevitably had a low score when compared with the tumours (Figure 5, grey filled circles).
Figure 5
Figure 5
Similarity scores for pairs of PLNRs and Wilms tumours
Although these data are consistent with the notion that PLNRs are the molecular genetic precursor of the associated Wilms tumours, there were a few samples in which this model did not fit. In six cases, PLNRs harboured large-scale copy number changes not observed in the concurrent Wilms tumour (Table 1). These included the samples which contained the lowest similarity scores between the rest and matched tumour (Figure 5). There were three recurrent aberrations noted in these rests – gain of 18 (commonly seen in Wilms tumour) and gains of 10p and 14q (rarely reported in Wilms tumours). All of these PLNRs had a low proliferative index by Ki-67 immunohistochemistry. It is apparent from these data, and from five cases consisting of 13 multifocal lesions with differing genomic profiles (Table 1), that although the evidence for PLNRs as precursors is compelling, not all lesions must necessarily undergo malignant transformation.
Actively proliferating PLNRs represent a more advanced molecular genetic precursor
We investigated the genomic profiles of our entire series of PLNRs on the basis of the proliferation index (PI) assessed by Ki-67 staining. 16/50 (32%) PLNRs were classified as actively proliferating (4/50, 8% were highly proliferative), in contrast with 24/25 (96%) Wilms tumours (14/25, 56% highly proliferative) (Table 1). There were a greater number of copy number changes in proliferating vs non-proliferating PLNRs (median 2 vs 0.5, p=0.024, Mann-Whitney U test). In particular, the qualitative differences between these high and low PI rests was such that the aCGH profiles of highly proliferating PLNRs more closely resembled their associated Wilms tumour than did those with no Ki-67 immunoreactivity (mean Spearmans rank correlation coefficient 0.583 (range 0.489 – 0.641) vs 0.214 (range 0.029 – 0.430), p<0.001, Mann-Whitney U test). In addition, actively proliferating PLNRs/WTs had a significantly higher similarity score (median 4.86 vs −6.015, p=0.023, Mann-Whitney U test). Indeed in some instances the distinction cannot be made on the basis of the genetic, epigenetic or genomic data between actively proliferating, morphologically hyperplastic blastemal cells as part of a PLNR or an adjacent Wilms tumour (Figure 4A).
Here we present the first genome-wide profiling of copy number changes in PLNRs and associated Wilms tumours. The proposed precursor status of both PLNRs and ILNRs has been largely defined by epidemiological (21, 22) morphological (3, 23, 24), but only recently by molecular (6) evidence. Here we demonstrate clear clonal progression on the basis of copy number profiles of PLNRs and Wilms tumours.
The route by which Wilms tumours arise from ILNRs is believed to be accompanied by mutations and deletions of WT1 at 11p13 at an early developmental stage (5), followed by mutation and nuclear localisation of β-catenin during the progression to Wilms tumour (25), with Wnt pathway activation and downstream transcription factor activation. This sequence of events is strongly associated with a stromal histology in the subsequent Wilms tumour (11).
By contrast, PLNRs and the Wilms tumours accompanying or arising from them have been associated with dysregulation at the 11p15 locus by genetic and epigenetic means, leading to an overexpression of IGF2 (12). The molecular events accompanying this IGF2-driven pathway have not been elucidated, although it has previously been suggested that Wilms tumours with wild-type WT1 (presumably largely developed via the PLNR pathway) harboured more genetic alterations than those with WT1 mutations (ILNR pathway) (26).
We have determined the temporal order of changes in DNA copy number which occur during the IGF2/PLNR pathway of Wilms tumorigenesis. Large scale chromosomal alterations such as gain of 12, 13 and 18, and loss of 1p, were frequently observed in PLNRs and can be regarded as ‘early’ events. This is in contrast to other common Wilms-associated alterations - gain of 1q, 6 and loss of 10p and 16q, which were not observed in our PLNRs, and are therefore ‘later’ events in the proposed multistep model of Wilms tumour development.
It is of interest to note the disparity in timing between the copy number changes most convincingly associated with treatment failure and tumour relapse. Although loss of 1p was frequently observed in PLNRs, gain of 1q and loss of 16q were restricted to Wilms tumours. These three events have shown concordance in previous Wilms tumour profiling experiments, suggesting a common mechanism (14). The data provided here suggest a sequence in which the copy number loss of 1p occurs prior to a coordinated +1q/−16q, at least via the IGF2/PLNR pathway. The implication of this is that we would therefore expect the formation of an isochromosome 1q to also be associated with the WT1/ILNR pathway, although this remains to be determined.
Genetic loss at 16q has been previously associated with LOI at 11p15 (20, 27), with the gene encoding CTCF, a regulator of imprinting at the H19/IGF2 locus, found on 16q22. Our data add weight to the evidence (6, 28) that despite this, 16q abnormalities are later events, and are preceded by genetic and epigenetic up-regulation of IGF2. In the single PLNR in which we observed not a copy number change, but allelic loss, of 16q, the associated Wilms tumour was of anaplastic histology, a subtype strongly associated with mutations in TP53 (29). We were not able to determine the timing of the event in this case. Other correlates of IGF2 LOI in Wilms tumours have been reported as 11q loss and trisomy 12 (20). While we observed copy number gain of chromosome 12, and both LOH and loss at 11q in our rests, suggesting these are early events with the IGF2/PLNR pathway, neither correlated directly with LOI.
In around half of the PLNRs we profiled, no large scale changes in DNA copy number were observed. This is around twice the proportion of Wilms tumours that gave similarly copy neutral aCGH profiles (14) or normal karyotypes (30). Almost all of these cases, however, exhibited high levels of IGF2 expression, either due to LOI or LOH (and assumed UPD). Although this suggests that in some cases the genetic/epigenetic targeting of IGF2 is sufficient in its own right to drive the tumorigenic process through to blastemal cell persistence, which additional abnormalities may be required for tumour progression are yet to be identified. Alterations at the genetic, epigenetic, transcript, small RNA and/or post-translational modification levels may all play a role. In any case, the observation that those rests which were actively proliferating harboured more genomic alterations, and more closely resembled their associated Wilms tumours, suggests that in a proportion of cases at least, there are additional alterations driving clonal expansion and selection for the malignant phenotype (31).
In a small number of cases, the genomic profiles of PLNRs did not match with either the associated Wilms tumour, or with a topographically distinct rest. Given the often multifocal nature of PLNRs, this is perhaps not surprising, although it has not been demonstrated before. This evidence seems to suggest that PLNRs are non-obligate precursors, in that not all lesions necessarily develop into Wilms tumours, a fact clear from the seminal early studies by Beckwith, who reported that approximately 1 in 100 kidneys at birth harbour nephrogenic rests, while the incidence of Wilms tumour is only 1 in 10,000 (3, 21). We provide a molecular underpinning of this observation in patients who did develop Wilms tumour, demonstrating that certain lesions, often containing +10p and/or +14, may be genomic dead-ends, as their associated tumour, and Wilms tumours in general, did not harbour these alterations. It is possible that genomic gains at these loci may even actively promote regression or involution of the rest, an intriguing thought given that they are otherwise commonly lost in Wilms tumours themselves. By contrast, the frequent occurrence of +18 in these and other PLNRs and Wilms tumours suggest it to be in some instances a non-critical mutation in sporadic IGF2/PLNR Wilms tumorigenesis.
Although Wilms tumours have been classified as “PLNR-like” and “ILNR-like” on the basis of their associated precursor lesion, and appear to evolve by different genetic and epigenetic pathways, the two routes may incorporate significant cross-talk. The novel X-chromosome tumour suppressor gene, WTX, acts as a negative regulator of β-catenin in the cytoplasm, and WTX mutations may also drive nuclear localisation of β-catenin and subsequent up-regulation of its transcriptional targets (32). Unfortunately we have not been able to address whether WTX deletion occurs early in development, and is thus present in the PLNRs, as our array platform does not contain a suitable BAC clone at the Xq11 locus. Additionally, WT1 itself may act as a transcriptional repressor of both IGF2 (33) and its receptor, IGF1R (34), which may in turn mediate the nuclear translocation of β-catenin (35). The IGF2/IGF1R axis has recently been identified as playing a direct and central role in the self-renewal of embryonic stem cells (36). Immature blastemal cells, stem cells of the developing kidney, are more likely to predominate in the IGF2/PLNR Wilms tumours (12) and IGF1R may also be up-regulated in Wilms tumour blastema by genomic means (13). Deconvoluting the critical initiating steps and functional endpoints of these two developmental pathways is a key challenge for Wilms tumour biology.
ACKNOWLEDGEMENTS
This work is supported by Cancer Research UK, Breakthrough Breast Cancer, CLIC Sargent, and the University of Bristol Cancer Research Fund. We thank the Children's Cancer and Leukaemia Group (CCLG) Tumour Bank, which is funded by Cancer Research UK, as well as contributing pathologists, oncologists and surgeons, for access to samples. We are also grateful to Boo Messahel (Institute of Cancer Research), Lorna Tinworth (St George's Hospital Medical School), Michelle Lazenby and Mandy Gilkes (Department of Haematology, Cardiff University) for technical assistance.
Footnotes
STATEMENT OF CLINICAL RELEVANCE
The presence of nephrogenic rests in a child's kidney has been considered to confer an increased risk of Wilms tumour. Here we report the molecular genetic basis of the precursor status of these lesions. By defining a temporal order of the genomic alterations occurring during Wilms tumour pathogenesis, we are able to identify those key changes associated with malignancy, and distinguish them from ‘passenger’ alterations. This has implications for the diagnostic dilemmas of differential diagnosis between nephrogenic rest and overt Wilms tumour, and has translational relevance for treatment guidance in the clinic.
1. Schedl A. Renal abnormalities and their developmental origin. Nat Rev Genet. 2007;8:791–802. [PubMed]
2. Rivera MN, Haber DA. Wilms' tumour: connecting tumorigenesis and organ development in the kidney. Nat Rev Cancer. 2005;5:699–712. [PubMed]
3. Beckwith JB, Kiviat NB, Bonadio JF. Nephrogenic rests, nephroblastomatosis, and the pathogenesis of Wilms' tumor. Pediatr Pathol. 1990;10:1–36. [PubMed]
4. Fukuzawa R, Reeve AE. Molecular pathology and epidemiology of nephrogenic rests and wilms tumors. J Pediatr Hematol Oncol. 2007;29:589–94. [PubMed]
5. Park S, Bernard A, Bove KE, et al. Inactivation of WT1 in nephrogenic rests, genetic precursors to Wilms' tumour. Nat Genet. 1993;5:363–7. [PubMed]
6. Charles AK, Brown KW, Berry PJ. Microdissecting the genetic events in nephrogenic rests and Wilms' tumor development. Am J Pathol. 1998;153:991–1000. [PubMed]
7. Rainier S, Johnson LA, Dobry CJ, Ping AJ, Grundy PE, Feinberg AP. Relaxation of imprinted genes in human cancer. Nature. 1993;362:747–9. [PubMed]
8. Fukuzawa R, Breslow NE, Morison IM, et al. Epigenetic differences between Wilms' tumours in white and east-Asian children. Lancet. 2004;363:446–51. [PubMed]
9. Ohlsson R, Cui H, He L, et al. Mosaic allelic insulin-like growth factor 2 expression patterns reveal a link between Wilms' tumorigenesis and epigenetic heterogeneity. Cancer Res. 1999;59:3889–92. [PubMed]
10. Bjornsson HT, Brown LJ, Fallin MD, et al. Epigenetic specificity of loss of imprinting of the IGF2 gene in Wilms tumors. J Natl Cancer Inst. 2007;99:1270–3. [PubMed]
11. Schumacher V, Schuhen S, Sonner S, et al. Two Molecular Subgroups of Wilms' Tumors with or without WT1 Mutations. Clin Cancer Res. 2003;9:2005–14. [PubMed]
12. Ravenel JD, Broman KW, Perlman EJ, et al. Loss of imprinting of insulin-like growth factor-II (IGF2) gene in distinguishing specific biologic subtypes of Wilms tumor. J Natl Cancer Inst. 2001;93:1698–703. [PubMed]
13. Natrajan R, Reis-Filho JS, Little SE, et al. Blastemal expression of type I insulin-like growth factor receptor in Wilms' tumors is driven by increased copy number and correlates with relapse. Cancer Res. 2006;66:11148–55. [PubMed]
14. Natrajan R, Williams RD, Hing SN, et al. Array CGH profiling of favourable histology Wilms tumours reveals novel gains and losses associated with relapse. J Pathol. 2006;210:49–58. [PubMed]
15. Little SE, Vuononvirta R, Reis-Filho JS, et al. Array CGH using whole genome amplification of fresh-frozen and formalin-fixed, paraffin-embedded tumor DNA. Genomics. 2006;87:298–306. [PubMed]
16. Natrajan R, Williams RD, Hing SN, et al. Genomic Changes Associated With Favourable Histology Wilms Tumours Analysed Using Genome-Wide 1Mb-Spaced And Chromosome 1 Tiling-Path Array CGH. submitted.
17. Redon R, Ishikawa S, Fitch KR, et al. Global variation in copy number in the human genome. Nature. 2006;444:444–54. [PMC free article] [PubMed]
18. Waldman FM, DeVries S, Chew KL, Moore DH, 2nd, Kerlikowske K, Ljung BM. Chromosomal alterations in ductal carcinomas in situ and their in situ recurrences. J Natl Cancer Inst. 2000;92:313–20. [PubMed]
19. Natrajan R, Louhelainen J, Williams S, Laye J, Knowles MA. High-resolution deletion mapping of 15q13.2-q21.1 in transitional cell carcinoma of the bladder. Cancer Res. 2003;63:7657–62. [PubMed]
20. Watanabe N, Nakadate H, Haruta M, et al. Association of 11q loss, trisomy 12, and possible 16q loss with loss of imprinting of insulin-like growth factor-II in Wilms tumor. Genes Chromosomes Cancer. 2006;45:592–601. [PubMed]
21. Breslow N, Olshan A, Beckwith JB, Green DM. Epidemiology of Wilms tumor. Med Pediatr Oncol. 1993;21:172–81. [PubMed]
22. Breslow NE, Beckwith JB, Perlman EJ, Reeve AE. Age distributions, birth weights, nephrogenic rests, and heterogeneity in the pathogenesis of Wilms tumor. Pediatr Blood Cancer. 2006;47:260–7. [PMC free article] [PubMed]
23. Bove KE, McAdams AJ. The nephroblastomatosis complex and its relationship to Wilms' tumor: a clinicopathologic treatise. Perspect Pediatr Pathol. 1976;3:185–223. [PubMed]
24. Beckwith JB. Nephrogenic rests and the pathogenesis of Wilms tumor: developmental and clinical considerations. Am J Med Genet. 1998;79:268–73. [PubMed]
25. Fukuzawa R, Heathcott RW, More HE, Reeve AE. Sequential WT1 and CTNNB1 mutations and alterations of beta-catenin localisation in intralobar nephrogenic rests and associated Wilms tumours: two case studies. J Clin Pathol. 2007;60:1013–6. [PMC free article] [PubMed]
26. Ruteshouser EC, Hendrickson BW, Colella S, Krahe R, Pinto L, Huff V. Genome-wide loss of heterozygosity analysis of WT1-wild-type and WT1-mutant Wilms tumors. Genes Chromosomes Cancer. 2005;43:172–80. [PubMed]
27. Mummert SK, Lobanenkov VA, Feinberg AP. Association of chromosome arm 16q loss with loss of imprinting of insulin-like growth factor-II in Wilms tumor. Genes Chromosomes Cancer. 2005;43:155–61. [PubMed]
28. Yuan E, Li CM, Yamashiro DJ, et al. Genomic profiling maps loss of heterozygosity and defines the timing and stage dependence of epigenetic and genetic events in Wilms' tumors. Mol Cancer Res. 2005;3:493–502. [PubMed]
29. Bardeesy N, Falkoff D, Petruzzi MJ, et al. Anaplastic Wilms' tumour, a subtype displaying poor prognosis, harbours p53 gene mutations. Nat Genet. 1994;7:91–7. [PubMed]
30. Gow KW, Murphy JJ. Cytogenetic and histologic findings in Wilms' tumor. J Pediatr Surg. 2002;37:823–7. [PubMed]
31. Bove KE, Lewis C, Debrosse BK. Proliferation and maturation indices in nephrogenic rests and Wilms tumor; the emergence of heterogeneity from dormant nodular renal blastema. Pediatr Pathol Lab Med. 1995;15:223–44. [PubMed]
32. Major MB, Camp ND, Berndt JD, et al. Wilms tumor suppressor WTX negatively regulates WNT/beta-catenin signaling. Science. 2007;316:1043–6. [PubMed]
33. Lee YI, Kim SJ. Transcriptional repression of human insulin-like growth factor-II P4 promoter by Wilms' tumor suppressor WT1. DNA Cell Biol. 1996;15:99–104. [PubMed]
34. Werner H, Re GG, Drummond IA, et al. Increased expression of the insulin-like growth factor I receptor gene, IGF1R, in Wilms tumor is correlated with modulation of IGF1R promoter activity by the WT1 Wilms tumor gene product. Proc Natl Acad Sci U S A. 1993;90:5828–32. [PubMed]
35. Chen J, Wu A, Sun H, et al. Functional significance of type 1 insulin-like growth factor-mediated nuclear translocation of the insulin receptor substrate-1 and beta-catenin. J Biol Chem. 2005;280:29912–20. [PubMed]
36. Bendall SC, Stewart MH, Menendez P, et al. IGF and FGF cooperatively establish the regulatory stem cell niche of pluripotent human cells in vitro. Nature. 2007;448:1015–21. [PubMed]