PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
FEMS Immunol Med Microbiol. Author manuscript; available in PMC 2009 November 1.
Published in final edited form as:
PMCID: PMC2593748
NIHMSID: NIHMS76357
Inhibition of Candida albicans Adhesion by Recombinant Human Antibody Single-Chain Variable Fragment Specific for Als3p
Monitoring Editor: Patrik Bavoil, Sonia S. Laforce-Nesbitt,1 Mark A. Sullivan,2 Lois L. Hoyer,3 and Joseph M. Bliss1,4*
1Department of Pediatrics, Women & Infants Hospital of Rhode Island, Warren Alpert Medical School of Brown University, Providence, RI
2Department of Pediatrics, University of Rochester School of Medicine and Dentistry, Rochester, NY
3Department of Pathobiology, University of Illinois at Urbana-Champaign, Urbana, IL
4Graduate Program in Pathobiology, Brown University, Providence, RI
*Corresponding Author - Dept. of Pediatrics, Women & Infants Hospital of Rhode Island, 101 Dudley St., Providence, RI 02905. Telephone (401) 274-1100; Fax (401) 453-7571; email: jbliss/at/wihri.org.
The Candida albicans adhesin, Als3p, was identified as a potential cognate antigen for previously described human antibody fragments (scFv) based on similarity of the binding pattern of the scFv to the distribution of this protein on the hyphal surface. Although all scFv bound avidly to wild-type, scFv3 showed no detectable binding via immunofluorescence assay (IFA) to strain 1843, containing a homozygous deletion of ALS3. Binding to the ALS3 reintegrant strain, 2322, was preserved, and scFv3 also bound to S. cerevisiae expressing ALS3. Other scFv retained binding to 1843, but with a markedly altered pattern. To determine if scFv3 could interfere with Als3p function, adhesion assays were conducted using human epithelial or endothelial cells as target. Treatment of wild-type C. albicans with scFv3 reduced adhesion of the fungus to both cell types to levels comparable to the als3Δ/als3Δ mutant. These experiments confirm that phage display is a viable method to isolate human scFv specific to an antigen implicated in C. albicans virulence, and that the scFv interfere with adhesion to human cells. The altered pattern of immunostaining with other scFv that retain binding to the als3Δ/als3Δ mutant suggest that Als3p may also have a role in structural organization of the C. albicans cell surface.
Keywords: Candida albicans, adhesin, single chain variable fragment, antibody
Candida albicans is a frequent cause of both mucocutaneous and systemic infections (Calderone, 2002). Incidence of invasive candidiasis is increasing among immunocompromised patients with mortality rates ranging from 30-50% despite aggressive antifungal therapy (Benjamin et al., 2006; Viudes et al., 2002). Central to the pathogenesis of this organism is its ability to respond to environmental signals by changing its growth morphology. The hyphal form of C. albicans is important in disease states, and as such has been the subject of much study (Calderone, 2002; San-Blas et al., 2000). Marked changes in gene expression profiles accompany the shift in morphology, and some of these gene products have been implicated in virulence (Kumamoto & Vinces, 2005).
Like any microorganism that is adapted to a human environment, the ability to adhere to host tissues is an important aspect of C. albicans biology. A number of adhesins have been described in this organism including Hwp1 (Staab et al., 1999; Sundstrom et al., 2002), Int1 (Gale et al., 1998), Eap1 (Li et al., 2007), and the Als family (Hoyer, 2001; Hoyer et al., 2008). These proteins bind to a variety of host substrates, enabling persistence of the fungus at sites within the host. Many of these proteins are found on the hypha surface, underscoring the importance of this growth form in the pathogenesis of the organism. The ALS gene family includes 8 genes that share a common structural organization but exhibit allelic variability, different expression levels, and encode proteins with variable adhesive properties (Hoyer, 2001; Hoyer et al., 2008). Maximal expression of ALS3 is associated with formation of germ tubes and hyphae (Hoyer et al., 1998). Als3p enables adherence to both epithelial and endothelial host cells through interaction with the cadherin family of host proteins (Phan et al., 2007). Recent work has established that binding of the cadherin receptor initiates endocytosis of the fungus by the host cell, and this mechanism may be important for the fungus to access structures deeper than the mucosal or endothelial surface en route to invasive disease (Phan et al., 2007). Previously, we reported the use of phage display technology to isolate human-derived single chain variable fragments (scFv) specific to both yeast and hyphal forms of C. albicans (Bliss et al., 2003; Haidaris et al., 2001). The rationale for obtaining such antibody fragments was several-fold. The scFv have potential to be useful as diagnostic reagents in Candida infection, as has been the case with scFv5 and scFv12 which enable distinction between the closely related species C. albicans and C. dubliniensis (Bliss et al., 2003). The scFv have also been useful to explore mechanisms by which such molecules may foster interaction between the fungus and host immune effector cells (Wellington et al., 2003). A third rationale for obtaining these antibody fragments was to investigate elements of the fungal cell surface that may have a role in interaction with the human host, and potentially to interfere with mechanisms that are important for pathogenesis. Here we report the specificity of one scFv, scFv3, to the Candida adhesin, Als3p, and the ability of this antibody fragment to interfere with Als3p-mediated adhesion to human epithelial and endothelial cells.
Organisms and media
Strains used in this study are listed in Table 1. Starter cultures of C. albicans strains for immunofluorescence or adhesion assays were grown 16 h at 37°C with vigorous agitation in YEPD medium (1% yeast extract, 2% peptone, 2% dextrose). Cultures were predominantly (>99%) yeast forms following this incubation. S. cerevisiae strains containing pADH1 (Bailey et al., 1996), or its derivatives that provide constitutive expression of ALS1 or ALS3 (Sheppard et al., 2004) were generously provided by Scott Filler and were grown in yeast nitrogen base broth (Difco) supplemented with 2% glucose and yeast synthetic drop-out medium supplement without uracil (Sigma) at 30°C.
TABLE 1
TABLE 1
Strains used in this study
Expression and purification of scFv and immunofluorescence assays (IFA)
Clones reactive with C. albicans germ tubes were originally isolated by panning against an M13 phage display library (Bliss et al., 2003). These clones were manipulated to remove the M13 gene III fragment, and mature scFv containing the FLAG epitope at the amino terminus and the hexa-histidine tag at the carboxy terminus were prepared as described previously (Haidaris et al., 2001). Purified preparations of mature scFv were prepared by nickel-affinity chromatography. Briefly, E. coli strain TG-1 containing scFv expression plasmid was grown to log phase in Luria broth containing 0.4 M sucrose (Kipriyanov et al., 1997), and scFv expression was induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 6 h at 22°C. Cell pellets were then resuspended in lysis buffer (4 mL g-1 wet weight; 50 mM sodium phosphate pH 8.0, 0.5 M NaCl, 20 mM imidazole, 10 mM β-mercaptoethanol) containing 5 µg mL-1 DNAse, 2 mg mL-1 lysozyme, and protease inhibitor cocktail (Sigma). Cells were incubated 30 min on ice followed by sonication. Lysates were cleared by centrifugation and filtration, then passed over Ni-NTA agarose (Qiagen) per manufacturer's instructions using lysis buffer for washes. Elution was performed in 50 mM sodium phosphate pH 8.0, 0.5 M NaCl, 0.5 M imidazole. Fractions were pooled, dialyzed against 50 mM sodium phosphate pH 6.0, 300 mM NaCl, 2.5 mM DTT, and concentrated by ultrafiltration (Millipore). IFAs were conducted on glass coverslips for C. albicans strains and in suspension for S. cerevisiae strains using scFv as described previously (Bliss et al., 2003).
Cloning and expression of full-length and N-terminal Als3p and detection by Western blotting
Full-length ALS3 (large allele) was amplified by colony PCR from wild-type strain SC5314 using upstream and downstream primers with the following respective sequences: 5′CTGGTACCATTACATGCTACAACAATATACATTG 3′; 5′GTGAGCTCTTAAGCGTAGTCCGGAACGTCGTACGGGTAAATAAATAAGGAT AATAATGTGATC 3′. The upstream primer incorporated a KpnI site, while the downstream primer incorporated a SacI site and a hemagglutinin epitope tag. The predicted 3516 bp PCR fragment was digested with KpnI and SacI and cloned into the corresponding sites of the E. coli expression vector, pTrplEx2 (Clontech Laboratories, Mountain View, CA) under control of the lac promoter. E. coli strain XL-1 Blue containing the construct was grown to log phase at 37°C in Luria broth and protein expression induced with 100 µM IPTG. After 4 hours, cells were pelleted, lysed in Laemmli buffer, and proteins separated by SDS-PAGE. Four µg of an N-terminal Als3p fragment was also included on the SDS-PAGE gels. This fragment was produced in yeast and includes the N-terminal 329 amino acids of Als3p without the 18 amino acid signal peptide. Proteins were transferred to nitrocellulose, and scFv Westerns were performed as described previously (Haidaris et al., 2001). Expression of full length Als3p was confirmed by probing membranes with anti-hemagglutinin antibody conjugated to peroxidase (Roche) and detecting by chemiluminescence (Amersham).
Adhesion assays
A fluorescence-based assay was developed to quantify adhesion of C. albicans strains to human cells. The FaDu pharyngeal carcinoma epithelial cell line was obtained from the American Type Culture Collection (ATCC). FaDu cells were maintained in Eagle's Minimum Essential Medium containing 10% fetal bovine serum, non-essential amino acids, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1500 mg L-1 sodium bicarbonte (ATCC). Primary human umbilical vein endothelial cells (HUVEC), pooled from 3-5 individuals, were obtained from Clonetics/Lonza Biosciences (Visp, Switzerland) and cultured in EGM-2 medium according to the manufacturer's recommendations. The human cells were grown to confluency in a tissue-culture treated 96-well dish (Corning). Overnight cultures of C. albicans strains were washed with Dulbecco's PBS and induced to form germ tubes by incubation at 6 × 106 cells mL-1 in RPMI (HyClone) at 37°C for 60 min. Cultures were examined by light microscopy to confirm uniform germ tube growth. C. albicans cells (6 × 105 cells well-1) were then added to the human cell monolayer in the presence of either scFv (5 µg well-1) or dialysis buffer. In selected assays, 4 µg of the purified N-terminal Als3p fragment was included with scFv. After a 30 min incubation at 37°C in 5% CO2, media was replaced with 50 µL calcofluor white (25 µM in Dulbecco's PBS, Sigma cat # F3543) and incubated for 10 min in the dark. Wells were gently washed three times with Dulbecco's PBS and fluorescence, proportional to fungal cell mass remaining in each well, was quantified on a fluorescence plate reader with excitation and emission wavelengths of 380 nm and 440 nm respectively. Minimal background fluorescence from wells not containing C. albicans was subtracted, and mean fluorescence was calculated from a minimum of 3 replicate wells for each condition. Data were normalized to wild-type mean fluorescence in each experiment.
Statistical analysis
Individual experiments were performed in triplicate at minimum and were repeated at least four times. Comparisons of C. albicans adhesion in the presence or absence of scFv were made by one-way analysis of variance (ANOVA). Between-group comparisons were made by the Newman-Keuls test with P values < 0.05 considered significant.
Specificity of scFv3 for Als3p
We have previously reported that several scFv bind to C. albicans hyphae in a uniform manner throughout the hypha structure (Bliss et al., 2003). All three scFv used in this study (scFv3, scFv5, and scFv12) bind to wild-type C. albicans with an identical pattern, and the binding of scFv3 is depicted in Fig. 1A. Based on differential binding of scFv5 and scFv12 to the closely related species, C. dubliniensis (Bliss et al., 2003), these two scFv likely recognize antigens that are distinct from each other, although the identity of the antigens recognized is not yet defined. The pattern of scFv binding to C. albicans germ tubes is similar to the pattern of Als3p distribution along the germ tube surface (Zhao et al., 2006). To test whether any of the scFv were specific for this antigen, indirect immunofluorescence assays (IFAs) were performed using strain 1843 (Zhao et al., 2004), containing a homozygous deletion of ALS3 (Fig. 1). Bright fluorescence was observed in IFAs with strain 1843 when using scFv5 (Fig. 1D) or scFv12 (identical pattern, data not shown), although the pattern of binding differed from wild-type (identical to the pattern depicted in Fig. 1A) (Bliss et al., 2003). Rather than binding to the germ tube with uniform intensity throughout the germ tube length, and with no detectable binding to the mother yeast, immunostaining of the mother yeast was seen with scFv5 or scFv12. Further, the intensity of staining was no longer uniform, with varied intensity from cell to cell and at different points within the same germ tube. In contrast, scFv3 showed no detectable fluorescence with 1843 (Fig. 1B). Strain 2322, the als3Δ/ als3Δ strain containing a reintegrated copy of ALS3, was recognized by scFv3 (Fig. 1C) with fluorescence equivalent to the wild-type strain, SC5314 (Fig. 1A). The wild-type binding pattern of scFv5 and scFv12 was also restored with the ALS3 reintegrant strain (data not shown). To confirm that scFv3 was specific for Als3p, and not to another target whose production or localization may have been altered by deletion of ALS3, IFAs were conducted with S. cerevisiae carrying plasmids providing constitutive expression of either C. albicans ALS1 or ALS3 genes (Sheppard et al., 2004). Bright fluorescence was seen with S. cerevisiae expressing ALS3 (Fig. 1E), while no fluorescence was detected with S. cerevisiae expressing ALS1 or containing the parent vector alone, pADH1 (data not shown). These findings confirmed that Als3p was the cognate antigen for scFv3, and that based on the altered distribution of binding for scFv5 and scFv12, Als3p may have a role in the organization of other proteins within the cell wall.
FIG. 1
FIG. 1
Immunofluorescence assays (IFA) using scFv and C. albicans or S. cerevisiae strains. The ability of scFv to bind to C. albicans strains of varied genotype and S. cerevisiae expressing ALS3 was tested by IFA. Binding of scFv3 to wild-type strain SC5314 (more ...)
Als3p is comprised of 3 domains: an N-terminal domain that is exposed at the cell surface and believed to confer adhesive properties, a central domain of tandem repeat elements, and a C-terminal domain with signals to direct localization to the cell wall (Hoyer et al., 2008). To determine if scFv3 recognized Als3p outside the context of the cell surface, Western blots were conducted using recombinant N-terminal domain of Als3p (329 aa) as well as full-length recombinant Als3p. In both cases, we were unable to detect binding of scFv3 to Als3p (Fig. 2). A hemagglutinin tag at the C-terminus of the full-length Als3p allowed Western blot confirmation of protein production (Fig. 2).
FIG. 2
FIG. 2
Western analysis of recombinant Als3p. Full-length Als3p was produced in E. coli with a hemagglutinin (HA) epitope tag. Anti-HA antibody detected protein in the E. coli lysate (Lane 1). This protein was not detected by scFv3 immunostaining (Lane 2) nor (more ...)
The nucleotide and deduced amino acid sequences of the VL and VH regions of scFv3 were determined. The deduced amino acid sequence for scFv3 is compared to the previously published sequences of scFv5 and scFv12 in Fig. 3. The scFv3 VL region was of the kappa family, while the VH region belonged to the VH3 family. Substantial sequence differences were observed in the complementarity-determining regions (CDR), consistent with the finding that scFv5 and scFv12 recognize antigens distinct from Als3p.
FIG. 3
FIG. 3
Comparison of the deduced amino acid sequence of scFv3 to scFv5 and scFv12 (Bliss et al., 2003). The cloning strategy yields a VL-linker-VH orientation of the scFv. The framework (FR) and complementarity-determining regions (CDR) (Kabat et al., 1991) (more ...)
Effect of scFv3 on adhesion of C. albicans to human cells
Because Als3p is known to function as an adhesin to both epithelial and endothelial cells, the ability of scFv3 to interfere with adhesion was investigated. Adhesion assays were conducted on human cell monolayers. The human pharyngeal carcinoma cell line, FaDu, was used as a source of epithelial cells, and human umbilical vein endothelial cells (HUVEC) were used for endothelium. Adhesion of the als3Δ/ als3Δ strain (1843) to epithelial cells was reduced to 22% of wild-type (Fig. 4A, p < 0.001) while adhesion to endothelial cells was reduced to 44% of wild-type (Fig. 4B, p < 0.001). Treatment of wild-type C. albicans (SC5314) with scFv3 reduced adhesion of this strain to epithelial cells to levels equivalent to the als3Δ/ als3Δ strain (Fig. 4A, p = 0.8). Although treatment of wild-type C. albicans with scFv3 also reduced adhesion to endothelial cells, adhesion remained somewhat higher than the als3Δ/ als3Δ strain (Fig. 4B, p < 0.001 vs. wild-type; p = 0.01 vs. als3Δ/ als3Δ). Treatment of wild-type C. albicans with an irrelevant scFv, scFv1, had no effect on adhesion. To determine the extent to which inhibition of adhesion was specific to scFv3 binding to Als3p, wild-type C. albicans was also treated with scFv5 and scFv12 which recognize hypha-specific antigens that are yet to be defined. Treatment of wild-type C. albicans with scFv12 had no effect on adhesion to either epithelial or endothelial cells, while treatment with scFv5 reduced adhesion to both cell types. This reduction was equivalent to scFv3 for endothelial cells (Fig 4B), but intermediate for epithelial cells (Fig. 4A, p = 0.002 vs. wild-type; p = 0.04 vs. scFv3). Finally, treatment of the als3Δ/ als3Δ strain with scFv3 resulted in no further reduction in adhesion to either cell type (p = 0.6 for epithelial cells, p = 0.3 for endothelial cells), supporting the notion that binding of Als3p is indeed responsible for the adhesion defect in wild-type cells. Consistent with the inability to detect the purified recombinant N-terminal Als3p by immunoblotting, inclusion of this protein with scFv3 in adhesion assays did not reduce the capacity of scFv3 to interfere with wild-type adhesion to human cells (data not shown). However, the ability of scFv3 to interfere with adhesion to human cells in a manner similar to that seen with deletion of the Als3p supports the notion that scFv3 is specific to Als3p.
FIG. 4
FIG. 4
Adhesion of C. albicans to human cells and the effect of scFv treatment. Strains SC5314 (wild-type; WT) and 1843 (als3Δ/als3Δ) were induced to form germ tubes and incubated with human epithelial cells (FaDu, Panel A) or endothelial cells (more ...)
Several lines of evidence support the conclusion that scFv3 is specific for Als3p. Similar to the cellular distribution described for Als3p (Zhao et al., 2006), this antibody fragment recognizes a protein that is surface-exposed and binds uniformly throughout the hypha length. While we could detect binding of other hypha-specific scFv (scFv5 and scFv12), binding of scFv3 was not detected to the als3Δ/ als3Δ strain, 1843, while binding was restored to strain 2322 in which ALS3 is reintegrated. Binding of scFv3 was also easily detectable in S. cerevisiae expressing the C. albicans ALS3 gene. Finally, and most importantly, our results demonstrate that treatment of wild-type C. albicans with scFv3 makes this strain behave very similarly to the als3Δ/ als3Δ strain in adhesion assays.
Several different attempts to demonstrate binding of scFv3 to Als3p in vitro were unsuccessful. Although we were able to demonstrate production of full-length Als3p in E. coli, we were unable to detect the protein with scFv3 by immunoblotting. Additionally, although the Als3p N-terminal domain is believed to confer its adhesive properties (Zhao et al., 2006), we were unable to detect the purified N-terminal 329 amino acids by immunoblotting, and inclusion of this protein in adhesion assays could not out-compete the ability of scFv3 to reduce wild-type C. albicans adherence. Taken together, these findings suggest that the specific epitope recognized by scFv3 is difficult to preserve in vitro. The epitope may be discontinuous or conformational, such that expression on the cell surface is required for the protein to be in the appropriate conformation for recognition. Alternatively, specific post-translational modifications may be required that are difficult to achieve in expression systems in vitro, or there may be carbohydrate moities within the epitope. Detection of Als3p on the surface of S. cerevisiae constitutively expressing the C. albicans gene not only confirms this protein as the target of scFv3, but also supports the need for post-translational modification or a specific conformational epitope for detection. ScFv specific to other antigens and isolated from the same phage display library commonly fail to recognize their target antigen in similar analyses (unpublished observation), suggesting that recapitulation of the native epitope is frequently difficult to achieve. More definitive information awaits careful epitope mapping of the reactive domain for this antibody fragment.
The binding pattern of scFv5 and scFv12 to the als3Δ/ als3Δ strain was markedly different from the pattern with wild-type C. albicans. Staining of the germ tube was quite variable and binding to the mother yeast was obvious, whereas in wild-type cells, the germ tubes were stained in a uniform fashion with no detectable staining of the mother yeast. These findings suggest that in the absence of Als3p, the antigenic milieu of the cell wall is altered. Because ALS3 transcription primarily is associated with germ tubes and hyphae (Hoyer et al., 1998), additional investigation is required to understand how this change occurs in the mother yeast. The cognate antigens of scFv5 and scFv12 have yet to be elucidated, but the obvious change in distribution of detectable antigen in the als3Δ/ als3Δ strain is striking. Although the role of Als3p in adhesion has been studied extensively, these data suggest that Als3p may also function in cell wall organization and structure.
Evidence that C. albicans Als3p functions as an adhesin is compelling. Although there may be some overlap and redundancy in function among the various C. albicans adhesins, deletion of ALS3 results in the largest effect on adhesion among the ALS gene family (Hoyer et al., 2008). Previous adhesion studies using a 6-well format showed a reduction in adhesion to HUVEC and pharyngeal epithelial cells by the als3Δ/als3Δ strain, 1843, to approximately 40% and 60% of wild-type levels respectively (Oh et al., 2005). In the present study, we observed an even more pronounced deficit in adhesion (approximately 20% and 45%) to these same cell types. Because our assay was adapted to a 96-well format and uses fluorescence for quantification, the discrepancy is likely due to assay methodology. The finding of reduced adherence by the mutant strain and similar trends between endothelial and epithelial cells validates both methodologies. Our assay has the advantage of high reproducibility and a robust signal-to-noise ratio. Further, this fluorescence-based assay in microtiter format allows more rapid readout, application of more variables in assay conditions, and higher throughput.
The finding that scFv3 has the most pronounced effect on adhesion relative to scFv5 and scFv12, coupled with the observation that all three scFv bind to germ tubes with an identical pattern, supports the notion that the interference with adhesion is specific to blocking Als3p. The smaller molecular size of scFv relative to whole antibody and the specificity of effect of scFv3 compared to other scFv that bind with an identical pattern suggest that blocking Als3p accounts for the adhesion defect, rather than merely resulting from steric interference.
Als3p binds N-cadherin and E-cadherin on endothelial and epithelial cells respectively (Phan et al., 2007). The capacity of scFv3 to block adhesion of wild-type C. albicans was more robust for epithelial cells than for endothelial cells, suggesting that the epitopes of Als3p involved in binding to these 2 cadherins may be distinct and blocked to different degrees by scFv3. Further, since the als3Δ/als3Δ strain also adheres more efficiently to endothelial cells than to epithelial cells (Fig. 4), Als3p may have a more significant role as an adhesin to epithelial surfaces than endothelial. Alternatively, there may be more redundancy among C. albicans adhesins targeted to endothelium, such that elimination of one adhesin, Als3p, either by mutation or antibody blocking, has less of an effect on adhesion to endothelium than other host surfaces.
A monoclonal antibody, C7, which was raised against a C. albicans stress mannoprotein that is the main target of salivary secretory immunoglobulin A (IgA) has been described (Moragues et al., 2003). In addition to interfering with C. albicans adhesion to HEp-2 larynx carcinoma cells and human buccal epithelial cells, C7 inhibits filamentation and has direct candidacidal activity. Subsequent study showed that this antibody reacts with Als3p after deglycosylation and with a recombinant N-terminal fragment of Als3p (Brena et al., 2007). This antibody has several other intriguing properties, including antifungal activity against a range of other genera (Cryptococcus neoformans, Aspergillus fumigatus, Scedosporium prolificans), direct tumoricidal activity, and recognition of the C. albicans enolase and the nuclear pore protein Nup88 (Moragues et al., 2003; Omaetxebarria et al., 2005). The authors suggest that the binding of Als3p by C7 may explain the inhibition of adhesion, the inhibition of germination, and the candidacidal activity of this antibody (Brena et al., 2007). However, this antibody binds neither to the hypha surface nor to dithiothreitol extracts of hyphae until they have been deglycosylated, suggesting that this antibody, unlike scFv3, may not bind efficiently to the Als3p antigen in its native state. This observation, coupled with the effects of C7 binding to other fungal antigens and to tumor cells, suggests that at least some of the properties attributed to this antibody relate to it binding antigens distinct from Als3p. Our observation that scFv3 has no effect on germination or on C. albicans growth (data not shown) supports the notion that antibody binding to this protein may not affect fungal physiology beyond its ability to adhere to human cells and may therefore have narrower antigen specificity than C7. Regardless, this study validates the use of phage display technology to generate antibody fragments that can function at the host-pathogen interface, and adds to the armamentarium of immune-based reagents available for study of invasive candidiasis.
ACKNOWLEDGEMENTS
This work was supported by National Institutes of Health grants (1K08 AI064919, R01 DE14158), a March of Dimes Basil O'Connor Award (5-FY05-1211) and a NIH COBRE grant (1P20 RR018728). We thank Sunil Shaw for assistance with technical aspects of this work and helpful discussions.
  • Bailey DA, Feldmann PJ, Bovey M, Gow NA, Brown AJ. The Candida albicans HYR1 gene, which is activated in response to hyphal development, belongs to a gene family encoding yeast cell wall proteins. J Bacteriol. 1996;178:5353–5360. [PMC free article] [PubMed]
  • Benjamin DK, Jr., Stoll BJ, Fanaroff AA, McDonald SA, Oh W, Higgins RD, Duara S, Poole K, Laptook A, Goldberg R. Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months. Pediatrics. 2006;117:84–92. [PubMed]
  • Bliss JM, Sullivan MA, Malone J, Haidaris CG. Differentiation of Candida albicans and Candida dubliniensis by using recombinant human antibody single-chain variable fragments specific for hyphae. J Clin Microbiol. 2003;41:1152–1160. [PMC free article] [PubMed]
  • Brena S, Omaetxebarria MJ, Elguezabal N, Cabezas J, Moragues MD, Ponton J. Fungicidal monoclonal antibody C7 binds to Candida albicans Als3. Infect Immun. 2007;75:3680–3682. [PMC free article] [PubMed]
  • Calderone RA. Candida and Candidiasis. ASM Press; Washington D.C.: 2002.
  • Gale CA, Bendel CM, McClellan M, Hauser M, Becker JM, Berman J, Hostetter MK. Linkage of adhesion, filamentous growth, and virulence in Candida albicans to a single gene, INT1. Science. 1998;279:1355–1358. [PubMed]
  • Gillum AM, Tsay EY, Kirsch DR. Isolation of the Candida albicans gene for orotidine-5′-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet. 1984;198:179–182. [PubMed]
  • Haidaris CG, Malone J, Sherrill LA, Bliss JM, Gaspari AA, Insel RA, Sullivan MA. Recombinant human antibody single chain variable fragments reactive with Candida albicans surface antigens. J Immunol Methods. 2001;257:185–202. [PubMed]
  • Hoyer LL. The ALS gene family of Candida albicans. Trends Microbiol. 2001;9:176–180. [PubMed]
  • Hoyer LL, Green CB, Oh SH, Zhao X. Discovering the secrets of the Candida albicans agglutinin-like sequence (ALS) gene family - a sticky pursuit. Med Mycol. 2008;46:1–15. [PMC free article] [PubMed]
  • Hoyer LL, Payne TL, Bell M, Myers AM, Scherer S. Candida albicans ALS3 and insights into the nature of the ALS gene family. Curr Genet. 1998;33:451–459. [PubMed]
  • Kabat EA, Wu TT, Perry H, Gottesman K, Foeller C. Sequences of Proteins of Immunological Interest. US Department of Health and Human Services, National Institutes of Health; Bethesda, MD: 1991.
  • Kipriyanov SM, Moldenhauer G, Little M. High level production of soluble single chain antibodies in small-scale Escherichia coli cultures. J Immunol Methods. 1997;200:69–77. [PubMed]
  • Kumamoto CA, Vinces MD. Contributions of hyphae and hypha-co-regulated genes to Candida albicans virulence. Cell Microbiol. 2005;7:1546–1554. [PubMed]
  • Li F, Svarovsky MJ, Karlsson AJ, Wagner JP, Marchillo K, Oshel P, Andes D, Palecek SP. Eap1p, an adhesin that mediates Candida albicans biofilm formation in vitro and in vivo. Eukaryot Cell. 2007;6:931–939. [PMC free article] [PubMed]
  • Moragues MD, Omaetxebarria MJ, Elguezabal N, Sevilla MJ, Conti S, Polonelli L, Ponton J. A monoclonal antibody directed against a Candida albicans cell wall mannoprotein exerts three anti-C. albicans activities. Infect Immun. 2003;71:5273–5279. [PMC free article] [PubMed]
  • Oh SH, Cheng G, Nuessen JA, Jajko R, Yeater KM, Zhao X, Pujol C, Soll DR, Hoyer LL. Functional specificity of Candida albicans Als3p proteins and clade specificity of ALS3 alleles discriminated by the number of copies of the tandem repeat sequence in the central domain. Microbiology. 2005;151:673–681. [PubMed]
  • Omaetxebarria MJ, Moragues MD, Elguezabal N, Rodriguez-Alejandre A, Brena S, Schneider J, Polonelli L, Ponton J. Antifungal and antitumor activities of a monoclonal antibody directed against a stress mannoprotein of Candida albicans. Curr Mol Med. 2005;5:393–401. [PubMed]
  • Phan QT, Myers CL, Fu Y, Sheppard DC, Yeaman MR, Welch WH, Ibrahim AS, Edwards JE, Filler SG. Als3 Is a Candida albicans Invasin That Binds to Cadherins and Induces Endocytosis by Host Cells. PLoS Biol. 2007;5:e64. [PMC free article] [PubMed]
  • San-Blas G, Travassos LR, Fries BC, et al. Fungal morphogenesis and virulence. Med Mycol. 2000;38(Suppl 1):79–86. [PubMed]
  • Sheppard DC, Yeaman MR, Welch WH, Phan QT, Fu Y, Ibrahim AS, Filler SG, Zhang M, Waring AJ, Edwards JE., Jr. Functional and structural diversity in the Als protein family of Candida albicans. J Biol Chem. 2004;279:30480–30489. [PubMed]
  • Staab JF, Bradway SD, Fidel PL, Sundstrom P. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science. 1999;283:1535–1538. [PubMed]
  • Sundstrom P, Balish E, Allen CM. Essential role of the Candida albicans transglutaminase substrate, hyphal wall protein 1, in lethal oroesophageal candidiasis in immunodeficient mice. J Infect Dis. 2002;185:521–530. [PubMed]
  • Viudes A, Peman J, Canton E, Ubeda P, Lopez-Ribot JL, Gobernado M. Candidemia at a tertiary-care hospital: epidemiology, treatment, clinical outcome and risk factors for death. Eur J Clin Microbiol Infect Dis. 2002;21:767–774. [PubMed]
  • Wellington M, Bliss JM, Haidaris CG. Enhanced phagocytosis of Candida species mediated by opsonization with a recombinant human antibody single-chain variable fragment. Infect Immun. 2003;71:7228–7231. [PMC free article] [PubMed]
  • Zhao X, Daniels KJ, Oh SH, Green CB, Yeater KM, Soll DR, Hoyer LL. Candida albicans Als3p is required for wild-type biofilm formation on silicone elastomer surfaces. Microbiology. 2006;152:2287–2299. [PMC free article] [PubMed]
  • Zhao X, Oh SH, Cheng G, Green CB, Nuessen JA, Yeater K, Leng RP, Brown AJ, Hoyer LL. ALS3 and ALS8 represent a single locus that encodes a Candida albicans adhesin; functional comparisons between Als3p and Als1p. Microbiology. 2004;150:2415–2428. [PubMed]