PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2009 July 1.
Published in final edited form as:
PMCID: PMC2587449
NIHMSID: NIHMS56320
CURCUMIN DECREASES SPECIFICITY PROTEIN (Sp) EXPRESSION IN BLADDER CANCER CELLS
Gayathri Chadalapaka,1 Indira Jutooru,1 Sudhakar Chintharlapalli,2 Sabitha Papineni,2 Roger Smith, III,3 Xiangrong Li,1 and Stephen Safe1,3
1Department of Veterinary Physiology and Pharmacology, Texas A&M University, College Station, TX 77843
2Institute of Biosciences and Technology, Texas A&M University Health Science Center, Houston, TX 77030
3Department of Veterinary Pathobiology, Texas A&M University, College Station, TX 77843
Send all correspondence to: Stephen Safe, Distinguished Professor of Toxicology, Department of Veterinary Physiology and Pharmacology, Texas A&M University, 4466 TAMU, Vet. Res. Bldg. 410, College Station, TX 77843-4466, Tel: 979-845-5988 / Fax: 979-862-4929, Email: ssafe/at/cvm.tamu.edu
Curcumin is the active component of tumeric, and this polyphenolic compound has been extensively investigated as an anticancer drug that modulates multiple pathways and genes. In this study, 10 – 25 µM curcumin inhibited 253JB-V and KU7 bladder cancer cell growth, and this was accompanied by induction of apoptosis and decreased expression of the proapoptotic protein survivin and the angiogenic proteins vascular endothelial growth factor (VEGF) and VEGF receptor 1 (VEGFR1). Since expression of survivin, VEGF and VEGFR1 are dependent on specificity protein (Sp) transcription factors, we also investigated the effects of curcumin on Sp protein expression as an underlying mechanism for the apoptotic and antiangiogenic activity of this compound. The results show that curcumin induced proteasome-dependent downregulation of Sp1, Sp3 and Sp4 in 253JB-V and KU7 cells. Moreover, using RNA interference with small inhibitory RNAs for Sp1, Sp3 and Sp4, we observed that curcumin-dependent inhibition of nuclear factor κB (NFκB)-dependent genes such as bcl-2, survivin and cyclin D1, was also due, in part, to loss of Sp proteins. Curcumin also decreased bladder tumor growth in athymic nude mice bearing KU7 cells as xenografts and this was accompanied by decreased Sp1, Sp3 and Sp4 protein levels in tumors. These results demonstrate for the first time that one of the underlying mechanisms of action of curcumin as a cancer chemotherapeutic agent is due, in part, to decreased expression of Sp transcription factors in bladder cancer cells.
Keywords: curcumin, Sp proteins, survivin, VEGF, VEGFR1, bladder cancer, inhibition
Phytochemicals, microbial metabolites, and other natural products and their synthetic analogs have been extensively used for drug development and treatment of various diseases including cancer (1, 2). Curcumin (diferuloylmethane) is a polyphenolic natural product and the active component of tumeric (Curcuma species) which is used in cooking and in traditional medicines (35). Curcumin has been extensively investigated as an anticancer drug in various cancer cells and laboratory animal models. Curcumin has also been evaluated in humans, and one of the major problems associated with clinical applications of curcumin is the low bioavailability (610). The effects of curcumin in various tumor models is highly variable and dependent on both tumor type and cell context. In many studies, curcumin inhibits cancer cell proliferation, induces apoptosis, and inhibits angiogenesis (1120). Mechanisms associated with these effects are variable and may involve direct effects on mitochondria, activation of endoplasmic reticulum (ER) stress, and modulation of kinase pathways including the inhibition of nuclear factor κB (NFκB).
Recent studies reported that curcumin decreased survival of RT4V6 and KU7 bladder cancer cells, and this was accompanied by increased DNA fragmentation and other parameters associated with apoptosis (17). In addition, there was also evidence that curcumin potentiated the effects of other drugs and cytokines in bladder cancer cells, and this has been observed in other studies (16, 17, 21, 22). Curcumin alone had minimal effects on NFκB in RT4V6 or KU7 cells; however, in cells treated with agents such as gemcitabine, tumor necrosis factor (TNF), and cigarette smoke that induce NFκB, cotreatment with curcumin inhibited NFκB activation. It was concluded that suppression of induced NFκB by curcumin may play a role in sensitizing bladder cancer cells and other cancer cell lines to various chemotherapeutic agents (17).
Betulinic acid (BA) is a triterpenoid natural product that inhibits growth of multiple cancer cell lines, and this compound induces apoptosis and inhibits angiogenesis (23). Studies in this laboratory showed that one of the underlying mechanisms of action of this compound in prostate cancer cells was the targeted degradation of specificity protein 1 (Sp1), Sp3 and Sp4 and Sp-dependent genes involved in cell growth, survival and angiogenesis (24). We also observed similar effects for the analgesic tolfenamic acid (25, 26), and RNA interference studies with small inhibitory RNAs for Sp1, Sp3 and Sp4 confirmed the role of these proteins in regulating expression of vascular endothelial growth factor (VEGF), VEGF receptor 1 (VEGFR1), VEGFR2, and survivin and repression of p27 by Sp3 (2630).
Curcumin induced apoptosis and inhibited KU7 and 253JB-V bladder cancer cell proliferation, and we hypothesized that curcumin may also affect Sp protein expression in these cells. Curcumin decreased Sp1, Sp3 and Sp4 protein expression in the bladder cancer cell lines and similar results were observed in tumors in a xenograft study. These results demonstrate that the curcumin-induced growth inhibitory, proapoptotic and angiogenic responses in bladder cancer cells and tumors are due, in part, to decreased expression of Sp1, Sp3 and Sp4. Moreover, curcumin-induced downregulation of Sp proteins also plays a role in the effects of curcumin as an inhibitor of NFκB-dependent genes.
Cell lines, antibodies, chemicals and other materials
KU-7 human bladder cancer cells were obtained from the American Type Culture Collection (Manassas, VA) and 253JB-V cells were provided by Dr. A. Kamat (M.D. Anderson Cancer Center, Houston, TX) and maintained essentially as described (17). With the exception of cleaved PARP (Cell Signaling Technology, Danvers, MA), NFκB-p65 (Abcam Inc., Cambridge, MA), and β-actin antibodies (Sigma-Aldrich), all remaining antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Curcumin (98% pure) was purchased from Indofine Chemical Company, Inc. (Hillsborough,NJ). Lipofectamine and Lipofectamine 2000 were purchased from Invitrogen (Carlsbad, CA). β-Galactosidase reagent was obtained from Tropix (Bedford, MA).
Cell proliferation assays
Bladder cancer cells (3 × 104 cells per well) were plated using DMEM:Ham's F-12 medium containing 2.5% charcoal-stripped FBS in 12-well plates and left to attach for 24 hr. Cells were then treated with either vehicle (DMSO) or the indicated concentrations of curcumin. Fresh medium and test compounds were added every 48 hr, and cells were then counted at the indicated times using a Coulter Z1 particle counter. Each experiment was done in triplicate and results are expressed as means ± SE for each determination.
TUNEL assay
253JB-V and KU7 cells (7 × 104) were seeded in four-chambered glass slides and left overnight to attach. After curcumin treatment for 12 hr, the in situ cell death detection POD kit was used for the TUNEL assay according to the instructions in the protocol manual for fixed cells. The percentage of apoptotic cells was calculated by counting the stained cells in 8 fields, each containing 50 cells. The total number of apoptotic cells was plotted as a percentage in both the cell lines.
Transfection and luciferase assays
Bladder cancer cells (1 × 105 per well) were plated in 12-well plates in DMEM:Ham's F-12 medium supplemented with 2.5% charcoal-stripped FBS. After 16 hr, various amounts of DNA (i.e., 0.4 µg pGL3/pGL2-Luc, 0.04 µg β-galactosidase, and 0.4 µg pSp1For4-Luc, pSp3For5-Luc, pVEGF-Luc, pNFκB-Luc and pSurvivin-Luc were transfected using Lipofectamine reagent according to the manufacturer’s protocol and luciferase activity (normalized to β-galactosidase) was determined essentially as described (2429).
Western blot assays
Bladder cancer cells were seeded in DMEM:Ham's F-12 medium containing 2.5% charcoal-stripped FBS. Twenty-four hr later, cells were treated with either vehicle (DMSO) or the indicated compounds for 24 hr and Western blot analysis was determined as described (2629). Nuclear and cytoplasmic extracts were separated using NE-PER nuclear and cytoplasmic extraction reagents (Pierce, Rockford, IL). The tumor tissues were also processed similarly and probed for Sp1, Sp3 and Sp4 proteins and β-actin served as loading control. Protein quantification used Image J software, and optical densities for each protein was normalized to β-actin in the iLamin-treated group.
Fluorescence-activated cell-sorting assays (FACS)
Both 253JB-V and KU7 bladder cancer cells were treated with either the vehicle (DMSO) or the indicated compounds for 24 hr. Cells were analysed on a FACS Calibur flow cytometer using CellQuest acquisition software (Becton Dickinson Immunocytometry Systems). PI fluorescence was collected through a 585/42 nm band pass filter, and list mode data were acquired on a minimum of 20,000 single cells defined by a dot plot of PI width versus PI area. Data analysis was performed in Modfit LT using PI width versus PI to exclude cell aggregates.
SiRNA interference assays
Small inhibitory RNAs for Sp1, Sp3 and Sp4 were prepared by Dharmacon RNA Technologies (Chicago, IL). The iRNA complexes used in this study are indicated as follows:
  • LMN 5’-CUG GAC UUC CAG AAG AAC ATT
  • Sp1 SMARTpool L-026959-00-0005, Human Sp1, NM_138473ss
  • Sp3 5′- GCG GCA GGU GGA GCC UUC ACU TT
  • Sp4 5′- GCA GUG ACA CAU UAG UGA GCT T
  • p65 (REL1096) 5’-GATTGAGGAGAAACGTAAATT
  • p50 (REL 1911) 5’- GTCACTCTAACGTATGCAATT
The two bladder cancer cell lines, 253JB-V and KU7, were seeded (1 × 105 per well) in 12-well plates in DMEM:Ham's F-12 medium supplemented with 2.5% charcoal-stripped FBS without antibiotic and left to attach for one day. The triple Sp SiRNA knockdown (iSp1, iSp3, iSp4 complex) along with iLamin as control was performed using Lipofectamine 2000 transfection reagent as per the manufacturer’s instructions. SiRNA for p65 and p50 and NC were purchased from Integrated DNA Technologies (Coralville, IA).
EMSA assay
Cells were rinsed in cold PBS buffer and harvested in reporter lysis buffer (Promega). After 15 min incubation on ice and 10 min centrifugation at 16,000 × g, 4°C, the pellet was resuspended in reporter lysis buffer supplemented with 0.5 M KCl and incubated on ice for 30 min. The supernatant containing nuclear proteins was collected after centrifugation for 10 min at 16,000 × g, 4°C and quantified for protein concentrations by Bradford method. The GC-rich probe was prepared by annealing the two complementary polynucleotides: 5’- CTC GTC GGC CCC CGC CCC TCT -3’ and 5’- AGA GGG GCG GGG GCC GAC GAG -3’. The NFκB sense strand probe was 5′-AGT TGA GGG GAC TTT CCC AGG C -3′. The annealed probe was 5′-end-labeled using T4 polynucleotide kinase (Invitrogen) and [γ-32P] ATP (PerkinElmer). The labeled probe was purified with the Chroma Spin TE-10 column (BD Biosciences). The EMSA reaction was carried out in the reporter lysis buffer (Promega) supplemented with 0.1 M KCl. Each reaction contained 2 µg nuclear protein, 500–1000 ng of poly (dI-dC) (Roche Molecular Biochemicals) with or without unlabeled competitor oligonucleotides, and 10 fmol of labeled probe; the mixture was incubated for 15 min on ice. Protein-DNA complexes were resolved by 5% native PAGE at 160 V at room temperature for 1.5 hr and visualized using a Storm A60 PhosphoImager system (Molecular Dynamics).
Xenograft study
Female athymic nude mice, age 4–6 weeks were purchased from Harlan (Indianapolis, CA). KU7 cells (1×106 cells) in 1:1 ratio of Matrigel (BD Biosciences, San Jose, CA) were injected into the either side of the flank area of nude mice. Seven days after the tumor cell inoculation, mice were divided into two groups of ten animals each. The first group received 50 µL vehicle (corn oil) by intraperitoneal injection, and the second group of animals received 50 mg/kg/d injection of curcumin in corn oil every second day for 18 days (9 doses) by intraperitoneal injection. The mice were weighed, and tumor areas were measured throughout the study. After 20 days, the animals were sacrificed; final body and tumor weights were determined and plotted.
Figures 1A and 1B illustrate the concentration-dependent effects of 5, 10 and 25 µM curcumin on proliferation of 253JB-V and KU7 bladder cancer cells over a 6 day period with change of media and treatment with DMSO (control) or curcumin every 48 hr. Proliferation of both 253JB-V and KU7 cells was inhibited by curcumin. However, the pattern of inhibition was slightly different; 5 and 10 µM curcumin significantly inhibited 253JB-V cells after treatment for 4 and 6 days, whereas 10 µM (but not 5 µM) curcumin significantly inhibited KU7 cell proliferation after treatment for 2, 4 and 6 days. The highest concentration of curcumin (25 µM) was cytotoxic to both cell lines, and similar results were previously reported on the cytotoxicity of curcumin in KU7 and RT4V6 bladder cancer cells (17). The effects of curcumin on the distribution of 253JB-V and KU7 cells in G0/G1, S and M phases of the cell cycle are illustrated in Figures 1C and 1D, respectively. Curcumin (5 – 25 µM) increased the percentage of 253JB-V cells in G0/G1 and decreased the percentage in S and G2/M phases, although the effects on G2/M were concentration-dependent and variable. In contrast, in KU7 cells, minimal effects were observed after treatment with 5 or 10 µM curcumin, whereas 25 µM curcumin decreased the percentage of cells in G0/G1 and increased the percentage in S and G2/M phases (Fig. 1D). These results demonstrate that curcumin-induced changes in the distribution of 253JB-V and KU7 cells in different phases of the cycle were dependent on cell context.
Figure 1
Figure 1
Curcumin inhibits bladder cancer cell growth and modulates the cell cycle. Inhibition of 253JB-V (A) and KU7 (B) cell growth. Cells were treated with DMSO (solvent control), 5, 10 or 25 µM curcumin and the effects of cell growth were determined (more ...)
The effects of curcumin on selected proteins involved in cell cycle progression are summarized in Figure 2A. Curcumin decreased expression of cyclin D1 in both 253JB-V and KU7 cells (Fig. 5C), and the cyclin-dependent kinase inhibitors p21 and p27 were also decreased. The loss of cyclin D1 expression in 253JB-V cells treated with curcumin was consistent with the inhibition of G0/G1 to S phase progression in the cell line (Fig. 1C). The cyclin-dependent kinase inhibitors p21 and p27 were also decreased in both cell lines by curcumin, but at different concentrations. p21 was decreased by 25 – 50 and 10 – 50 µM curcumin in 253JB-V and KU7 cells, respectively, whereas 25 – 50 µM curcumin decreased p27 expression in both cell lines. The role of these responses in mediating the distribution of bladder cancer cells in different phases of the cell cycle (Figs. 1C and 1D) is unclear. Previous studies showed that curcumin induced apoptosis in bladder cancer cells (17) and, in pancreatic tumors, curcumin suppressed proliferation and inhibited angiogenesis (13, 16). Results in Figure 2B demonstrate that curcumin induced PARP cleavage in 253JB-V and KU7 cells, and this was also accompanied by downregulation of the antiapoptotic gene survivin. Decreased survivin and increased PARP cleavage were initially observed at curcumin concentrations of 10 and 25 µM in 253JB-V and KU7 cells, respectively, and maximal responses were observed in cells treated with 25 and 50 µM curcumin. In addition, curcumin also decreased expression of two angiogenic proteins, VEGF and VEGFR1, in both cell lines (Fig. 2B). The proapoptotic activity of curcumin was also confirmed in a TUNEL assay (Fig. 2C) where 40 µM curcumin induced increased TUNEL staining in 253JB-V and KU7 cells, whereas minimal effects were observed in the solvent (DMSO)-treated cells.
Figure 2
Figure 2
Curcumin modulates expression of cell cycle, survival and angiongenic proteins and induces apoptosis. (A) Decreased expression of p27 and p21 proteins. 253JB-V and KU7 cells were treated with DMSO, 5, 10, 25, or 50 µM curcumin for 24 hr, and whole (more ...)
Figure 5
Figure 5
Effects of curcumin and Sp knockdown on NFκB. (A) Curcumin decreases NFκB promoter activity in 253JB-V and KU7 cells. 253JB-V and KU7 cells were transfected with pNFκB-luc treated with DMSO, 10, 25 or 40 µM curcumin, and (more ...)
Results in Figures 3A and 3B show that after treatment of 253JB-V and KU7 cells with curcumin (5 – 50 µM) for 24 hr, there was a concentration-dependent decrease in the expression of Sp1, Sp3 and Sp4 proteins. Curcumin-induced downregulation of Sp proteins was dependent on the concentration of curcumin, Sp protein (i.e. Sp1, Sp3 or Sp4), and cell context. However, in both 253JB-V and KU7 cells, decreased expression of all three proteins was observed after treatment with 10 µM and higher concentrations of curcumin for 24 hr. Since curcumin decreased expression of Sp1, Sp3, Sp4 and Sp-dependent survivin, VEGF and VEGFR1 proteins (Fig. 2B, Fig. 3A and 3B), we also investigated the effects of curcumin on luciferase activity in 253JB-V and KU7 cells transfected with constructs containing GC-rich promoters that bind Sp proteins. Luciferase activity was decreased in 253JB-V and KU7 cells treated with 10 – 40 µM curcumin and transfected with GC-rich Sp1For4 and Sp3For5 constructs containing the −751 to −20 and −417 to −38 regions of the Sp1 and Sp3 gene promoters, respectively (31, 32) (linked to the luciferase gene) (Fig. 3C). In addition, curcumin (10 – 40 µM) also decreased luciferase activity in 253JB-V and KU7 cells transfected with GC-rich pVEGF and pSurvivin constructs that contain the −2018 to +50 and −269 to +49 GC-rich regions of the VEGF and survivin gene promoters, respectively (Fig. 3D). Thus, like tolfenamic acid and betulinic acid, curcumin-induced downregulation of Sp1, Sp3 and Sp4 not only decreased expression of Sp-regulated proteins such as VEGF and survivin (Fig. 2B), but also decreased transactivation in 253JB-V and KU7 cells transfected with pVEGF and pSurvivin constructs containing GC-rich promoter inserts.
Figure 3
Figure 3
Effects of curcumin on Sp proteins and Sp-dependent transactivation. Curcumin decreases Sp proteins in 253JB-V (A) and KU7 (B) bladder cancer cells. Cells were treated with DMSO, 5, 10, 25 or 50 µM curcumin for 24 hr and whole cell lysates were (more ...)
Previous studies show that tolfenamic and betulinic acids induce proteasome-dependent degradation of Sp1, Sp3 and Sp4 in pancreatic and prostate cancer cells (24, 25), and Figures 4A and 4B summarize the effects of the proteasome inhibitor MG132 on curcumin-induced downregulation of these proteins. In KU7 cells, MG132 inhibited curcumin-induced downregulation of Sp1, Sp3 and Sp4 proteins, and similar effects were observed in 253JB-V cells. However, in the latter bladder cancer cell line, MG132 alone also decreased Sp protein expression and this response was most pronounced for Sp1. Other proteasome inhibitors such as lactacystin and gliotoxin gave similar results and, in combination with curcumin, high cytotoxicity was observed in 253JB-V cells (data not shown). Nevertheless, it was apparent that MG132 plus curcumin blocked Sp protein downregulation in both cell lines, suggesting that curcumin, like betulinic and tolfenamic acids (2426), induced proteasome-dependent downregulation of Sp1, Sp3 and Sp4 proteins in 253JB-V and KU7 cells. Figure 4C summarizes the effects of MG132 on curcumin-dependent decreased luciferase activity in 253JB-V and KU7 cells transfected with pSp1For4 and pSp3For5. In 253JB-V cells, MG132 only partially reversed downregulation of activity by 25 µM curcumin, whereas in KU7 cells, MG132 completely inhibited the effects of curcumin on luciferase activity. The relative effectiveness of MG132 as an inhibitor of curcumin-dependent downregulation of luciferase activity in cells transfected with pVEGF or pSurvivin also differed in 253JB-V and KU7 cells (Fig. 4D). MG132 reversed the effects of curcumin in KU7 cells (80 – 100%) but was less efficient in 253JB-V cells. This may be due, in part, to the cytoxocity of MG132 alone and in combination with curcumin in 253JB-V cells. These results demonstrate that curcumin primarily induced proteasome-dependent degradation of Sp1, Sp3 and Sp4 in the bladder cancer cells, and similar effects have been observed for tolfenamic acid and betulinic acid in pancreatic and prostate cancer cells (24, 25).
Figure 4
Figure 4
MG132 inhibition of curcumin-induced effects on Sp proteins and Sp-dependent transactivation. MG132 inhibits curcumin-dependent downregulation of Sp proteins in 253JB-V (A) and KU7 (B) cells. Bladder cancer cells were treated with DMSO alone, 25 µM (more ...)
Previous studies in bladder and other cancer cell lines report that the broad spectrum of anticancer activities of curcumin have been associated, in part, with decreased NFκB-dependent activity (3, 4). Results illustrated in Figures 5A show that 10 – 40 µM curcumin decreased luciferase activity in 253JB-V and KU7 cells transfected with pNFκB, a construct containing 5 tandem NFκB response elements that regulate a luciferase reporter gene. Thus, curcumin decreases NFκB-dependent transactivation in 253JB-V and KU7 cell lines. Since curcumin also decreases expression of Sp1, Sp3 and Sp4 in bladder cancer cells (Figs. 3A and 3B), we investigated the effects of Sp protein knockdown on luciferase activity in cells transfected with pNFκB-luc (Fig. 5B). 253JB-V and KU7 cells were transfected with iSp which is a cocktail of small inhibitory RNAs for Sp1 (iSp1), Sp3 (iSp3), and Sp4 (iSp4) (33). The results showed that transfection with iSp significantly inhibited NFκB-dependent activity and this was not directly related to a decrease in p65 or p50 protein levels after transfection with iSp (fig. 5B). There was a minimal but not significant decrease in these proteins over replicated experiments, suggesting that decreased NFκB-dependent transactivation by iSp was not dependent on decreased expression of p65 or p50. We also investigated the effects of iSp1, iSp3 and iSp4 on p65 and p50 protein expression in 253JB-V and KU7 cells (Supplement 1). In the former cell line, iSp3 and iSp4 (but not iSp1) slightly decreased p65 protein levels, whereas none of the small inhibitory RNAs affected p65 or p50 expression in KU7 cells and p50 expression in 253JB-V cells. Results in Figures 2A and 2B show that curcumin also decreased expression of VEGF and survivin which are regulated by both NFκB and Sp transcription factors (28, 3437). Figure 5C shows that curcumin decreased expression of cyclin D1 and the antiapoptotic protein bcl-2 in 253JB-V and KU7 cells, and both of these genes are also regulated by NKκB and Sp transcription factors (38, 39). It is possible that curcumin-induced downregulation of Sp proteins may directly affect NFκB since both p65 and p50 are Sp-dependent genes in some cell lines (34, 40). However, treatment of 253JB-V and KU7 cells with DMSO, 10, 25 or 40 µM curcumin for 24 hr did not affect nuclear p65 expression, whereas nuclear p50 protein levels were decreased only at the higher (40 µM) concentration (Figs. 5D) and 25 µM curcumin, which decreases Sp protein levels, did not affect p65 or p50 expression. Thus, curcumin-mediated inhibition of NFκB-dependent gene expression is not due to direct effects on p65 or p50.
A close inspection of many NFκB-regulated genes such as cyclin D1, bcl-2, survivin and VEGF indicates that these genes also contain multiple GC-rich promoter sequences and are coregulated by Sp proteins in many cell lines (2428, 3439). Results in Figure 6A show that in 253JB-V and KU7 cells transfected with iLamin (control) or the iSp cocktail (containing iSp1, iSp3 and iSp4), there was a significant decrease in levels of bcl-2, cyclin D1, survivin and VEGF and this correlated with the effects of curcumin on these same proteins (Fig. 2B and Fig. 5C). In contrast, combined knockdown of p65 and p50 by RNA interference (Fig. 6B) did not affect expression of all these proteins. Only VEGF and bcl-2 proteins were decreased by p65/p50 knockdown, suggesting that basal expression of cyclin D1 and survivin were NFκB-independent in the bladder cancer cells. Figure 6C illustrates gel mobility shift assays in which nuclear extracts from 253JB-V and KU7 cells bound a 32P-labeled GC-rich oligonucleotide to form Sp-DNA retarded bands as previously characterized in other cell lines (2729). Treatment with 25 or 40 µM curcumin decreased retarded band intensities and coincubation with unlabeled wild-type GC-rich or mutant oligonucleotides decreased or did not affect retarded band intensities, respectively (Fig. 6C). Supershift experiments with Sp1 antibodies did not give a defined supershifted (SS) antibody-protein complex but a diffuse band. However, the Sp1 band intensity was decreased due to immunodepletion. We also determined the effects of curcumin on NFκB-DNA binding in a gel mobility shift assay using a consensus NFκB response element and extracts from cells, and the results showed that curcumin decreased retarded band intensities associated with the NFκB-DNA complex (Supplement 2). These data confirm that curcumin decreases Sp proteins and Sp-DNA complex formation and the NFκB-DNA retarded band and this correlated with decreased expression of NFκB regulated proteins which are also coregulated by Sp transcription factors. These factors suggest that curcumin-dependent downregulation of Sp proteins contributes to decreased expression of several NFκB-dependent proteins which are coregulated by both Sp and NFκB transcription factors (2428, 3439).
Figure 6
Figure 6
Role of Sp protein and NFκB on protein expression and the effects of curcumin on Sp-DNA binding and bladder tumor growth. Effects of iSp and iLamin (A) and small inhibitory RNAs for p65 (ip65) and p50 (ip50) [combined (B)] on genes regulated by (more ...)
We also investigated the antitumorigenic activity of curcumin in athymic nude mice bearing KU7 cells as xenografts. At a dose of 50 mg/kg/d, curcumin significantly decreased tumor volumes and tumor weights (Fig. 6D). Moreover, Western blot analysis of tumor lysates from three control and three treated mice show that Sp1, Sp3 and Sp4 protein expression is decreased in the latter group. These results complement the in vitro studies and demonstrate that curcumin-induced effects on Sp proteins also plays a role in the mechanism of action of this compound in bladder cancer cells.
Curcumin has been widely used in traditional medicines, and its chemoprotective and chemotherapeutic effects are due to many different activities that are also dependent on cell context (35). One of the most predominant effects of curcumin observed in many studies is associated with inhibition of constitutive or induced NFκB-dependent genes/proteins associated with cell survival, angiogenesis and inflammation (35, 33, 4143). However, other pathways contribute to the effects of curcumin, and these may be NFκB-independent. For example, curcumin induces endoplasmic reticulum (ER) stress in human leukemia HL-60 cells, and this results in activation of ER stress-dependent proapoptotic pathways associated with cleavage of caspases 8, 9, 3 and 4 (18). In addition, curcumin-induced apoptosis in human leukemia U937 cells was also linked to the direct effects of this compound on mitochondria function and subsequent activation of the intrinsic apoptosis pathway (44).
Recent studies in this laboratory have demonstrated that compounds such as celecoxib, tolfenamic acid, and betulinic acid inhibit cancer cell and tumor growth and metastasis, and exhibit both antiangiogenic and proapoptotic activity through decreased expression of Sp proteins such as Sp1, Sp3 and Sp4 (2527). The role of Sp proteins in mediating these responses was consistent with RNA interference studies showing that Sp proteins regulate angiogenic, growth promoting, and prosurvival genes in cancer cells (2830). Results in Figure 1 illustrate that curcumin decreased proliferation of bladder cancer cells and induced apoptosis as evidenced by induction of PARP cleavage (Fig. 2B) and DNA laddering (Fig. 2C) in 253JB-V and KU7 bladder cancer cells. These results are consistent with a report (17) showing that curcumin exhibited growth inhibitory and proapoptotic activity in KU7 and RT4V6 bladder cancer cells. In the prior study (17), 10 µM curcumin slightly inhibited G0/G1 to S phase progression in KU7 cells, whereas our results showed that 10 µM curcumin inhibited G0/G1 to S phase progression in 253JB-V but not in KU7 cells which were essentially unaffected by 10 µM curcumin (Figs. 1C and 1D). Differences in the effects of curcumin on cell cycle progression in these cell lines may be due, in part, to the effects of curcumin on p21, p27 and cyclin D1 expression (Fig. 2A and Fig. 5C), and this is currently being investigated.
Curcumin also decreased expression of the angiogenic proteins VEGF and VEGFR1 in both bladder cancer cell lines, and decreased expression of the antiapoptotic protein survivin was accompanied by induction of caspase-dependent PARP cleavage (Fig. 2B) and increased staining in the TUNEL assay (Fig. 2C). This evidence for activation of apoptosis by curcumin is consistent with previous studies on this compound in bladder and other cancer cell lines (35, 1218). However, the coordinate decrease in expression of survivin, VEGF and VEGFR1 in bladder cancer cells treated with curcumin was reminiscent of similar effects observed in prostate and pancreatic cancer cells treated with betulinic acid and tolfenamic acid, respectively (2426). In those studies, it was shown that decreased expression of survivin, VEGF and VEGFR1 was due to degradation of Sp1, Sp3 and Sp4 which are known to regulate basal expression of survivin, VEGF, VEGFR1 and VEGFR2 (2730, 3537). Results summarized in Figure 3 illustrate that treatment of 253JB-V and KU7 cells with curcumin caused a concentration-dependent decrease in Sp1, Sp3 and Sp4 protein expression. The Sp1 and Sp3 promoters contain GC-rich motifs that bind Sp proteins (31, 32), and curcumin inhibited transactivation in 253JB-V and KU7 cells transfected with constructs (pSp1For4 and pSp3For5) containing Sp1 and Sp3 gene promoter inserts (Fig. 3C). Sp proteins also regulate expression of survivin and VEGF (3537), and curcumin decreased luciferase activity in bladder cancer cells transfected with pVEGF and pSurvivin.
Betulinic acid- and tolfenamic acid-induced downregulation of Sp1, Sp3 and Sp4 in prostate and pancreatic cancer cells is due to activation of proteasomes, and these are blocked by the proteasome inhibitor MG132 (2426). This same inhibitor inhibited curcumin-induced downregulation of Sp1, Sp3 and Sp4 proteins in 253JB-V and KU7 cells (Figs. 4A and 4B), and similar effects were observed in cells transfected with pS1For4, pSp3For5, pVEGF and pSurvivin and treated with curcumin plus MG132 (Figs. 4C and 4D). MG132 and other proteasome inhibitors such as gliotoxin and lactacystin were cytotoxic to 253JB-V cells, and MG132 alone decreased Sp1 protein in this cell line. However, despite these effects, our results show that curcumin-dependent downregulation of Sp1, Sp3 and Sp4 proteins was partially reversed in 253JB-V cells cotreated with curcumin plus MG132. Moreover, similar results were observed in the transfection studies (Figs. 4C and 4D), suggesting that curcumin-dependent downregulation of Sp1, Sp3 and Sp4 in KU7 and 253JB-V cells was primarily due to activation of the proteasome pathway. These results suggest that some of the proapoptotic and antiangiogenic activities of curcumin in bladder cancer cells are due, in part, to degradation of Sp proteins and Sp-dependent survivin, VEGF and VEGFR1.
In cancer cells and tumors, NFκB regulates expression of prosurvival and angiogenic genes, and the efficacy of several chemotherapeutic agents including curcumin has also been linked to their inhibition of NFκB-mediated responses (35, 11, 16, 17). Inhibition of NFκB by curcumin has been associated with modulation of multiple pathways; however, the effects of curcumin-dependent downregulation of Sp proteins on NFκB has not been determined. p65 and p50/105 are regulated by Sp1 in some cell lines (40, 45), and our results show that concentrations of curcumin that decreased NFκB-dependent activity (≤ 25 µM) did not affect nuclear p65 or p50 levels in KU7 or 253JB-V cells (Fig. 5D). Moreover, in KU7 and 253JB-V cells transfected with the iSp cocktail containing small inhibitory RNAs for Sp1, Sp3 and Sp4, there was also only a minimal decrease in expression of p65 or p50 (Fig. 5B). Curcumin decreased expression of several NFκB-dependent genes including VEGF, survivin, bcl-2 and cyclin D1 (Fig. 2B and Fig. 5C) (24, 26, 28, 29, 3439), and similar results were observed in bladder cancer cells transfected with iSp (Fig. 6A). Since curcumin decreases both Sp proteins and NFκB-dependent transactivation in bladder cancer cells, the role of NFκB in mediating these responses was investigated by p65 and p50 knockdown (Fig. 6B). Only VEGF and bcl-2 were decreased in both cell lines after transfection with small inhibitory RNAs for p65 and p50 (combined). This suggests that curcumin-induced effects on bcl-2, cyclin D1, VEGF and survivin expression are primarily due to Sp downregulation; however, the contribution of Sp proteins and NFκB on regulation of these gene products are gene- and cell context-dependent even though their promoters contain both GC-rich and NFκB elements (24, 26, 28, 29, 3439).
We also examined the in vivo activity of curcumin (50 mg/kg/d) in athymic nude mice bearing KU7 cells as xenografts (Fig. 6D). Curcumin inhibited tumor growth and weight and this corresponded to parallel effects in 253JB-V and KU7 cells (Figs. 1A and 1B) where curcumin inhibited cell proliferation. Moreover, curcumin-induced effects on Sp protein expression in bladder cancer cells (Figs. 3A and 3B) were also observed in bladder tumors (Fig. 6D) demonstrating that curcumin-dependent Sp protein degradation is an integral part of the anticancer activity of this compound in bladder cancer cells and tumors.
In summary, results of this study demonstrate for the first time that curcumin induces proteasome-dependent degradation of Sp1, Sp3 and Sp4 in bladder cancer cell lines, and this is accompanied by decreased expression of Sp-dependent survival and angiogenic proteins. The results suggest that at least some of the important anticancer activities of curcumin may be due, in part, to decreased expression of Sp proteins. A recent study (46) reported that curcumin decreased Sp1 protein expression in pancreatic cancer cells and this was related to increased microRNA-22 which directly targets Sp1 but not Sp3 or Sp4. Since curcumin induces proteasome-dependent degradation of all three Sp proteins in bladder cancer cells, the mechanism of curcumin action clearly differs in pancreatic and bladder cancer cells. Current studies are focused on the cancer cell context-dependent differences in the contributions and mechanisms of action of curcumin-dependent downregulation of Sp proteins on the overall activity of this compound as an anticancer agent.
Supplementary Material
Supplemental 1
Supplemental 2
Acknowledgements
The financial assistance of the National Institutes of Health (ES09106) and the Texas Agricultural Experiment Station and the advice of Dr. Lavania Reddivari are gratefully acknowledged.
Footnotes
This PDF receipt will only be used as the basis for generating PubMed Central (PMC) documents. PMC documents will be made available for review after conversion (approx. 2–3 weeks time). Any corrections that need to be made will be done at that time. No materials will be released to PMC without the approval of an author. Only the PMC documents will appear on PubMed Central -- this PDF Receipt will not appear on PubMed Central.
1. Koehn FE, Carter GT. The evolving role of natural products in drug discovery. Nat Rev Drug Discov. 2005;4:206–220. [PubMed]
2. Butler MS. The role of natural product chemistry in drug discovery. J Nat Prod. 2004;67:2141–2153. [PubMed]
3. Sharma RA, Gescher AJ, Steward WP. Curcumin: the story so far. Eur J Cancer. 2005;41:1955–1968. [PubMed]
4. Aggarwal BB, Shishodia S. Molecular targets of dietary agents for prevention and therapy of cancer. Biochem Pharmacol. 2006;71:1397–1421. [PubMed]
5. Aggarwal BB, Kumar A, Bharti AC. Anticancer potential of curcumin: preclinical and clinical studies. Anticancer Res. 2003;23:363–398. [PubMed]
6. Cheng AL, Hsu CH, Lin JK, et al. Phase I clinical trial of curcumin, a chemopreventive agent, in patients with high-risk or pre-malignant lesions. Anticancer Res. 2001;21:2895–2900. [PubMed]
7. Hayashi S, Watanabe J, Kawajiri K. Genetic Polymorphisms in the 5′-Flanking Region Change Transcriptional Regulation of the Human Cytochrome P450IIE1 Gene. J Biochem (Tokyo) 1991;110:559–565. [PubMed]
8. Sharma RA, McLelland HR, Hill KA, et al. Pharmacodynamic and pharmacokinetic study of oral Curcuma extract in patients with colorectal cancer. Clin Cancer Res. 2001;7:1894–1900. [PubMed]
9. Sharma RA, Euden SA, Platton SL, et al. Phase I clinical trial of oral curcumin: biomarkers of systemic activity and compliance. Clin Cancer Res. 2004;10:6847–6854. [PubMed]
10. Dhillon N, Wolff RA, Abbruzzese JL. Phase II clinical trial of curcumin in patients with advanced pancreatic cancer. J Clin Oncol. 2006;24:14151. (Abstract).
11. Aggarwal S, Ichikawa H, Takada Y, Sandur SK, Shishodia S, Aggarwal BB. Curcumin (diferuloylmethane) down-regulates expression of cell proliferation and antiapoptotic and metastatic gene products through suppression of IκBα kinase and Akt activation. Mol Pharmacol. 2006;69:195–206. [PubMed]
12. Mohan R, Sivak J, Ashton P, et al. Curcuminoids inhibit the angiogenic response stimulated by fibroblast growth factor-2, including expression of matrix metalloproteinase gelatinase B. J Biol Chem. 2000;275:10405–10412. [PubMed]
13. Li L, Aggarwal BB, Shishodia S, Abbruzzese J, Kurzrock R. Nuclear factor-κB and IκB kinase are constitutively active in human pancreatic cells, and their down-regulation by curcumin (diferuloylmethane) is associated with the suppression of proliferation and the induction of apoptosis. Cancer. 2004;101:2351–2362. [PubMed]
14. Li L, Braiteh FS, Kurzrock R. Liposome-encapsulated curcumin: in vitro and in vivo effects on proliferation, apoptosis, signaling, and angiogenesis. Cancer. 2005;104:1322–1331. [PubMed]
15. Anto RJ, Mukhopadhyay A, Denning K, Aggarwal BB. Curcumin (diferuloylmethane) induces apoptosis through activation of caspase-8, BID cleavage and cytochrome c release: its suppression by ectopic expression of Bcl-2 and Bcl-xl. Carcinogenesis. 2002;23:143–150. [PubMed]
16. Kunnumakkara AB, Guha S, Krishnan S, Diagaradjane P, Gelovani J, Aggarwal BB. Curcumin potentiates antitumor activity of gemcitabine in an orthotopic model of pancreatic cancer through suppression of proliferation, angiogenesis, and inhibition of nuclear factor-κB-regulated gene products. Cancer Res. 2007;67:3853–3861. [PubMed]
17. Kamat AM, Sethi G, Aggarwal BB. Curcumin potentiates the apoptotic effects of chemotherapeutic agents and cytokines through down-regulation of nuclear factor-kappaB and nuclear factor-kappaB-regulated gene products in IFN-alpha-sensitive and IFN-alpha-resistant human bladder cancer cells. Mol Cancer Ther. 2007;6:1022–1030. [PubMed]
18. Pae HO, Jeong SO, Jeong GS, et al. Curcumin induces pro-apoptotic endoplasmic reticulum stress in human leukemia HL-60 cells. Biochem Biophys Res Commun. 2007;353:1040–1045. [PubMed]
19. Kuo ML, Huang TS, Lin JK. Curcumin, an antioxidant and anti-tumor promoter, induces apoptosis in human leukemia cells. Biochim Biophys Acta. 1996;1317:95–100. [PubMed]
20. Han SS, Chung ST, Robertson DA, Ranjan D, Bondada S. Curcumin causes the growth arrest and apoptosis of B cell lymphoma by downregulation of egr-1, c-myc, bcl-XL, NF-kappa B, and p53. Clin Immunol. 1999;93:152–161. [PubMed]
21. Aggarwal BB, Shishodia S, Takada Y, et al. Curcumin suppresses the paclitaxel-induced nuclear factor-kappaB pathway in breast cancer cells and inhibits lung metastasis of human breast cancer in nude mice. Clin Cancer Res. 2005;11:7490–7498. [PubMed]
22. Liu Y, Chang RL, Cui XX, Newmark HL, Conney AH. Synergistic effects of curcumin on all-trans retinoic acid- and 1 alpha,25-dihydroxyvitamin D3-induced differentiation in human promyelocytic leukemia HL-60 cells. Oncol Res. 1997;9:19–29. [PubMed]
23. Alakurtti S, Makela T, Koskimies S, Yli-Kauhaluoma J. Pharmacological properties of the ubiquitous natural product betulin. Eur J Pharmacol Sci. 2006 [PubMed]
24. Chintharlapalli S, Papineni S, Ramaiah SK, Safe S. Betulinic acid inhibits prostate cancer growth through inhibition of specificity protein transcription factors. Cancer Res. 2007;67:2816–2823. [PubMed]
25. Abdelrahim M, Baker CH, Abbruzzese JL, Safe S. Tolfenamic acid and pancreatic cancer growth, angiogenesis, and Sp protein degradation. J Natl Cancer Inst. 2006;98:855–868. [PubMed]
26. Abdelrahim M, Baker CH, Abbruzzese JL, et al. Regulation of vascular endothelial growth factor receptor-1 (VEGFR1) expression by specificity proteins 1, 3 and 4 in pancreatic cancer cells. Cancer Res. 2007;67:3286–3294. [PubMed]
27. Higgins KJ, Abdelrahim M, Liu S, Yoon K, Safe S. Regulation of vascular endothelial growth factor receptor-2 expression in pancreatic cancer cells by Sp proteins. Biochem Biophys Res Commun. 2006;345:292–301. [PubMed]
28. Abdelrahim M, Smith R, III, Burghardt R, Safe S. Role of Sp proteins in regulation of vascular endothelial growth factor expression and proliferation of pancreatic cancer cells. Cancer Res. 2004;64:6740–6749. [PubMed]
29. Abdelrahim M, Samudio I, Smith R, Burghardt R, Safe S. Small inhibitory RNA duplexes for Sp1 mRNA block basal and estrogen-induced gene expression and cell cycle progression in MCF-7 breast cancer cells. J Biol Chem. 2002;277:28815–28822. [PubMed]
30. Safe S, Abdelrahim M. Sp transcription factor family and its role in cancer. Eur J Cancer. 2005;41:2438–2448. [PubMed]
31. Nicolas M, Noe V, Jensen KB, Ciudad CJ. Cloning and characterization of the 5′-flanking region of the human transcription factor Sp1 gene. J Biol Chem. 2001;276:22126–22132. [PubMed]
32. Tapias A, Monasterio P, Ciudad CJ, Noe V. Characterization of the 5′-flanking region of the human transcription factor Sp3 gene. Biochim Biophys Acta. 2005;1730:126–136. [PubMed]
33. Khan S, Wu F, Liu S, Wu Q, Safe S. Role of specificity protein (Sp) transcription factors in estrogen-induced gene expression in MCF-7 breast cancer cells. J Mol Endocrinol. 2007;39:289–304. [PubMed]
34. Li F, Altieri DC. Transcriptional analysis of human survivin gene expression. Biochem J. 1999;344(Pt 2):305–311. [PubMed]
35. Li Y, Xie M, Yang J, et al. The expression of antiapoptotic protein survivin is transcriptionally upregulated by DEC1 primarily through multiple sp1 binding sites in the proximal promoter. Oncogene. 2006;25:3296–3306. [PubMed]
36. Wu J, Ling X, Pan D, et al. Molecular mechanism of inhibition of survivin transcription by the GC-rich sequence-selective DNA binding antitumor agent, hedamycin: evidence of survivin down-regulation associated with drug sensitivity. J Biol Chem. 2005;280:9745–9751. [PMC free article] [PubMed]
37. Finkenzeller G, Sparacio A, Technau A, Marme D, Siemeister G. Sp1 recognition sites in the proximal promoter of the human vascular endothelial growth factor gene are essential for platelet-derived growth factor-induced gene expression. Oncogene. 1997;15:669–676. [PubMed]
38. Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS., Jr NF-κB controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol. 1999;19:5785–5799. [PMC free article] [PubMed]
39. Ma Q, Li X, Vale-Cruz D, Brown ML, Beier F, LuValle P. Activating transcription factor 2 controls Bcl-2 promoter activity in growth plate chondrocytes. J Cell Biochem. 2007;101:477–487. [PubMed]
40. Yurochko AD, Mayo MW, Poma EE, Baldwin AS, Jr, Huang ES. Induction of the transcription factor Sp1 during human cytomegalovirus infection mediates upregulation of the p65 and p105/p50 NF-κB promoters. J Virol. 1997;71:4638–4648. [PMC free article] [PubMed]
41. Arbiser JL, Klauber N, Rohan R, et al. Curcumin is an in vivo inhibitor of angiogenesis. Mol Med. 1998;4:376–383. [PMC free article] [PubMed]
42. Yamamoto Y, Gaynor RB. Therapeutic potential of inhibition of the NF-κB pathway in the treatment of inflammation and cancer. J Clin Invest. 2001;107:135–142. [PMC free article] [PubMed]
43. Aggarwal BB. Nuclear factor-kappaB: the enemy within. Cancer Cell. 2004;6:203–208. [PubMed]
44. Bae JH, Park JW, Kwon TK. Ruthenium red, inhibitor of mitochondrial Ca2+ uniporter, inhibits curcumin-induced apoptosis via the prevention of intracellular Ca2+ depletion and cytochrome c release. Biochem Biophys Res Commun. 2003;303:1073–1079. [PubMed]
45. Gu L, Findley HW, Zhou M. MDM2 induces NF-κB/p65 expression transcriptionally through Sp1-binding sites: a novel, p53-independent role of MDM2 in doxorubicin resistance in acute lymphoblastic leukemia. Blood. 2002;99:3367–3375. [PubMed]
46. Sun M, Estrov Z, Ji Y, Coombes KR, Harris DH, Kurzrock R. Curcumin (diferuloylmethane) alters the expression profiles of microRNAs in human pancreatic cancer cells. Mol Cancer Ther. 2008;7:464–473. [PubMed]