PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC Dec 26, 2008.
Published in final edited form as:
PMCID: PMC2610260
NIHMSID: NIHMS81599
Serotonergic transcription of human FEV reveals direct GATA factor interactions and fate of Pet-1 deficient serotonin neuron precursors
Katherine C. Krueger and Evan S. Deneris
Case Western Reserve University School of Medicine, Department of Neurosciences Cleveland Ohio 44106
Correspondence: Evan Deneris Case Western Reserve University School of Medicine, Department of Neuroscience 2109 Adelbert Rd. Cleveland, Ohio 44106-4975 Phone: 216-368-8725, FAX: 216-368-4650 ; esd/at/case.edu
Altered expression of the human FEV ETS transcription factor gene impacts the level of CNS serotonin (5HT) neuron gene expression and maternal nurturing. However, the regulatory mechanisms that determine FEV expression are poorly understood. Here, we investigated the cis-regulatory control of FEV to begin to identify the upstream transcription factors that restrict FEV expression to 5HT neurons. We find that sequences extending only 275 bp upstream of the FEV 5′-untranslated region are sufficient to direct FEV transgene expression to embryonic 5HT neurons although sequences further upstream are required for maintenance in adult 5HT neurons. Two highly conserved consensus GATA factor binding sites within the 275 bp region interact with GATA factors in vitro. Chromatin immunoprecipitations with embryonic hindbrain demonstrated Gata-2 interactions with the orthologous mouse Pet-1 ETS cis-regulatory region. Mutagenesis of GATA sites revealed that one or the other site is required for serotonergic FEV transgene expression. Unexpectedly, FEV-lacZ transgenes also enabled determination of 5HT neuron precursor fate in the adult Pet-1−/− dorsal and median raphe nuclei and thus provided further insight into Fev/Pet-1 function. Comparable numbers of FEV-LacZ positive cells were detected in Pet-1+/− and Pet-1−/− adult dorsal raphe nuclei indicating that the majority of mutant serotonergic precursors are not fated to apoptosis. However, B7 dorsal raphe cells were aberrantly distributed, suggesting a role for FEV/Pet-1 in their midline organization. Our findings identify a direct transcriptional interaction between Gata-2 and FEV and a unique marker for new insight into FEV/Pet-1 function in 5HT neuron development.
Keywords: FEV, Pet-1, GATA-2, serotonin, cis-regulatory, transgenic
Alterations in serotonin (5HT) neuron gene expression lead to changes in emotional behavior in rodents (Ansorge et al., 2007; Beaulieu et al., 2008) and are associated with depression and anxiety disorders in humans (Ansorge et al., 2007; Murphy and Lesch, 2008). A critical developmental determinant of serotonergic gene expression is the ETS transcription factor Pet-1 (Hendricks et al., 2003). In Pet-1−/− mice, normal numbers of serotonergic precursors are generated in the ventral hindbrain, but most fail to express tryptophan hydroxylase 2 (TPH2), the serotonin transporter (SERT), and other serotonergic genes. The dramatically reduced levels of 5HT in Pet-1−/− deficient mice is associated with delayed respiratory maturation (Erickson et al., 2007), increased aggression and anxiety-like behavior in adulthood (Hendricks et al., 2003) and a profound deficit in maternal behavior (Lerch-Haner et al., 2008).
Pet-1 expression is governed by a serotonergic transcriptional cascade that includes the proneural factor Mash1 (Pattyn et al., 2004), the homeodomain factor Nkx2.2 (Pattyn et al., 2003), and the forkhead box factor Foxa2 (Jacob et al., 2007) in ventral hindbrain progenitors and the zinc finger factor Gata-2 in postmitotic precursors (Craven et al., 2004). We showed previously that a cis-regulatory region upstream of Pet-1 is sufficient to direct transgene reporter expression to developing and adult 5HT neurons (Scott et al., 2005). Therefore, this region is a target of upstream serotonergic transcriptional cascade. However, the precise location of cis-regulatory elements for serotonergic expression of Pet-1 has not been determined, nor is it known whether any of the identified transcription factors in the cascade directly regulate Pet-1.
Human FEV encodes a protein that has 96% identity to Pet-1 and is expressed specifically in human raphe (Iyo et al., 2005). Recently, we showed that both serotonergic and nurturing deficits in Pet-1−/− mice could be rescued with a bacterial artificial chromosome encoding FEV (Lerch-Haner et al., 2008), hence demonstrating that FEV is an orthologue of Pet-1. Importantly, the levels of serotonergic gene expression in rescued Pet-1−/− mice, as well as maternal care and offspring survival, depended on the level of FEV gene expression. These findings show subtle alterations in FEV expression can influence serotonergic gene expression and the quality of nurturing behaviors. Thus, FEV regulation and function may be relevant to disease pathogenesis (Rand et al., 2007). However, the mechanisms that control FEV expression in 5HT neurons have not been investigated.
Here, we investigated the cis-regulatory control of FEV and report that sequences surrounding the FEV transcriptional start site are sufficient to direct 5HT neuron-specific transgene expression. Two conserved GATA sites in this region are required in a functionally redundant manner for serotonin neuron transgene expression. Finally, FEV-directed transgenes enable fate analysis of mutant 5HT neuron precursors in the adult Pet-1−/− brain and show that these mutant precursors are maintained but are aberrantly distributed. Our findings provide insight into the regulation and function of conserved human and mouse serotonergic developmental control genes and a transcriptional control map for future identification of functional FEV cis-regulatory variants.
Transgenes
FEV2.2Z, FEV1.1Z, and FEV0.6Z
A BGZA vector (Yee and Rigby, 1993) was first modified to introduce BglII and PacI sites in the multiple cloning site, and then a 2.2 kb BglII/PacI FEV upstream fragment was subcloned into the modified BGZA vector. The vector sequences were removed prior to pronuclear injection with EagI. FEV1.1Z and FEV0.6Z were prepared by KpnI/EagI or StuI/EagI digests, respectively, of the FEV2.2Z plasmid.
FEV2.2ΔZ and FEV1.1ΔZ
PCR was used to amplify products on either side of the deletion (Figure 1) using the following primers: 5′-GGGCAGATCTGAATCTGCCCTTGACTGAGC-3′ and 5′-TAATGCGCGCCTTCCCCGTCTCCTTCTTG-3′; 5′-TAATGCGCGCGAAGAAGGGCTCTAGGGAGG-3′ and 5′-GGCGTCTAGACCTTAATTAAAGCGCTGCCG-3′ (underline indicates BglII, BssHII, or PacI sites used to clone in the amplified products). PCR products were inserted into the corresponding BglII, BssHII, or PacI sites in the FEV2.2Z plasmid, and sequenced. Relative to the predicted start site, sequences −214/+25 were removed. FEV2.2ΔZ and FEV1.1ΔZ were digested with EagI or KpnI/EagI prior to injection.
Figure 1
Figure 1
Conserved FEV/Pet-1 upstream sequences and transgene structure
FEV2.2ZΔβg
FEV2.2Z was digested with PacI and SbfI to excise the β-globin TATA box, overhanging ends were blunted, and self-ligated to generate FEV2.2ZΔβg. Reporters were verified by sequencing prior to pronuclear injection. The vector backbone sequences were removed by EagI digest.
GATA mutants
For mutagenesis of GATA binding sites, the QuikChange Site-Directed Mutagenesis Kit (Stratagene) was used. Following a previously described strategy (Kobayashi-Osaki et al., 2005), the GATA sites were destroyed either singly or in combination by modification of the “GATA” motif to “AATT” using the following mutagenic primers (underlined residues were modified): FEV distal site (GATA1) 5'- GGATGCGGGCAGAGATAAAGGGAGCAACGGCTGC-3' and complement; FEV proximal site (GATA2) 5'- GGAAATTTAAAAGTGAAGATGCAGATAACGCAGCCTGGAGACGGG -3' and complement. The inserts were fully sequenced, and EagI digest was used to release the inserts prior to pronuclear injection.
FEV60Z
Genomic DNA was obtained from a human bacterial artificial chromosome RPCI-3304 (accession AC097468). A pBACe3.6 vector (Frengen et al., 1999) was modified by the insertion of a polylinker containing PmeI and RsrII restriction sites into the MluI site (Scott et al., 2005). A 58.6 kb NruI/RsrII FEV fragment was obtained from RPCI-3304 and subcloned into pBACe3.6 using PmeI and RsrII sites. The β-globin TATA, lacZ, and SV40 polyadenylation sequences were released from a BGZA plasmid (Yee and Rigby, 1993) with an EagI/NotI digest and inserted into the NotI site of pBACe3.6 downstream of the FEVfragment to prepare FEV60Z. The vector backbone of FEV60Z transgene was removed with AscI prior to pronuclear injection.
Transgenic mice
Pronuclear injections were carried out by the Case Transgenic and Targeting Facility as described (Scott et al., 2005). FEV60Z founders were identified by PCR with 5'-CAAAGACAGGAGGAGGTTGGTAGC-3' and 5'-TTGGGTAACGCCAGGGTTTTCC-3' primers. All other transgenes were identified with 5'-CTTTATTGCGATGGGACGAT-3' and 5'-GTTTTCCCAGTCACGACGTT-3'. Cycling conditions were as follows: 95ºC for 5min; 35 cycles of 30 s at 94ºC, 30 s at 60ºC, then 60 s at 72ºC; then 72ºC for 7 min. Products were 260 bp. Pet-1−/− and Pet-1+/− mice were generated and genotyped as described (Hendricks et al., 2003). Twelve lines were generated for FEV2.2Z, seven of which were analyzed at E12.5. For FEV0.6Z, 17 founders/lines were analyzed at E12.5. Three additional FEV0.6Z lines were generated but were excluded from our analyses due to a high level of ectopic hindbrain transgene expression. For FEV1.1Z, FEV2.2ΔZ, FEV1.1ΔZ, FEV2.2ZΔβg, and GATA mutant lines, founder E12.5 embryos were evaluated exclusively by whole-mount X-gal staining, followed in certain lines by staining for 5HT.
Histology
Adult mice were transcardially perfused for 15-20 min with ice-cold 4% PFA in 0.1 M PBS, post-fixed for 4 hrs at 4ºC, then sunk overnight in 20% sucrose in 0.1 M PBS. Embryos were fixed by immersion in 4% PFA in 0.1 M PBS for 10 min (whole-mount Xgal staining) or 1 hr (slices). Xgal staining was carried out on fixed whole embryos as described (Scott et al., 2005); otherwise, embryos were sunk in 30% sucrose overnight at 4ºC, then frozen in Tissue Freezing Medium and stored at -80ºC. Tissue sections were obtained using the freezing microtome (adult, 20 µm) or cryostat (embryo, 10-20 µm). In some cases, following whole mount Xgal staining, embryos were fixed, sliced, and stained for 5HT as described (Hendricks et al., 1999). Fluorescent immunohistochemistry for βgal, 5HT, TPH, and NeuN was carried out as described (Scott et al., 2005). Gata-2 immunostaining was carried out with RC1.1 rat anti-chicken Gata-2 antibody (gift from J.D. Engel). Other antisera used were mouse anti-Gata-3 (Santa Cruz Biotechnology), chicken anti-tyrosine hydroxylase (TH, Aves), and goat anti-choline acetyltransferase (ChAT, Chemicon). Gata-3 immunostaining required a mild antigen retrieval treatment (30 min incubation at 37ºC in 10 mM citric acid, pH 3) prior to incubation with primary antibody.
Sequence analysis
Human and mouse sequence comparisons were carried out as described (Scott et al., 2005). The minimal criteria for significant sequence conservation were 70% identity over 100 bp. Gene annotation information was derived from NCBI (FEV accession NM_017521, Pet-1 accession NM_153111) and the ECR browser tools (Ovcharenko et al., 2004). Predicted transcription factor binding sites were obtained using rVista 2.0 (Loots and Ovcharenko, 2004) and MatInspector (Cartharius et al., 2005). FEV-proximal conserved sequences were identified using a discontiguous megaBLAST search of the Whole Genome Survey database and Trace Archives (NBCI) and aligned using CLUSTALW (MacVector 7).
Electrophoretic mobility shift assays
Assays were carried out with the LightShift EMSA Kit (Pierce) using the supplied binding buffer supplemented with 1 mM EDTA (except for experiments with recombinant protein or antibody). GATA sites upstream of FEV were tested with the following biotinylated oligonucleotides (GATA motif underlined): GATA1 site, 5'-CGGGCAGAGATAAAGGGAGC -3'; GATA2 site, 5'- AAGATGCAGATAACGCAGCC -3'; and complementary oligonucleotides. Biotin-labeled oligonucleotides were annealed and 60-80 fmol of double-stranded oligonucleotides were incubated with ˜1 µg recombinant Gata-1 protein (Panomics) or 6.4-12.8 µg HeLa nuclear extracts (Promega). Competition assays were carried out using 100-fold excess of unlabeled wildtype or base substituted oligonucleotides (in which the “GATA” motif was changed to “AATT” as in transgenic studies). For supershift experiments, 5 µl of goat anti-Gata-2 (Santa Cruz) or rabbit anti-GFP (Invitrogen) were used. For both supershift and competition experiments, extracts were preincubated for 20 min in the absence of labeled DNA, followed by 20 min incubation with labeled oligonucleotide. Reactions were electrophoresed on 6% PAGE in 0.5X TBE and processed according the manufacturer's instructions (Pierce).
Chromatin immunoprecipitation (ChIP) assays
Hindbrain tissues (from mesencephalic flexure to cervical flexure) were removed from 141 E11.5 embryos and quick frozen on dry ice. Gata-2 occupancy of genomic regions was tested by GenPathway, Inc. (San Diego), using rabbit anti-Gata-2 antibody (Santa Cruz Biotechnology) and quantitative PCR (QPCR) according to their protocols (Alexiadis et al., 2007). Supplemental Table 1 gives the sequences of primers used for QPCR. Each primer pair gave a single product by melt-curve analysis and agarose gel electrophoresis. Binding was tested in triplicate for two negative control regions (untranscribed genomic regions Untr8, Untr17) and several FEV upstream regions containing predicted GATA sites. Data are expressed as fold increase in binding for each sample relative to binding at Untr17. Differences in binding among regions were calculated using one-way ANOVA with Bonferroni's Multiple Comparison Test (Prism 4.0). Replication of the entire assay gave similar results.
Cell counts
A template for counting was generated in Adobe Photoshop CS3, and consisted of four identical boxes centered on an image of a wildtype section outside the main body of the B7 dorsal raphe nucleus (DRN) (Figure 8E). Images of knockout and control B7 were overlaid with this same template, centered at the midline using the ventricle and midline nuclei, and all cells within these boxes were counted. The mean number of cells within the boxes per section was averaged for each animal, and groups (knockout or control) were compared using a two-tailed t-test. A total of eight Pet-1−/− and six control (five Pet-1+/− and one Pet-1+/+) adult animals were counted, 3-7 sections (mean = 5) per animal.
Figure 8
Figure 8
Pet-1−/− cells in the B7 DRN retain serotonergic character but are aberrantly distributed
Human FEV cis-regulatory elements direct expression to developing and adult 5HT neurons
Rodent 5HT neurons develop in two ventral hindbrain domains, a rostral domain extending from rhombomere (r) r1 to r3, and a caudal domain extending from r5-r7 (Lidov and Molliver, 1982; Wallace and Lauder, 1983; Hendricks et al., 1999). Pet-1 expression is initiated at E10.5-E11 in the mouse rostral domain followed about 1 day later by expression in the caudal domain (Pfaar et al., 2002; Pattyn et al., 2003). In the adult brain a large number of 5HT neurons are present in the midline raphe nuclei, although significant numbers are also found scattered in more lateral regions of the pontine reticular formation and ventrolateral medulla (Steinbusch, 1981). Expression of the endogenous Pet-1 gene is maintained in what appears to be all 5HT neurons of the adult brain (Hendricks et al., 1999).
Our previous studies showed that a 1.8 kb fragment immediately upstream of mouse Pet-1 was sufficient to direct transgene expression in embryonic and adult 5HT neurons (Scott et al., 2005). Comparison of the Pet-1 and FEV upstream regions revealed two blocks of sequence conservation (Figure 1). The proximal block includes the FEV 5'-untranslated exon and extends 310 bp into the FEV upstream region. The distal block comprises three subregions, the first of which begins 895 bp upstream of the FEV start site. To determine whether or not 5HT neuron-specific elements are located among these sequences we isolated a 2.2 kb FEV genomic fragment whose 3' end is located in the FEV 5' untranslated region (Figure 1). This fragment was ligated upstream of a β-globin TATA box/lacZ/poly(A) signal sequence cassette (Yee and Rigby, 1993; Helms et al., 2000) to prepare transgene reporter FEV2.2Z. The β-globin TATA box was included in this and other transgenes to ensure the presence of a start site as neither the Pet-1 nor FEV promoters have been experimentally localized.
Seven FEV2.2Z lines were analyzed for expression at embryonic stages. Similar to endogenous Pet-1, FEV2.2Z expression was initiated in the rostral hindbrain between E10.5-E11 (data not shown) and then expanded into the caudal domain by E12.5 (Figure 2A) in six of seven lines (Figure 1). Co-immunostaining with anti-5HT and anti-β-galactosidase (βgal) revealed a 5HT neuron specific pattern of FEV2.2Z expression in the hindbrain (Figure 2B). Expression of FEV2.2Z, however, was weak in the posterior half of the caudal hindbrain near the cervical flexure (Figure 2C, C') in all but one line.
Figure 2
Figure 2
FEV is controlled by a cis-regulatory region that directs expression to developing and adult 5HT neurons
In eleven of twelve lines, adult FEV2.2Z expression was reproducibly present in the DRN and median raphe nuclei (MRN) as well as in the reticular formation and ventrolateral medulla (Figure 2D-F and data not shown). Coimmunostaining of FEV2.2Z mice indicated that the majority of βgal+ cells expressed tryptophan hydroxylase (TPH), the rate-limiting enzyme for 5HT biosynthesis, in each of the adult raphe nuclei (Figure 2G-G”). However, a small number of βgal/TPH+cells was observed in all FEV2.2Z lines (Fig 2G”), and FEV2.2Z expression was missing from most 5HT neurons in the B2 raphe obscurus (data not shown) in all but one line. These cells likely correspond to cells derived from the posterior half of the embryonic caudal hindbrain, and therefore additional cis regulatory elements probalby direct expression to this subdomain. Nevertheless, these findings show that a conserved regulatory region upstream of FEV directs transgene expression to developing and adult 5HT neurons.
FEV promoter sequences are necessary and sufficient for embryonic serotonergic transgene expression
We next tested several additional FEV transgenes to determine the location of essential serotonergic cis regulatory elements within the FEV 2.2 kb fragment. To investigate the importance of distal conserved sequences, we generated two transgenes with 5' truncations of either 1.1 kb or 1.6 kb (FEV1.1Z or FEV0.6Z, respectively) (Figure 1). Similar to FEV2.2Z, both FEV1.1Z and FEV0.6Z expression was restricted to the rostral and caudal hindbrain (Figure 3A, B). Further analysis of FEV0.6Z indicated that FEV0.6Z was expressed in a 5HT neuron specific pattern in the hindbrain (Figure 3C), but expression was again lacking in posterior caudal 5HT neurons (Figure 3D, D'). Thus, important cis regulatory elements for embryonic expression are not likely to be associated with the distal conserved sequences. These findings additionally suggest that conserved sequences surrounding the FEV transcriptional start site (−275/+318) constitute a minimal FEV cis-regulatory region sufficient for 5HT neuron-specific transgene expression in the developing hindbrain. However, when four FEV0.6Z lines showing restricted serotonergic expression of LacZ in the embryonic hindbrain were evaluated at adult stages, only one of them continued to express LacZ, and this expression was very weak (data not shown). Thus, additional regulatory elements that are present in FEV2.2Z but missing in FEV0.6Z are likely to be required for maintenance of expression.
Figure 3
Figure 3
Proximal conserved sequences are necessary and sufficient for 5HT neuron-specific expression in the developing hindbrain
We next asked whether proximal conserved sequences were necessary for 5HT neuron specific expression by testing a transgene, FEV2.2ΔZ, in which sequences −214 to +25 of the proximal block were deleted in the context of the 2.2 kb upstream fragment (Figure 1). Transgenic founders were analyzed at E12.5 using whole-mount Xgal staining. Deletion of these sequences led to a complete loss of serotonergic expression of FEV2.2ΔZ although ectopic expression was present (Figure 3E, F vs. G). Similar results were obtained for a second transgene, FEV1.1ΔZ, in which −214/+25 sequences were removed from FEV1.1Z (Figure 1).
Our findings show that proximal conserved sequences are not only sufficient but also necessary for 5HT neuron expression of FEV in the developing rostral and anterior portion of the caudal hindbrain. Furthermore, they suggest that the FEV promoter comprises the 5' flanking proximal sequences that are deleted in FEV2.2ΔZ and FEV1.1ΔZ. Consistent with this hypothesis, a 2.2 kb FEV transgene lacking the β-globin TATA box, FEV2.2ZΔβg, was expressed in a 5HT neuron-specific pattern (Figure 1). Therefore, the β-globin start site is not required, and likely does not contribute to, transgene expression. Since FEV sequences can initiate transcription in the absence of a heterologous start site, and deletion of proximal sequences results in loss of specific expression, we conclude that these conserved sequences immediately upstream of the FEV start site constitute the FEV promoter region.
Conserved GATA binding sites are present in the FEV promoter region
We next sought to identify putative transcription factor binding sites within the FEV upstream region to begin to determine factors that directly control FEV transcription. Upstream sequences were analyzed for candidate binding sites using the rVista (Loots and Ovcharenko, 2004) and MatInspector (Cartharius et al., 2005) tools. Interestingly, this analysis identified possible binding sites for NUDR/DEAF-1, Engrailed-1, and GATA transcription factors clustered in the promoter region (Figure 4A). NUDR/DEAF-1 has been shown to be a repressor of the 5HT1A receptor gene (Htr1a) through binding to an upstream polymorphic site (Lemonde et al., 2003) and loss of function studies have implicated Engrailed-1/2 in the development of 5HT neurons (Simon et al., 2005). Of particular interest was the presence of two consensus GATA binding motifs (Figure 4A, B). Multispecies comparisons of the upstream region revealed these sites were conserved even among distantly related mammals (Figure 4B). As Gata-2 is essential for Pet-1 induction in the hindbrain (Craven et al., 2004), the presence of conserved tandem GATA sites in the FEV promoter region suggested that Gata-2 might directly induce FEV/Pet-1 in serotonergic precursors. Therefore, we focused our next set of studies at testing this idea.
Figure 4
Figure 4
Predicted transcription factor binding sites in the FEV upstream region
We first determined with co-immunostaining that Gata-2 was expressed in βgal+ cells of the rostral hindbrain in FEV2.2Z transgenic embryos (Figure 5A). We then asked whether the consensus sites could bind GATA protein in vitro. Gata-1, Gata-2, and Gata-3 all recognize a consensus site, WGATAR (Ko and Engel, 1993), and both sites in the FEV upstream region perfectly match this sequence (Figure 4B). We tested the ability of purified recombinant Gata-1 protein to bind either the FEV-distal (GATA1) or proximal (GATA2) sites (Figure 4) using electrophoretic mobility shift assays (EMSAs). Recombinant Gata-1 protein formed a single complex with duplex oligonucleotides carrying either GATA site (Figure 5B), thus demonstrating that these are indeed bona fide in vitro GATA binding sites. To test whether these sites are also recognized by Gata-2, we carried out EMSAs with HeLa cell nuclear extracts, as these cells express endogenous Gata-2, but not other GATA factors (Dorfman et al., 1992; Zon et al., 1993; Siltanen et al., 1999; Ho et al., 2005). Oligonucleotides containing the distal conserved GATA site, GATA1 formed two complexes when incubated with HeLa nuclear extracts (arrow and arrowhead in Figure 5C, lanes 2 and 5). These complexes were competed away with an excess of the unlabeled GATA1 site but not an equimolar mass of an oligonucleotide in which the GATA site had been altered (Figure 5C, lanes 3 and 4, respectively). When the proximal GATA site, GATA2, was used as a competitor, wildtype but not mutant oligonucleotides specifically competed the upper complex formed with GATA1 oligonucleotides (Figure 5C, lanes 6 and 7). GATA2 oligonucleotides formed similar complexes with HeLa extract that were competed with wildtype but not mutated GATA1 oligonucleotides (data not shown). These cross-competition experiments demonstrate that common proteins bind specifically to the “GATA” motif found in both oligonucleotide sequences. Finally, the addition of anti-Gata-2 antibody, but not an equal amount of anti-GFP antibody, disrupted the upper complex, indicating that Gata-2 is indeed present in that complex (Figure 5D). Taken together, these results suggest that both sequences are functional in vitro binding sites for Gata-2.
Figure 5
Figure 5
In vitro and in vivo analysis of GATA sites in FEV/Pet-1 upstream region
Gata-2 directly interacts with the Pet-1 cis regulatory region
We next used chromatin immunoprecipitation (ChIP) to determine whether Gata-2 occupies the homologous Pet-1 cis regulatory region in vivo. To our knowledge there is no neuronal cell line that expresses high levels of Pet-1 or FEV together with Gata-2. Therefore, we developed a ChIP assay with E11.5 mouse hindbrain as a source of serotonergic chromatin. Chromatin was immunoprecipitated with an anti-Gata-2 antibody, and the immunoprecipitate was assessed by quantitative PCR. We tested for Gata-2 interaction with the Pet-1 upstream region, as well as sequences located in upstream genes, Cryba2 and Ccdc108, where consensus GATA motifs are located. Anti-Gata-2 antibody immunoprecipitation of sequences associated with the Cryba2 GATA site was slightly increased over background levels measured with the Untr17 control but not with the Untr8 control. No enrichment of Ccdc108 sequences was detected when compared to either of these controls (Figure 5E). In contrast, binding of Gata-2 to the Pet-1 upstream region was highly significantly enriched (p<0.001) compared to both negative control regions and to the Cryba2 or Ccdc108 regions (Figure 5E). These findings show that in the developing hindbrain Gata-2 directly binds to the FEV/Pet-1 upstream cis-regulatory region.
Conserved GATA binding sites in the FEV cis-regulatory region are required for serotonergic transgene expression
Having shown that conserved GATA binding sites are present in the FEV promoter region and that Gata-2 directly interacts with the homologous Pet-1 cis regulatory region, we next investigated the function of the GATA sites in vivo. Site-directed mutagenesis was carried out to destroy these GATA binding sites in FEV2.2Z, either singly (Gata1mut2.2Z or Gata2mut2.2Z) or in combination (Gata1,2mut2.2Z) (Figure 1). Mutation of either GATA site alone resulted in little change in the transgene expression in 5HT neurons (compare 6C, D with 6A) or reproducibility of expression; however, we did observe an increase in ectopic expression as compared to FEV2.2Z or FEV2.2ZΔβg (data not shown). In contrast, nucleotide changes to both GATA sites (Gata1,2mut2.2Z, Figure 1), led to a complete loss of ventral hindbrain expression in 16 of 27 founders. The remaining eleven founders showed very weak expression in rostral 5HT neurons (Figure 6E, G), which was often accompanied by weak to strong ectopic expression. Little or no staining was observed in more median or caudal 5HT neurons (Figure 6F, compare to 6B). Furthermore, robust staining, comparable to FEV2.2Z (Figure 2A, ,6A),6A), was never observed with Gata1,2mut2.2Z. Thus, mutation of both GATA sites greatly compromised the ability of the 2.2 kb fragment to direct expression to 5HT neurons, as evidenced both by the large numbers of founders showing no hindbrain expression and the dramatically reduced serotonergic expression in remaining founders.
Figure 6
Figure 6
GATA sites are functionally required for FEV transgene expression
FEV-directed transgene expression and fate of mutant 5HT neuron precursors in Pet-1−/− brain
We showed previously that a LacZ reporter controlled by the mouse Pet-1 upstream enhancer was weakly expressed in the Pet-1−/− brain compared to its expression in wildtype mice (Scott et al., 2005). To determine whether FEV-directed transgene expression was also dependent on endogenous Pet-1 function we crossed the FEV2.2Z transgene into the Pet-1−/− background. The number of βgal+ cells in the embryonic brain of FEV2.2Z, Pet-1−/− mice was somewhat diminished compared to their numbers in Pet-1+/− background (Figure 7A versus B), but FEV2.2Z continued to be expressed in 5HT+ cells (Figure 7A', B'). However, FEV2.2Z expression was greatly diminished in adult Pet-1−/− mice (Figure 7C versus D). When costained for TPH and βgal, only a few co-labeled cells were detected (Figure 7E, arrowheads). These findings show that maintenance of FEV2.2Z expression depends on endogenous Pet-1.
Figure 7
Figure 7
FEV-directed transgenes mark Pet-1−/− cells in the adult brain
To determine whether a longer upstream fragment was less sensitive to loss of Pet-1 we made a new reporter, FEV60Z, with a 60 kb upstream FEV fragment. Two independent FEV60Z transgenic lines were crossed into the Pet-1−/− background. In wildtype mice, we observed strong FEV60Z expression in the embryonic hindbrain at E12.5 (Figure 7F and data not shown) and in adult DRN (Figure 7G and data not shown). In contrast to FEV2.2Z and the mouse Pet-1 enhancer-directed LacZ (Scott et al., 2005), the number of LacZ+ cells in the DRN was similar in FEV60Z, Pet-1−/− and FEV60Z, Pet-1+/− mice at both embryonic (Figure 7F versus H) and adult (Figure 7G versus I) stages. Indeed, cell counts of adult B7 DRN from Pet-1+/− and Pet-1−/− animals (n=3 for each genotype, two sections per animal) revealed no differences between groups (means were 380 and 378 cells for Pet-1+/− and Pet-1−/− sections, respectively, t-test p=0.98).
In FEV60Z, Pet-1+/− mice all TPH+ cells were βgal+ and the majority of βgal+ cells were TPH+ (Figure 7J). However, in FEV60Z, Pet-1−/− mice, while all remaining TPH+ neurons in the B7 DRN expressed the transgene, a substantial number of βgal+ cells were TPH (Figure 7K). In medullary raphe, FEV60Z was expressed in Pet-1−/− mice but not always in the remaining TPH+ cells (Figure 7L and data not shown). Thus, FEV60Z does not require Pet-1 to maintain its B7 expression, but may be dependent on Pet-1 function in medullary 5HT neurons.
The comparable expression of FEV60Z in Pet-1+/− and Pet-1−/− B7 DRN suggested it could be used a novel fate marker of Pet-1−/− 5HT neuron precursors. We reported previously (Hendricks et al., 2003) and confirmed here with FEV60Z (Figure 7H, I, K) that normal numbers of B7 and B8 serotonergic precursors are generated in Pet-1−/− mice but only about 30% of them can be detected in the adult brain with serotonergic markers. These observations suggested that cell death, misfating, or mismigration might account for the failure to detect these cells in adults. However, the similar numbers of βgal+ cells in the adult B7 DRN of FEV60Z, Pet-1+/− and FEV60Z, Pet-1−/− mice indicated that these cells are not eliminated by a cell death program but may remain in an arrested precursor stage. The continued activity of FEV60Z is consistent with the maintenance of serotonergic character despite the lack of TPH expression in these cells (Figure 7K). Further studies showed that all FEV60Z+ DRN cells co-expressed NeuN (Figure 8A), a general neuronal marker. The expression of Gata-3, which marks several distinct neuronal populations in the brain including postmitotic 5HT neuron precursors (Pattyn et al., 2004; Zhao et al., 2008), was also present in βgal+ cells (Figure 8B, B') further supporting a serotonergic character of FEV60Z+ cells in the Pet-1−/− brain. Importantly, these cells did not coexpress markers of nearby neuronal cell types, such as tyrosine hydroxylase (TH) (Figure 8C), a marker of dopaminergic neurons, or choline acetyltransferase (ChAT) (Figure 8D), expressed by motor neurons.
The marking of mutant 5HT neuron precursors with the FEV60Z transgene also provided a means to visualize the organization of these cells in the adult B7 DRN. Interestingly, analysis of serial sections through the entire anterior-posterior length of the B7 DRN suggested an aberrant distribution of βgal+ cell bodies. The stereotypical “fountain” shape distribution of serotonergic cell bodies in the DRN was never observed in Pet-1 deficient mice and βgal+ cells in the nucleus appeared laterally extended (Figure 7G versus 7I). Lateralization of the DRN in the Pet-1−/− brain was quantified by counting βgal+ cells in two pairs of regions on each side of the midline (Figure 8E, boxed areas). Significantly more βgal+ cells were located further from the midline in Pet-1−/− animals (Figure 8F) than in controls. This lateralization appeared to be limited to DRN, as median and caudal βgal+ cells were appropriately positioned. These findings suggest that Pet-1 may also be required for the precise migration of 5HT neurons to their proper locations in the DRN.
Our study of human FEV cis-regulatory control in mouse 5HT neurons has led to three major findings. First, we show that a conserved region extending only 275 bp upstream of FEV is sufficient to direct transgene expression to 5HT neuron precursors while sequences further upstream are likely required for maintenance of transcription in adult 5HT neurons. Second, serotonergic expression of FEV/Pet-1 depends on direct interactions with the zinc finger factor, Gata-2. Third, FEV transgenes mark serotonergic precursors in the adult brain and show that mutant cells remain in the Pet-1-deficient B7 DRN but their organization is disrupted. Thus, our findings provide new insights into the mechanisms that regulate FEV/Pet-1 in the ventral hindbrain and their roles in 5HT neuron development.
Transcriptional control of FEV/Pet-1 in 5HT neurons
Our data suggest that several regulatory subregions are responsible for different spatial and temporal domains of FEV transcription in 5HT neurons. A proximal subregion surrounding the FEV transcriptional start site was sufficient for 5HT neuron specific expression of FEV transgenes in the rostral and the anterior half of the caudal hindbrain. The FEV promoter likely comprises sequences in the proximal subregion, as deletion of this region completely abolished transgene expression in developing 5HT neurons. The proximal subregion, however, was not able to direct transgene expression to the posterior half of the caudal hindbrain. Nor was it able to efficiently direct transgene expression to adult 5HT neurons. Additional findings suggest that a separate regulatory module directs FEV transcription to the posterior hindbrain and another one functions to maintain FEV transcription. First, FEV2.2Z and smaller transgenes were unable to fully recapitulate the expression patterns of endogenous Pet-1 in the caudal hindbrain. However, FEV60Z was expressed in 5HT neurons along the entire length of the caudal domain (data not shown), which suggests a spatial regulatory module resides further upstream of the immediate 2.2 kb 5′ flanking region. Second, FEV2.2Z but not FEV0.6Z was strongly expressed in adult 5HT neurons. Therefore, the temporal module that functions to maintain FEV transcription in the adult dorsal and median raphe is likely to be located in or near the distal block of conserved sequences. These findings suggest that FEV/Pet-1 expression along the rostrocaudal axis of the developing hindbrain and in the adult brain may be controlled by heterogeneous cis-regulatory elements, each responsible for different spatial and temporal domains of FEV transcription.
Direct Gata-2 regulation of FEV/Pet-1
Prior to this study it was not clear which, if any, of the transcription factors implicated in the serotonergic regulatory cascade are direct activators of Pet-1 or FEV. Previous experiments placed Gata-2 genetically upstream of Pet-1 at all rostrocaudal levels of the developing hindbrain: Pet-1 expression and all 5HT neurons are lost in Gata-2 knockouts, while misexpression of Gata-2 in chick r1 induces Pet-1 and ectopic 5HT neurons (Craven et al., 2004). Our own studies expand upon these findings to support direct Gata-2-FEV/Pet-1 interactions. First, we identify two conserved GATA binding sites (Figures (Figures44 and and5)5) in the FEV promoter region that are recognized in vitro by GATA factors and, in particular, Gata-2. Second, a ChIP assay carried out on mouse embryonic hindbrain shows that Gata-2 protein directly interacts with the Pet-1 cis-regulatory region. Third, a transgene lacking both GATA sites (Gata1,2mut2.2Z) showed weak or undetectable expression in developing 5HT neurons but increased transgene expression in non-serotonergic cell types. Elimination of each GATA site individually had little effect on transgene expression in 5HT neurons, which suggests the GATA sites are functionally redundant for enhancement of FEV transcription in 5HT neurons. Interestingly, the related factor Gata-3 is not redundant with Gata-2, as the loss of Pet-1 expression occurs despite the continued expression of Gata-3 in Gata-2 knockouts (Craven et al., 2004). Additionally, Pet-1 expression is unchanged in Gata-3 knockout mice, in which a subset of 5HT neurons is lost (Pattyn et al., 2004), suggesting that while Gata-3 plays a role in 5HT neuron development, it is unlikely to do so via direct regulation of Pet-1.
The weak serotonergic expression of Gata1,2mut2.2Z seen in some lines contrasts with the complete absence of transgene expression observed in all lines upon deletion of the proximal sequences that included both GATA sites. Therefore, additional transcription factor interactions are also likely to occur in the conserved promoter region and are probably involved in restricting expression of FEV to 5HT neurons as GATA-2 is expressed in many types of neurons. We suspect that Gata-2 interactions with sites in the FEV promoter region are not likely to be involved in maintenance of expression in the adult brain as Gata-2 expression declines around the time of Pet-1 induction (Nardelli et al., 1999; Zhou et al., 2000), a finding consistent with the lack of FEV0.6Z reporter expression in adult 5HT neurons. Our findings provide insight into the 5HT neuron developmental program by showing that FEV and Pet-1 are direct targets of a conserved Gata-2-dependent regulatory cascade that gives rise to 5HT neurons in the developing rostral and caudal hindbrain.
Fate of mutant 5HT neuron precursors in the Pet-1−/− brain
Our FEV cis regulatory studies have identified a unique marker of Pet-1−/− cells in the B7 DRN, which has led to new insights into Pet-1's role in 5HT neuron development. In adult Pet-1−/− mice some cell bodies are missing in the mutant pons where 5HT neurons normally coalesce to form the B6 DRN (Hendricks et al., 2003). Therefore cell death or misfating may account for the absence of some 5HT neurons in the Pet-1−/− pons. However, the large numbers of FEV60Z+ cells in the Pet-1−/− B7 DRN and B8 MRN suggests that the majority of mutant precursors neither die nor misfate, but rather are maintained in an arrested state of development in which coordinate transcription of TPH2, aromatic amino acid decarboxylase, SERT, and vesicular monoamine transporter 2 is greatly reduced or aborted. In support of this idea, NeuN immunostaining showed that FEV60Z+ mutant precursors retained pan-neuronal character. In addition, they maintained expression of Gata-3, a postmitotic (although not specific) marker of serotonergic precursors. In contrast, nearly all 5HT neuron cell bodies were shown to be absent in adult mice in which Lmx1b was conditionally inactivated in the serotonergic lineage (Zhao et al., 2006). Thus, while Pet-1 and Lmx1b are likely to cooperate in the coordinate transcriptional control of serotonergic gene expression and 5HT synthesis (Cheng et al., 2003), Lmx1b appears to function independently from Pet-1 in the survival of 5HT neurons. It is unknown whether mutant 5HT neuron precursors in the adult Pet-1−/− B7 DRN retain physiologic functions such as release of neuropeptides. Additional studies facilitated by the genetic marking of these cells with FEV60Z will likely resolve this issue.
An unexpected finding of the FEV60Z studies was the altered distribution of cells in the Pet-1−/− DRN. These findings suggest that Pet-1 function may be required for precise migration patterns of 5HT neurons. The migration of 5HT precursors is also deficient in Lmx1b−/− mice (Ding et al., 2003), suggesting Pet-1 and Lmx1b may coordinately regulate migration, perhaps through regulation of 5HT synthesis. 5HT can modulate the in vitro migration of neural crest cells (Moiseiwitsch and Lauder, 1995) and is attractive for mast cells in vitro and in vivo (Kushnir-Sukhov et al., 2006). In both cell types, signaling through the Htr1a receptor was implicated. Htr1a expression is already enriched in newly differentiated 5HT neurons as they begin to migrate (C.J. Wylie and E.S. Deneris, unpublished observations). This raises the possibility that release of 5HT from embryonic 5HT neurons provides an autoregulatory signal that helps direct migration of 5HT precursors to their mature positions. It remains to be determined what might be the functional consequence of serotonergic cell body disorganization in the DRN and whether this defect contributes to the behavioral and physiological alterations present in Pet-1 deficient mice.
Transcriptional control of FEV and neuropsychiatric disease
Defects in the transcriptional control of 5HT neuron gene expression lead to effects on adult emotional behavior (Hendricks et al., 2003), neonatal respiration (Erickson et al., 2007), thermoregulation (Hodges et al., 2008), inflammatory pain (Zhao et al., 2007), and reproductive success (Lerch-Haner et al., 2008). Furthermore, genetic variants that alter TPH2 and SERT expression have been associated with psychiatric disease (Leonardo and Hen, 2006; Murphy and Lesch, 2008). These findings raise the possibility that genetic alterations impacting serotonergic transcriptional control may predispose individuals to abnormal behavior or physiology (Albert and Lemonde, 2004). The ability of FEV to regulate TPH2 and SERT (Lerch-Haner et al., 2008) suggests the regulatory mechanisms governing FEV expression may be relevant to disease pathogenesis. Our studies provide a functional map of FEV cis-regulatory elements, which will facilitate the identification and analysis of possible FEV cis-regulatory variants and their roles as potential disease susceptibility factors. Indeed, the NCBI dbSNP database (Sherry et al., 2001) lists a possible regulatory variant (rs57981340) within the FEV promoter region we have defined here and our sequencing has verified the existence of this SNP (K.C. Krueger, R.L. Findling and E.S. Deneris, unpublished data).
Supplementary Material
Table 1
Acknowledgements
We thank the Case Transgenic and Targeting Facility for generation of transgenic lines. We also thank Kathy Lobur and RoxAnne Murphy for outstanding assistance with propagation, maintenance, and genotyping of Pet-1−/− lines. Supported by NIH MH62723 and P50 MH078028.
  • Albert PR, Lemonde S. 5-HT1A receptors, gene repression, and depression: guilt by association. Neuroscientist. 2004;10:575–593. [PubMed]
  • Alexiadis V, Ballestas ME, Sanchez C, Winokur S, Vedanarayanan V, Warren M, Ehrlich M. RNAPol-ChIP analysis of transcription from FSHD-linked tandem repeats and satellite DNA. Biochim Biophys Acta. 2007;1769:29–40. [PMC free article] [PubMed]
  • Ansorge MS, Hen R, Gingrich JA. Neurodevelopmental origins of depressive disorders. Curr Opin Pharmacol. 2007;7:8–17. [PubMed]
  • Beaulieu JM, Zhang X, Rodriguiz RM, Sotnikova TD, Cools MJ, Wetsel WC, Gainetdinov RR, Caron MG. Role of GSK3 beta in behavioral abnormalities induced by serotonin deficiency. Proc Natl Acad Sci U S A. 2008;105:1333–1338. [PubMed]
  • Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M, Bayerlein M, Werner T. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics. 2005;21:2933–2942. [PubMed]
  • Cheng L, Chen CL, Luo P, Tan M, Qiu M, Johnson R, Ma Q. Lmx1b, Pet-1, and Nkx2.2 coordinately specify serotonergic neurotransmitter phenotype. J Neurosci. 2003;23:9961–9967. [PubMed]
  • Craven SE, Lim KC, Ye W, Engel JD, De Sauvage F, Rosenthal A. Gata2 specifies serotonergic neurons downstream of sonic hedgehog. Development. 2004;131:1165–1173. [PubMed]
  • Ding YQ, Marklund U, Yuan W, Yin J, Wegman L, Ericson J, Deneris E, Johnson RL, Chen ZF. Lmx1b is essential for the development of serotonergic neurons. Nat Neurosci. 2003;6:933–938. [PubMed]
  • Dorfman DM, Wilson DB, Bruns GA, Orkin SH. Human transcription factor GATA-2. Evidence for regulation of preproendothelin-1 gene expression in endothelial cells. J Biol Chem. 1992;267:1279–1285. [PubMed]
  • Erickson JT, Shafer G, Rossetti MD, Wilson CG, Deneris ES. Arrest of 5HT neuron differentiation delays respiratory maturation and impairs neonatal homeostatic responses to environmental challenges. Respir Physiol Neurobiol. 2007;159:85–101. [PMC free article] [PubMed]
  • Frengen E, Weichenhan D, Zhao B, Osoegawa K, van Geel M, de Jong PJ. A modular, positive selection bacterial artificial chromosome vector with multiple cloning sites. Genomics. 1999;58:250–253. [PubMed]
  • Helms AW, Abney AL, Ben-Arie N, Zoghbi HY, Johnson JE. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 2000;127:1185–1196. [PubMed]
  • Hendricks T, Francis N, Fyodorov D, Deneris E. The ETS Domain Factor Pet-1 is an Early and Precise Marker of Central 5-HT Neurons and Interacts with a Conserved Element in Serotonergic Genes. J Neurosci. 1999;19:10348–10356. [PubMed]
  • Hendricks TJ, Fyodorov DV, Wegman LJ, Lelutiu NB, Pehek EA, Yamamoto B, Silver J, Weeber EJ, Sweatt JD, Deneris ES. Pet-1 ETS gene plays a critical role in 5-HT neuron development and is required for normal anxiety-like and aggressive behavior. Neuron. 2003;37:233–247. [PubMed]
  • Ho CK, Wood JR, Stewart DR, Ewens K, Ankener W, Wickenheisser J, Nelson-Degrave V, Zhang Z, Legro RS, Dunaif A, McAllister JM, Spielman R, Strauss JF., 3rd Increased transcription and increased messenger ribonucleic acid (mRNA) stability contribute to increased GATA6 mRNA abundance in polycystic ovary syndrome theca cells. J Clin Endocrinol Metab. 2005;90:6596–6602. [PubMed]
  • Hodges MR, Tattersall GJ, Harris MB, McEvoy SD, Richerson DN, Deneris ES, Johnson RL, Chen ZF, Richerson GB. Defects in breathing and thermoregulation in mice with near-complete absence of central serotonin neurons. J Neurosci. 2008;28:2495–2505. [PubMed]
  • Iyo AH, Porter B, Deneris ES, Austin MC. Regional distribution and cellular localization of the ETS-domain transcription factor, FEV, mRNA in the human postmortem brain. Synapse. 2005;57:223–228. [PMC free article] [PubMed]
  • Jacob J, Ferri AL, Milton C, Prin F, Pla P, Lin W, Gavalas A, Ang SL, Briscoe J. Transcriptional repression coordinates the temporal switch from motor to serotonergic neurogenesis. Nat Neurosci. 2007;10:1433–1439. [PubMed]
  • Ko LJ, Engel JD. DNA-binding specificities of the GATA transcription factor family. Mol Cell Biol. 1993;13:4011–4022. [PMC free article] [PubMed]
  • Kobayashi-Osaki M, Ohneda O, Suzuki N, Minegishi N, Yokomizo T, Takahashi S, Lim KC, Engel JD, Yamamoto M. GATA motifs regulate early hematopoietic lineage-specific expression of the Gata2 gene. Mol Cell Biol. 2005;25:7005–7020. [PMC free article] [PubMed]
  • Kushnir-Sukhov NM, Gilfillan AM, Coleman JW, Brown JM, Bruening S, Toth M, Metcalfe DD. 5-hydroxytryptamine induces mast cell adhesion and migration. J Immunol. 2006;177:6422–6432. [PubMed]
  • Lemonde S, Turecki G, Bakish D, Du L, Hrdina PD, Bown CD, Sequeira A, Kushwaha N, Morris SJ, Basak A, Ou XM, Albert PR. Impaired repression at a 5-hydroxytryptamine 1A receptor gene polymorphism associated with major depression and suicide. J Neurosci. 2003;23:8788–8799. [PubMed]
  • Leonardo ED, Hen R. Genetics of Affective and Anxiety Disorders. Annu Rev Psychol. 2006:117–137. [PubMed]
  • Lerch-Haner JK, Frierson D, Crawford LK, Beck SG, Deneris ES. Serotonergic transcriptional programming determines maternal behavior and offspring survival. Nat Neurosci. 2008;11:1001–1003. [PMC free article] [PubMed]
  • Lidov HG, Molliver ME. An immunohistochemical study of serotonin neuron development in the rat: ascending pathways and terminal fields. Brain Res Bull. 1982;8:389–430. [PubMed]
  • Loots GG, Ovcharenko I. rVISTA 2.0: evolutionary analysis of transcription factor binding sites. Nucleic Acids Res. 2004;32:W217–221. [PMC free article] [PubMed]
  • Moiseiwitsch JR, Lauder JM. Serotonin regulates mouse cranial neural crest migration. Proc Natl Acad Sci U S A. 1995;92:7182–7186. [PubMed]
  • Murphy DL, Lesch KP. Targeting the murine serotonin transporter: insights into human neurobiology. Nat Rev Neurosci. 2008;9:85–96. [PubMed]
  • Nardelli J, Thiesson D, Fujiwara Y, Tsai FY, Orkin SH. Expression and genetic interaction of transcription factors GATA-2 and GATA-3 during development of the mouse central nervous system. Dev Biol. 1999;210:305–321. [PubMed]
  • Ovcharenko I, Nobrega MA, Loots GG, Stubbs L. ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res. 2004;32:W280–286. [PMC free article] [PubMed]
  • Pattyn A, Simplicio N, Van Doorninck JH, Goridis C, Guillemot F, Brunet JF. Ascl1/Mash1 is required for the development of central serotonergic neurons. Nat Neurosci. 2004;7:589–595. [PubMed]
  • Pattyn A, Vallstedt A, Dias JM, Samad OA, Krumlauf R, Rijli FM, Brunet JF, Ericson J. Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from a common pool of CNS progenitors. Genes Dev. 2003;17:729–737. [PubMed]
  • Pfaar H, von Holst A, Vogt Weisenhorn DM, Brodski C, Guimera J, Wurst W. mPet-1, a mouse ETS-domain transcription factor, is expressed in central serotonergic neurons. Dev Genes Evol. 2002;212:43–46. [PubMed]
  • Rand CM, Berry-Kravis EM, Zhou L, Fan W, Weese-Mayer DE. Sudden infant death syndrome: rare mutation in the serotonin system FEV gene. Pediatr Res. 2007;62:180–182. [PubMed]
  • Scott MM, Krueger KC, Deneris ES. A differentially autoregulated Pet-1 enhancer region is a critical target of the transcriptional cascade that governs serotonin neuron development. J Neurosci. 2005;25:2628–2636. [PubMed]
  • Sherry ST, Ward MH, Kholodov M, Baker J, Phan L, Smigielski EM, Sirotkin K. dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 2001;29:308–311. [PMC free article] [PubMed]
  • Siltanen S, Anttonen M, Heikkila P, Narita N, Laitinen M, Ritvos O, Wilson DB, Heikinheimo M. Transcription factor GATA-4 is expressed in pediatric yolk sac tumors. Am J Pathol. 1999;155:1823–1829. [PubMed]
  • Simon HH, Scholz C, O'Leary DD. Engrailed genes control developmental fate of serotonergic and noradrenergic neurons in mid- and hindbrain in a gene dose-dependent manner. Mol Cell Neurosci. 2005;28:96–105. [PubMed]
  • Steinbusch HWM. Distribution of serotonin-immunoreactivity in the central nervous system of the rat-cell bodies and terminals. Neuroscience. 1981;6:557–618. [PubMed]
  • Wallace JA, Lauder JM. Development of the serotonergic system in the rat embryo: an immunocytochemical study. Brain Res Bull. 1983;10:459–479. [PubMed]
  • Yee SP, Rigby PW. The regulation of myogenin gene expression during the embryonic development of the mouse. Genes Dev. 1993;7:1277–1289. [PubMed]
  • Zhao GY, Li ZY, Zou HL, Hu ZL, Song NN, Zheng MH, Su CJ, Ding YQ. Expression of the transcription factor GATA3 in the postnatal mouse central nervous system. Neurosci Res. 2008;61:420–428. [PubMed]
  • Zhao ZQ, Scott M, Chiechio S, Wang JS, Renner KJ, Gereau RWt, Johnson RL, Deneris ES, Chen ZF. Lmx1b is required for maintenance of central serotonergic neurons and mice lacking central serotonergic system exhibit normal locomotor activity. J Neurosci. 2006;26:12781–12788. [PubMed]
  • Zhao ZQ, Chiechio S, Sun YG, Zhang KH, Zhao CS, Scott M, Johnson RL, Deneris ES, Renner KJ, Gereau RWt, Chen ZF. Mice lacking central serotonergic neurons show enhanced inflammatory pain and an impaired analgesic response to antidepressant drugs. J Neurosci. 2007;27:6045–6053. [PubMed]
  • Zhou Y, Yamamoto M, Engel JD. GATA2 is required for the generation of V2 interneurons. Development. 2000;127:3829–3838. [PubMed]
  • Zon LI, Yamaguchi Y, Yee K, Albee EA, Kimura A, Bennett JC, Orkin SH, Ackerman SJ. Expression of mRNA for the GATA-binding proteins in human eosinophils and basophils: potential role in gene transcription. Blood. 1993;81:3234–3241. [PubMed]