PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

Logo of bmcresnotesBioMed Centralbiomed central web sitesearchsubmit a manuscriptregisterthis articleBMC Research Notesjournal front page
 
From:
Published online Dec 22, 2008. doi: 10.1186/1756-0500-1-132
Table 1
Primer pairs used for real time quantitative RT-PCR
Gene abbreviationGene definitionGenBank accessionUnigene IDPrimer pair
(5'-forward-3'/5'-reverse-3')
Product size
(bp)
STS1Stilbene synthase1DQ366301Vvi.8CGAAGCAACTAGGCATGTGT/CTCCCCAATCCAATCCTTCA134

STS2Stilbene synthase2DQ366302Vvi.8ACCAAAGTCCAAGATCACCCA/ACAACATCACCCTTCTAACCGAT122

PAL1Phenylalanine ammonia lyaseEC987386Vvi.1950CCGAACCGAATCAAGGACTG/GTTCCAGCCACTGAGACAAT183

C4H1Cinnamate-4-hydroxylseEC995763Vvi.6228AAAGGGTGGGCAGTTCAGTT/GGGGGGTGAAAGGAAGATAT109

4CL14-coumarate-CoA ligaseEC947790Vvi.1251CTGATGCCGCTGTTGTTTCG/GCAGGATTTTACCCGATGGA198

CHS1Chalcone synthase1EC996578Vvi.117GTCCCAGGGTTGATTTCCAA/TCTCTTCCTTCAGACCCAGTT157

CHS2Chalcone synthase2EC996527Vvi.1973TTTGGGCATCAAGGACTGGA/CTCGGGCTTTAGGGCTAAT100

CCR2Cinnamoyl-CoA reductaseCF517687Vvi.15864ACAGCATGACGACTCTCTTCG/AGTGACAAGGGGTGGATTGA182
Articles from BMC Research Notes are provided here courtesy of
BioMed Central