PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jmedgeneJournal of Medical GeneticsCurrent TOCInstructions for authors
 
J Med Genet. Dec 2007; 44(12): 772–778.
Published online Aug 3, 2007. doi:  10.1136/jmg.2007.051979
PMCID: PMC2652813
Clinical, molecular and histopathological features of short stature syndrome with novel CUL7 mutation in Yakuts: new population isolate in Asia
N Maksimova, K Hara, A Miyashia, I Nikolaeva, A Shiga, A Nogovicina, A Sukhomyasova, V Argunov, A Shvedova, T Ikeuchi, M Nishizawa, R Kuwano, and O Onodera
N Maksimova, I Nikolaeva, V Argunov, Yakut Scientific Centre of Russian Academy of Medical Sciences and Government of Republic of Sakha (Yakutia), Yakutsk, Russia
K Hara, A Shiga, M Nishizawa, Department of Neurology, Brain Research Institute, Niigata University, Japan
A Miyashia, R Kuwano, Genome Science Branch, Center for Bioresource‐Based Researches, Brain Research Institute, Niigata University, Japan
A Nogovicina, A Sukhomyasova, A Shvedova, Republican Hospital No 1, National Medical Centre, Yakutsk, Russia
T Ikeuchi, O Onodera, Department of Molecular Neuroscience, Resource Branch for Brain Disease, Brain Research Institute, Niigata University, Niigata, Japan
Correspondence to: O Onodera
MD, PhD, Department of Molecular Neuroscience, Resource Branch for Brain Disease Research, Brain Research Institute, Niigata University, Asahi‐machi‐dori, Niigata 951‐8585, Japan; onodera@bri.niigata‐u.ac.jp
Received May 29, 2007; Revised July 14, 2007; Accepted July 17, 2007.
Background
In total, 43 patients having short stature syndrome in 37 Yakut families with autosomal recessive prenatal and postnatal nonprogressive growth failure and facial dysmorphism but with normal intelligence have been identified.
Methods
Because Yakuts are considered as a population isolate and the disease is rare in other populations, genomewide homozygosity mapping was performed using 763 microsatellite markers and candidate gene approach in the critical region to identify the causative gene for the short stature syndrome in Yakut.
Results
All families shared an identical haplotype in the same region as the identical loci responsible for 3‐M and gloomy face syndromes and a novel homozygous 4582insT mutation in Cullin 7 (CUL7) was found, which resulted in a frameshift mutation and the formation of a subsequent premature stop codon at 1553 (Q1553X). Yakut patients with short stature syndrome have unique features such as a high frequency of neonatal respiratory distress and few bone abnormalities, whereas the clinical features of the other Yakut patients were similar to those of 3‐M syndrome. Furthermore, abnormal vascularisation was present in the fetal placenta and an abnormal development of cartilage tissue in the bronchus of a fetus with CUL7 mutation.
Conclusion
These findings may provide a new understanding of the clinical diversity and pathogenesis of short stature syndrome with CUL7 mutation.
Keywords: 3‐M syndrome, CUL7, Yakuts, neonatal respiratory distress, vascularisation
Population isolates that have experienced marked decline in population size and have strikingly different demographic histories, have been used with great success in mapping and cloning mendelian disease genes.1 Yakuts are an East Asian population, and live in the northeastern part of Siberia in the Republic of Sakha of the Russian Federation. Yakuts emigrated from southern to northern Siberia in the 13th or 14th century AD and their population has expanded rapidly to >440 000 people in a particular restricted area.2 Y‐chromosome haplotype analysis of Yakuts has found that at some point they experienced a serious decline in their population size, which is known as the bottleneck effect.2,3 In addition, Yakuts exhibit high frequencies of some mendelian disorders.3 Taken together, these findings suggest that Yakuts are a population isolate that can provide a unique model for genetic studies.1
Yakuts have several hereditary diseases, with short stature syndrome being one of the main conditions.4 We have identified short stature syndrome in Yakut families with facial dysmorphism and with a relatively large head but with normal intelligence. These patients do not show apparent abnormalities in bone structure and hormone production, but some of them experienced respiratory distress at birth. The clinical spectrum of short stature syndrome in Yakuts resembles that of 3‐M syndrome (OMIM 273750), which is a rare autosomal recessive disorder characterised by severe prenatal and postnatal growth retardation and facial dysmorphism but with normal intelligence.5 Although the characteristic radiological findings of slender long bones and tall vertebral bodies have often been reported in patients with 3‐M syndrome, these radiological findings have not been commonly observed in short stature syndrome in Yakuts.5 Gloomy face syndrome is another similar type of short stature disorder; it has been reported that patients with gloomy face syndrome do not show any radiological abnormalities.6 Recently, it has been shown that both 3‐M and gloomy face syndromes are both caused by a mutation of Cullin 7 (CUL7) and should be grouped together.7 However, <50 patients with 3‐M syndrome and <10 patients with gloomy face syndrome have been reported to date, therefore the clinical diversity of these disorders has not yet been fully documented.5,8,9,10,11,12,13,14,15 We describe the clinical and histopathogical features of short stature syndrome in Yakuts with a new nonsense mutation in CUL7.
Subjects
In the regional Department of Medical Genetical Consultation, Republican Hospital No 1, National Medical Centre, Yakutsk, Russia, we recruited 43 patients with hereditary short stature syndrome and their 39 unaffected parents and relatives from 37 Yakut families. Affected siblings were recruited from six families. There were 25 (58%) female and 18 (42%) male patients. We retrospectively reviewed the medical records of these patients. Birth size and subsequent lengths/heights were expressed as standard deviation scores (SDS) according to the Yakut standards. In addition, we used 104 DNA samples from healthy Yakut people as normal controls. Blood samples were obtained from all the patients, their parents, and controls after obtaining informed consent. Genomic DNA was extracted from peripheral blood leukocytes using a standard protocol. This project was approved by the ethics committee of Niigata University.
Genomewide homozygosity mapping
We performed a genomewide homozygosity mapping of the 37 families having short stature syndrome using 763 microsatellite markers (ABI Prism Linkage Mapping Set HD‐5; Applied Biosystems, Foster City, California, USA) covering the entire autosome with an average interval of 4.6 cM. We carried out PCR using various MapPair microsatellite markers and analysed PCR products using an ABI Prism 3100 genetic analyser (Applied Biosystems). We determined all allele sizes using GeneScan V.3.1.2 and GENEMAPPER programs (both Applied Biosystems). The genetic distance between adjacent markers was determined using the Marshfield sex‐averaged linkage map. In addition, we developed two dinucleotide polymorphic markers between D6S1552 and D6S1582, based on simple repeat information from the UCSC Human Genome Browser (May 2004; http://genome.ucsc.edu/index.html). The primer sequences for each new marker were: 5′‐AAAAATTAGCTGGGCATGGTG‐3′ and GCAAGAGATCAAGACTTCAAG‐3′ (M4265 forward and reverse primers, respectively), and 5′‐ACCCACTCTACAAGAAAGAG‐3′; reverse primer, ATGCTCTCAGCAGTCAAGAG‐3′ (M4298 forward and reverse primers, respectively).
The allele frequencies of the markers were determined by analysing 50 Yakut control subjects.
Mutational analysis of CUL7
A series of 25 intronic primers for amplifying the 25 coding exons of CUL7 was designed. Each exon was amplified by PCR and the amplified products were purified with ExoSAP‐IT (Amersham Biosciences, Amersham, Buckinghamshire, UK) in a cycle sequencing reaction using BigDye Terminator V.3.0 (Applied Biosystems). We purified the reaction products using a NucleoSEQ kit (Maclerey‐Nagel, Duren, Germany) and analysed the products using an ABI 3100 DNA sequencer (Applied Biosystems).
PCR–restriction fragment length polymorphism analysis
The exon 25 of CUL7 was amplified using the primers 5′‐AGCAAAAGGATATACCAGGAG‐3′ (forward) and 5′‐TCCGTCTCTTCTCCAAGTTC‐3′ (reverse). The 240 bp fragment was digested with HinfI endonuclease, resulting in 115 and 125 bp fragments in the control individuals, whereas an undigested 240 bp fragment was obtained in the patients.
Histopathological analysis
We analysed the lungs and placentas from fetuses of 26 weeks' gestation with and without 3‐M syndrome. For molecular genetics, PCR–restriction fragment length polymorphism analysis was performed to identify the homozygous 4582insT mutation. The tissues were fixed in 10% formaldehyde solution, embedded in paraffin wax, and sections stained with H&E.
Identification of novel CUL7 mutation in short stature syndrome in Yakuts
Because Yakuts are considered as a population isolate and short stature syndrome is a rare recessive inherited disease commonly found in Yakutia, we applied the homozygosity mapping approach.1,16 A genomewide homozygosity mapping revealed that 23 of the 37 families shared a 7‐5‐5 haplotype at D6S1552, D6S282 and D6S271 in the homozygous state (table 11).). Therefore, we carried out fine genotyping using additional polymorphic markers in this region (ie, M4265, M4298, D6S1582, D6S1604 and D6S451) (table 11).). Loss of homozygosity at the telomere site was found at M4298 in patient 595 (pedigree 16), and loss in the centromere site at D6S271 in patients AA205 (pedigree 15), 4113 (pedigree 23) and AA91 (pedigree 23) (table 11).). Although loss of homozygosity was observed at D6S1582 in patients AA2436 and AA2447 (pedigree 35), the patients shared the 5‐5‐2‐4 haplotype, which was identical to those of the other patients at D6S282, D6S271, D6S1604 and D6S451 in the homozygous state. Therefore, this could be accounted for by replication slippage with the marker D6S1582. Notably, at M4298, all the patients except patient 595 were homozygous for allele 2, whereas none of the Yakut controls had allele 2 (table 11).). Taken together, the results indicated that the causative gene of short stature syndrome in Yakuts is located in a 623 kb segment between M4298 and D6S271 (table 11).
Table thumbnail
Table 1 Haplotype analysis of patients with 3‐M syndrome in 37 Yakut families
During this work, Huber et al reported identification of CUL7 as the causative gene of 3‐M and gloomy face syndromes. CUL7 is present in this critical region (table 11).). Because the clinical presentations of short stature syndrome in Yakuts were similar to those of 3‐M syndrome except for neonatal respiratory distress and low frequencies of slender tubular bones and tall vertebral bodies, we considered CUL7 a good candidate gene for short stature syndrome in Yakuts. Consequently, we performed sequence analysis of CUL7 in the patients using a series of 25 intronic primers to amplify the 25 coding exons of CUL7 and found a novel homozygous insertion T at position 4582 in exon 25 (fig 1A1A).). This type of mutation is a frameshift mutation with the development of a subsequent premature stop codon at position 1553 (Q1553X). All Yakut patients were homozygous for this frameshift mutation. To confirm the frequency of this substitution mutation in a normal population, we performed PCR‐RFLP analysis. The 4582insT mutation changes the recognition site of the HinfI endonuclease, causing the production of an undigested fragment (fig 1B1B).). This insertion was observed, as a heterozygous mutation, in one of the 200 control chromosomes studied.
figure mg51979.f1
Figure 1 Mutational analysis of CUL7. (A) Direct sequencing (see Methods) revealed a homozygous T insertion at position 4582 of CUL7. The patient (P) shows an undigested 240 bp fragment, whereas one of the patient's siblings (S1) and (more ...)
Demographics and clinical features of 43 patients with Q1553X CUL7 mutation
The length of gestation varied from 35 to 42 (median 37) weeks, and 5 of 35 (14%) babies were delivered by caesarean section. The mean birth length was 42.0 (−6.2 SDS; range −12.2 to −1.8) cm, and mean birth weight was 2330 (−3.04 SDS; range −1.06 to −5.06) kg. We evaluated the SDSs of height by age from birth to 45 years (fig 22).). The mean (SD) SDS was −5.6 (1.8) in females, −5.3 (1.5) in males and −5.5 (1.7 in total). There was no significant difference between the sexes (p = 0.18). The mean SDS of height for each age was from −4.23 to −6.57 and there was no significant correlation between age and SDS (r = 0.13, p = 0.07). The mean occipitofrontal head circumfluence was 36.3 cm (range 32 to 37 cm), which was comparable with the gestational age.
figure mg51979.f2
Figure 2 Body length SDS by age in 43 Yakut patients with 3‐M syndrome. We evaluated body length SDS in 25 female (open circles) and 18 male (closed squares) patients of different ages. In all, 23 female and 16 male patients of different (more ...)
In total, 18 (41.9%) infants had severe asphyxia and respiratory distress at birth and 11 (25.6%) infants required mechanical ventilation. In five (11.6%) families, newborns who were diagnosed clinically as having the same disease died immediately after birth of unknown causes. The respiratory failure observed was not due to respiratory distress syndrome caused by the lack of a lung surfactant or a lung infection.
The clinical features of the patients are summarised in table 22.. In all, 95% of the patients had a characteristic triangular face with a hypoplastic midface; a broad, frontal‐bossing, low nasal bridge; a depressed nasal root; a long philtrum; prominent mouth and prominent, full lips; and a pointed chin (fig 3A–E). A short neck, short and wide thorax, brachydactyly, micromelia of the hands and feet and prominent heels were observed in >95% of the patients in all generations, whereas a hydrocephaloid skull, sternum deformity, accentuated lumbar lordosis, muscle hypotonia and a large abdomen became less obvious in adult patients. All the patients showed normal intelligence. Hypoplasia of the 12th rib (4 cases), polydactyly (3), and syndactyly (1) were also observed in some patients (fig 3F3F).). Male hypogonadism was not observed. Hypospadia was observed in one case. The sizes of the uterus and ovary of the female patients were normal, except in two cases. Two men and one woman with the syndrome have children of normal height. Notably, the characteristic radiological findings for 3‐M syndrome(slender tubular bones or tall vertebral bodies) were observed in few patients (fig 3G3G).). Bone aging of the patients' hands was delayed in the first decade, but normalised after 16 years of age. The patients did not have a predisposition to malignancy. Three patients were > 40 years old with proportionally short stature <130–140 cm. The facial dysmorphism is not prominent in these three patients.
Table thumbnail
Table 2 Clinical features at the first time of diagnosis in 43 Yakut patients with 3‐M syndrome
figure mg51979.f3
Figure 3 Clinical features of Yakut patients of different ages with 3‐M syndrome from different families. (A) Newborn patient with 3‐M syndrome; note the large hydrocephaloid skull, relatively short stature, short neck, short and (more ...)
Histopathology of lung and placenta of patients with CUL7 mutation
The histopathological analysis in mice lacking p185, the mouse homologue of CUL7, shows a defect in the differentiation of trophoblasts, including an abnormal vascular structure in their placenta and the insufficient inflation of alveolar spaces in the lungs.17 To determine whether these abnormalities are present in humans, we histopathologically examined the lungs and placenta from fetuses of 26 weeks' gestation with and without a homozygous 4582insT mutation in CUL7. In the lungs of the fetus with CUL7 mutation, the amount of cartilaginous lamina of the medium and large bronchi was small and the cartilaginous lamina insufficiently developed (fug 4A), whereas there were no obvious abnormalities in the alveolar tissues, including vascularisation and cellular infiltration of these tissues (fig 4B4B).). In the placenta of the fetus with CUL7 mutation, a marked increase in the number of chorionic villi with numerous syncytial knots and intervillous lacuna constriction was observed (fig 4C4C),), whereas the number of trophoblast giant cells was normal (fig 4D4D).
figure mg51979.f4
Figure 4 Histopathological analysis of lungs and placenta of a normal fetus and a fetus with 3‐M syndrome at 26 weeks of gestation, stained with H&E. (A) The lung of the fetus with CUL7 mutation has a few small islands (more ...)
In this study, using the homozygosity mapping approach, we have mapped the candidate region for short stature syndrome in Yaluts to the identical locus as that for 3‐M syndrome, and found a new frameshift mutation in CUL7. In addition, we report the detailed clinical features of 43 patients with an identical mutation, 4582insT, and show the abnormal development of the cartilaginous lamina of the bronchus and abnormal vascularisation of the placenta of a fetus with CUL7 mutation.
The prevalence rate of short stature syndrome with CUL7 mutation in Yakut is ~0.01% (at least 43 patients among 440 000 people); the carrier frequency of the 4582insT mutation of CUL7 is approximately 2% in the Yakut population. The results indicate that Yakuts have a founder chromosome responsible for the CUL7 mutation. The result also indicates that Yakuts are a population isolate. Genetic analysis in population isolates makes it easier to find causative genes for mendelian inherited diseases and susceptibility genes for complex diseases.1,18 Although many population isolates have been reported among Caucasians, Yakuts are considered the first population isolate in Asia, thus, they have an important role in the identification of susceptibility genes for complex diseases, particularly in people with an Asian background.18
3‐M and gloomy face syndromes are both characterised by growth retardation and facial dysmorphism. Although they can be clinically distinguished by bone abnormalities, slender tubular bones and tall vertebral bodies, in childhood, Huber et al proposed that both conditions should be grouped together. Huber et al found similar bone abnormalities in an elderly patient with gloomy face syndrome and one with 3‐M syndrome, and recently identified CUL7 as the causative gene of both syndromes.7 Although Yakut patients with short stature syndrome have similar cardinal clinical features to those of patients with 3‐M syndrome (namely, severe growth retardation and characteristic face), they rarely show bone abnormalities even in the elderly.5,8,9,14,15 These findings suggest that these bone abnormalities are not crucial clinical features of short stature syndrome with CUL7 mutation.
Notably, 41.9% of the Yakut patients with 3‐M syndrome had asphyxia and respiratory distress at birth and 25.6% of them required mechanical ventilation. Although respiratory distress at birth has not been investigated in 3‐M or gloomy face syndromes, mice lacking CUL7 die immediately after birth of respiratory distress.17 Histolopathogical examination of the lungs of fetal and neonatal mice lacking CUL7 revealed that their lungs failed to inflate and showed markedly reduced alveolar space. In contrast, histopathological examination of the lungs of a Yakut fetus with a CUL7 fetus showed development of small cartilaginous tissues in medium and large bronchi; however, we did not detect any marked abnormality in the alveolar space of the lungs. CUL7 may affect the development of cartilaginous tissues in the lungs and may also cause respiratory distress at birth in humans. To clarify how the mutation of CUL7 impairs its function and whether this mutation is related to the development of respiratory distress, further investigation is required. The clinical features of short stature syndrome also resemble those of Mulibrey nanism (OMIM 253250) and Silver–Russell syndrome (OMIM 180860).19,20 However, the average height SDS of Yakuts with short stature syndrome is shorter than those of these two syndromes.19,20 In addition, short stature syndrome does not progressive during the lifespan of <40 years and does not induce any other physical, vascular and neurological problems. Therefore, we speculate that CUL7 may only affect prenatal and postnatal body size and not head size.
The precise mechanism of prenatal and postnatal growth retardation in 3‐M syndrome remains unclear. From the analysis of mice lacking CUL7, it could be speculated that CUL7 affects vasculogenesis or angiogenesis, and intracranial aneurysm has been reported in patients with 3‐M syndrome.7 However, we have never found any vascular malformation or aneurysm in our patients. To clarify the histopathological effects of the CUL7 mutation further, we performed histopathology on the lungs and placenta of a fetus with and one without CUL7 mutation. The number of villi in the placenta was markedly increased in the fetus with the mutation. This finding is consistent with the finding that mice lacking CUL7 show marked increases in the number of fetal blood vessels in labyrinths.17 Thus, the imbalance in the number of fetal and maternal blood vessels may underlie the mechanism of prenatal growth retardation in 3‐M syndrome.
The molecular mechanism of CUL7 mutations remains to be elucidated. CUL7 assembles an E3 ubiquitin ligase complex containing S‐phase kinase‐associated protein 1A (Skp1), F‐box‐only protein 29 (Fbx29) and RBX1 ring‐box 1 (ROC1), and also promotes ubiquitination.21 Moreover, it has been shown that CUL7 with nonsense (R1445X) and missense (H1464P) mutations in the Cullin domain hampers the ability of CUL7 to interact with ROC1, resulting in the failure to assemble polyubiquitin chains.7 Although the Q1533X (4582insT) mutation that we found in patients in Yakutia is located outside the Cullin domain, this mutation may also alter the ability of CUL7 bind to ROC1.7 Another possibility is that the 4582insT mutation might induce nonsense‐mediated mRNA decay. The 4582insT mutation causes premature termination at nucleotide 4582, which is 447 nucleotides upstream of the last exon–exon junction in CUL7. Recent molecular genetics have revealed that the premature stop codon terminates >50–55 nucleotides upstream of the last exon–exon junction and elicits nonsense‐mediated mRNA decay, which reduces the mRNA level to ~5–25% that of normal controls.22 This mechanism might also affect the pathogenesis of the 4582insT mutation.
Here, we show that short stature syndrome in Yakuts is caused by the 4582insT mutation of CUL7. This information may be useful for genetic counselling for Yakuts. This is the second report on patients with CUL7 mutation and the first comprehensive study of the clinical features of patients and histopathological findings of the lungs and placenta of patients with CUL7 mutation. These results may provide new insights for understanding the clinical diversity and pathogenesis of this rare hereditary short stature syndrome.
Acknowledgements
We sincerely thank the Yakut families for participating in this study. This study was supported in part by a grant‐in‐aid for scientific research on priority areas (Advanced brain science project and Applied genomics), a grant for young researchers within the framework of the Program of the Japan‐Russian Youth Exchange and HUGO Grant travel awards, and a grant for the promotion of Niigata University research projects.
Abbreviations
OMIM - Online Mendelian Inheritance in Man
RFLP - restriction fragment length polymorphism
SDS - standard deviation scores
Footnotes
Competing interests: none declared.
The first two authors contributed equally to this work.
Parental/guardian informed consent was obtained for publication of fig 3.
1. Peltonen L, Palotie A, Lange K. Use of population isolates for mapping complex traits. Nat Rev Genet 2000. 1182–190.190. [PubMed]
2. Pakendorf B, Novgorodov I N, Osakovskij V L, Danilova A P, Protod'jakonov A P, Stoneking M. Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts. Hum Genet 2006. 120334–353.353. [PubMed]
3. Tarskaia L A, Zinchenko R A, El'chinova G I, Egorova A G, Korotov M N, Basova E V, Prokop'eva A M, Sivtseva E N, Nikolaeva E E, Banshchinkova E S, Samarkina M V, Danilova G I, Zhelobtsova A F, Danilova A P, Popova G N. [The structure and diversiity of hereditary pathology in Sakha Republic (Yakutia)]. Genetika 2004. 401530–1539.1539. [PubMed]
4. Nogovicina A N, Maksimova N R, Khandy M V. Monogenic hereditary diseases of families consulted in Medical Genetical Department of National Center of the Republic of Sakha (Yakutia) from 1990 to 1998 years. Far East Med J 1999. 126–30.30.
5. Miller J D, McKusick V A, Malvaux P, Temtamy S, Salinas C. The 3‐M syndrome: a heritable low birthweight dwarfism. Birth Defects Orig Artic Ser 1975. 1139–47.47. [PubMed]
6. Le Merrer M, Brauner R, Maroteaux P. Dwarfism with gloomy face: a new syndrome with features of 3‐M syndrome. J Med Genet 1991. 28186–191.191. [PMC free article] [PubMed]
7. Huber C, Dias‐Santagata D, Glaser A, O'Sullivan J, Brauner R, Wu K, Xu X, Pearce K, Wang R, Uzielli M L, Dagoneau N, Chemaitilly W, Superti‐Furga A, Dos Santos H, Megarbane A, Morin G, Gillessen‐Kaesbach G, Hennekam R, Van der Burgt I, Black G C, Clayton P E, Read A, Le Merrer M, Scambler P J, Munnich A, Pan Z Q, Winter R, Cormier‐Daire V. Identification of mutations in CUL7 in 3‐M syndrome. Nat Genet 2005. 371119–1124.1124. [PubMed]
8. Cantu J M, Garcia‐Cruz D, Sanchez‐Corona J, Fragoso R, Hernandez A, Nazara‐Cazorla Z. 3‐M slender‐boned nanism. An intrauterine growth retardation syndrome. Am J Dis Child 1981. 135905–908.908. [PubMed]
9. Hennekam R C, Bijlsma J B, Spranger J. Further delineation of the 3‐M syndrome with review of the literature. Am J Med Genet 1987. 28195–209.209. [PubMed]
10. Marik I, Marikova O, Kuklik M, Zemkova D, Kozlowski K. 3‐M syndrome in two sisters. J Paediatr Child Health 2002. 38419–422.422. [PubMed]
11. Meo F, Pinto V, D'Addario V. 3‐M syndrome: a prenatal ultrasonographic diagnosis. Prenat Diagn 2000. 20921–923.923. [PubMed]
12. Spranger J, Opitz J M, Nourmand A. A new familial intrauterine growth retardation syndrome the “3‐M syndrome”. Eur J Pediatr 1976. 123115–124.124. [PubMed]
13. Temtamy S A, Aglan M S, Ashour A M, Ramzy M I, Hosny L A, Mostafa M I. 3‐M syndrome: a report of three Egyptian cases with review of the literature. Clin Dysmorphol 2006. 1555–64.64. [PubMed]
14. van der Wal G, Otten B J, Brunner H G, van der Burgt I. 3‐M syndrome: description of six new patients with review of the literature. Clin Dysmorphol 2001. 10241–252.252. [PubMed]
15. Winter R M, Baraitser M, Grant D B, Preece M A, Hall C M. The 3‐M syndrome. J Med Genet 1984. 21124–128.128. [PMC free article] [PubMed]
16. Houwen R H, Baharloo S, Blankenship K, Raeymaekers P, Juyn J, Sandkuijl L A, Freimer N B. Genome screening by searching for shared segments: mapping a gene for benign recurrent intrahepatic cholestasis. Nat Genet 1994. 8380–386.386. [PubMed]
17. Arai T, Kasper J S, Skaar J R, Ali S H, Takahashi C, DeCaprio J A. Targeted disruption of p185/Cul7 gene results in abnormal vascular morphogenesis. Proc Natl Acad Sci U S A 2003. 1009855–9860.9860. [PubMed]
18. Arcos‐Burgos M, Muenke M. Genetics of population isolates. Clin Genet 2002. 61233–247.247. [PubMed]
19. Karlberg N, Jalanko H, Perheentupa J, Lipsanen‐Nyman M. Mulibrey nanism: clinical features and diagnostic criteria. J Med Genet 2004. 4192–98.98. [PMC free article] [PubMed]
20. Price S M, Stanhope R, Garrett C, Preece M A, Trembath R C. The spectrum of Silver‐Russell syndrome: a clinical and molecular genetic study and new diagnostic criteria. J Med Genet 1999. 36837–842.842. [PMC free article] [PubMed]
21. Dias D C, Dolios G, Wang R, Pan Z Q. CUL7: A DOC domain‐containing cullin selectively binds Skp1.Fbx29 to form an SCF‐like complex. Proc Natl Acad Sci U S A 2002. 9916601–16606.16606. [PubMed]
22. Kuzmiak H A, Maquat L E. Applying nonsense‐mediated mRNA decay research to the clinic: progress and challenges. Trends Mol Med 2006. 12306–316.316. [PubMed]
Articles from Journal of Medical Genetics are provided here courtesy of
BMJ Group