PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Development. Author manuscript; available in PMC 2008 October 7.
Published in final edited form as:
PMCID: PMC2562748
NIHMSID: NIHMS54938

Requirement for Foxd3 in Maintenance of Neural Crest Progenitors

Summary

Understanding the molecular mechanisms of stem cell maintenance is critical for the ultimate goal of manipulating stem cells for treatment of disease. Foxd3 is required early in mouse embryogenesis; Foxd3−/− embryos fail around the time of implantation, cells of the inner cell mass cannot be maintained in vitro, and blastocyst-derived stem cell lines cannot be established. Here, we report that Foxd3 is required for maintenance of the multipotent mammalian neural crest. Using tissue specific deletion of Foxd3 in the neural crest, we show that Foxd3flox/; Wnt1-Cre mice die perinatally with a catastrophic loss of neural crest-derived structures. Cranial neural crest tissues are either missing or severely reduced in size, the peripheral nervous system consists of reduced dorsal root ganglia and cranial nerves, and the entire gastrointestinal tract is devoid of neural crest derivatives. These results demonstrate a global role for this transcriptional repressor in all aspects of neural crest maintenance along the anterior-posterior axis, and establish an unprecedented molecular link between multiple divergent progenitor lineages of the mammalian embryo.

Keywords: Neural crest, Foxd3, mouse embryo, stem cell maintenance

Introduction

The neural crest (NC) are multipotent progenitor cells possessing the unique ability to contribute to a variety of disparate adult derivatives: the entire peripheral and enteric nervous systems (PNS and ENS), bones and connective tissue of the head and neck, and the outflow tract of the developing heart among others. NC cells emigrate from the dorsal neural tube during early embryogenesis and migrate to final sites of differentiation. Their fate depends on their rostral-caudal position of origin in the neural tube, their route of migration and final destination (reviewed in Le Douarin and Kalcheim, 1999). Many of the cellular mechanisms critical to development of an embryo are represented within this extraordinary tissue: specification of cell type, maintenance of multipotency of progenitor cells, directed migration of cells to their final destination and terminal differentiation of cells. Members of the PDGF, BMP and Wnt families of secreted molecules are important for the initial specification and subsequent maintenance of the NC (reviewed in (Steventon et al., 2005). And many transcription factors are activated in NC in response to these signaling cascades. These include Foxd3, Sox8, 9 and 10 (Cheung and Briscoe, 2003); (Southard-Smith et al., 1998), Ap2 (Schorle et al., 1996), Pax3 (Epstein et al., 1991), and others. It is not yet clear how these factors work together to induce and then maintain this unique cell type.

The Foxd3 gene encodes a transcriptional repressor of the winged helix or “Forkhead” family of proteins (Labosky and Kaestner, 1998; Sutton et al., 1996). This large family of proteins is characterized by a 100 amino acid DNA-binding domain and transcriptional activation or repression domains (reviewed in Labosky and Kaestner, 2005; Wijchers et al., 2006). Foxd3 was first characterized by its expression in embryonic stem cells (ES cells) and multipotent cells of the NC (Labosky and Kaestner, 1998). Our previous work demonstrated that Foxd3 is required early in mouse embryogenesis; Foxd3−/− embryos fail around the time of implantation, cells of the inner cell mass cannot be maintained in vitro, and ES cell and trophoblast stem cell lines cannot be established (Hanna et al., 2002; Tompers et al., 2005). In vivo, the pool of both embryonic and trophoblast progenitors is not maintained without Foxd3; embryonic progenitor cells die while trophoblast progenitors give rise to an excess of trophoblast giant cells at the expense of the remaining trophoblast lineage. However, the ultimate effect in both cases is that the progenitor pool is not maintained and the cell lineage is lost.

Foxd3 is one of the earliest molecular markers of the NC lineage, it is expressed in multiple species in premigratory and migrating NC and expression is downregulated as the cells differentiate into most derivatives (Dottori et al., 2001; Labosky and Kaestner, 1998). Ectopic expression of Foxd3 in chick neural tube and Xenopus embryos can specify NC cell fate as measured by upregulation of HNK-1 and Slug (Dottori et al., 2001; Kos et al., 2001; Sasai et al., 2001). In addition, maintained expression of Foxd3 in migrating NC interferes with differentiation and retains NC in an undifferentiated state, evidence that points to a potential role for Foxd3 in the control of stem cell self-renewal (Dottori et al., 2001). Morpholino knockdown of zebrafish Foxd3 and mutations that affect Foxd3 expression in the zebrafish NC have deleterious effects on maintenance of the NC (Lister et al., 2006; Montero-Balaguer et al., 2006; Stewart et al., 2006).

Because the deletion of Foxd3 results in embryonic lethality around the time of implantation, we employed Cre-loxP technology to delete the Foxd3 coding region specifically in NC. Here we demonstrate that without this transcriptional regulator the NC lineage fails to be maintained resulting in catastrophic loss of most NC derivatives. Mutant mice perish at birth with a cleft face, the PNS is severely reduced, and the ENS is not formed. Surprisingly, however, while the cardiac NC is greatly reduced early in embryogenesis, by midgestation most cardiac NC derivatives are normal with subtle defects in a small percentage of mutant embryos. We show that the mechanism of cellular loss of most of the NC is by a failure to maintain the progenitor pool as much of the premigratory and early migrating NC undergoes cell death. Cells that survive are able to migrate and differentiate normally but cannot completely compensate for the early loss of progenitors. Our data demonstrate that Foxd3 is required for maintenance of NC progenitor cells and taken together with our previous work, places Foxd3 in the unique role of maintaining the undifferentiated multipotent state of three completely divergent progenitor populations of the early mammalian embryo.

Materials and Methods

Construction of Foxd3 floxP Targeting Vector

A 1.2Kb fragment of the Foxd3 locus was inserted into the EcoR1 site of pPNT4 downstream of the Frt-flanked Neo gene to serve as the 3′ homology arm. An oligonucleotide containing the loxP recognition sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT) was inserted 5′ of the Foxd3 coding region. Upstream, a 4.2kb fragment of the Foxd3 locus was inserted to complete the 5′ homology arm to generate the final targeting vector shown in Fig. 1A.

Figure 1
Generation of a NC specific deletion in Foxd3

ES Cell Electroporation and Generation of Mice

TL1 ES cells were electroporated as described (Tompers and Labosky, 2004). ES cell DNA was analyzed using Southern blot as shown in Fig. 1A and B. Lines were screened by PCR for the presence of the 5′ loxP site. We identified three correctly recombined cell lines out of 337 (0.9% frequency). Chimeras were generated by blastocyst injection and offspring of chimeras genotyped to identify heterozygous founders. Two independent cell lines transmitted through the germ line and because both showed the identical phenotype we restricted our studies to one cell line. Mice were genotyped either by Southern blot or PCR with the following primers: 5′CGGCTTTCTTTCGGGGGAC3′ and 5′ACATATCGCTGGCGCTGCCG3′ to give a 130bp band for the wild type allele and a 220bp band for the floxed allele.

Mouse Strains

Foxd3tm2.Lby is a null mutation of Foxd3 generated previously (Hanna et al., 2002) and is referred to as Foxd3 throughout. Wnt1-Cre mice were a generous gift of Drs. Andrew McMahon and David Rowitch. In the reporter strain Gt(ROSA)26Sortm1Sor (referred to as ROSA26R) Cre expression results in removal of a loxP-flanked DNA segment that prevents expression of a lacZ gene. After Cre activation, lacZ is detected in cells/tissues where Cre is expressed. The transgenic line EIIaCre (Tg(EIIa-cre)C5379Lmgd from The Jackson Laboratories) carries a Cre transgene under control of the adenovirus EIIa promoter that targets expression of Cre recombinase to the early mouse embryo and acts as a ubiquitous deletor strain for our purposes. The presence of Cre was detected with primers: 5′TGATGAGGTTCGCAAGAACC3′ and 5′CCATGAGTGAACGAACCTGG 3′ producing a band size of 400bp. All mouse strains were maintained on an outbred mixed genetic background that is primarily CD-1 and C57BL/6. Animals were maintained in accordance with the rules of the University of Pennsylvania and Vanderbilt University Institutional Animal Care and Use Committee (IACUC).

Histology and whole mount in situ hybridization

Histology was performed using standard procedures (Presnell and Schreibman, 1997). For frozen sections (beta-galactosidase antibody only) embryos were fixed in 4% PFA in PBS overnight, equilibrated in 30% sucrose overnight and embedded in OCT. Sections were cut at 10 microns. For whole-mount LysoTracker staining, embryos were dissected in Hanks’ buffer, and incubated in 5 hM LysoTracker (Molecular Probes) at 37°C for 1 hour. Embryos were then washed in Hanks’ buffer and fixed in 4% PFA in PBS overnight, washed in PBS and dehydrated in methanol before imaging with a fluorescent stereoscope. TUNEL assay was performed in paraffin sections using the In Situ Cell Death Detection Kit (Roche). Whole-mount immunostaining was performed as described (Wall et al., 1992). Skeletal preparations and 5-bromo-4-chloro-3-indolyl -D-galactoside (Xgal) staining followed standard techniques (Nagy et al., 2003). For histological analysis, paraffin sections (7–12 microns) were counter-stained with eosin.

The following antibodies were used: rabbit-anti-Foxd3 at 1:1000 (Tompers et al., 2005); mouse-anti-PGP9.5 at 1:100 (Biogenesis), mouse-anti-neurofilament (2H3 monoclonal) at 1:1000 (Developmental Studies Hybridoma Bank), mouse-anti-beta III tubulin (Tuj1) at 1:100 (Chemicon), rabbit-anti-phosphohistone H3 at 1:200 (Upstate Biotechnology), goat-anti-FABP7 (also known as BFABP) at 1:20 (R&D), goat-anti-rabbit-Cy3, goat-anti-mouse-Cy3 and donkey-anti-goat-Cy2 (Jackson ImmunoResearch Laboratories). The Vectastain ABC kit (Vector Laboratories) was used to detect the non-fluorescent secondary antibodies and DAPI (1:5000 from Molecular Probes) was used to highlight nuclei.

Whole mount in situ hybridization was performed using Costar 12-well inserts following standard protocols (Hanna et al., 2002). Probes for Crabp (Stoner and Gudas, 1989), Dlx1 (Dolle et al., 1992), Msx1 (Satokata and Maas, 1994), Pdgfa (Mercola et al., 1990), Pdgfc (Ding et al., 2000), and Sox10 (Southard-Smith et al., 1998) were as described. Digoxigenin labeled RNA probes were prepared using reagents from Roche Molecular Biochemicals.

Corrosion casting was performed as described (Feiner et al., 2001) by injecting the left ventricle of embryonic or newborn hearts first with PBS and then with polymer containing red pigment using gentle pressure (Polysciences #07349). Polymer containing blue pigment was injected into the right ventricle to monitor for possible ventricular septal defects (VSD). The casts cured overnight at 4 °C and surrounding tissue was macerated (Polysciences #07359) at 50 °C for 6–8 h.

Results

Conditional Deletion of the Foxd3 Locus in NC

A targeting vector was designed so that after homologous recombination in ES cells the Foxd3 coding region (Fig. 1A purple box) would be flanked with loxP sequences (Fig. 1A orange triangles). Correctly targeted ES cells were used to generate mice carrying a Foxd3flox allele. Mice carrying two Foxd3flox alleles (Foxd3flox/flox mice) appeared normal and healthy. To test whether Cre-mediated deletion of the Foxd3 locus produced a null allele efficiently, we crossed Foxd3flox/flox mice with Foxd3flox/+; EIIa-Cre mice. Timed pregnant females from this cross were dissected at 6.5 days post coitum (dpc) and 25% of the resulting embryos had a phenotype identical to the original loss of function allele (data not shown). There was no difference in results observed with or without the neo selection cassette (data not shown).

To selectively delete Foxd3 in the NC, we used the well-characterized Wnt1-Cre transgenic mouse line in which Cre recombinase is expressed in migrating NC starting at 8.0–8.5 dpc (Danielian et al., 1998). We used reciprocal matings between Foxd3flox/flox and Foxd3+/; Wnt1-Cre mice to obtain Foxd3flox/; Wnt1-Cre (mutant) embryos. At the four-somite stage (~8.0 dpc), Foxd3 protein is detected in migrating NC in the head folds (Fig. 1D). In contrast, we see a severe reduction in Foxd3 protein in head folds of mutant embryos, detecting only one or two cells that are weakly positive for Foxd3 protein expression (Fig. 1E, arrow). By 9.5 dpc, no Foxd3 protein is detected in the mutant dorsal neural tube or migratory path of NC (compare Fig. 1F and G). Foxd3 expression is not maintained in the facial mesenchyme at 13.5 dpc, expression is limited to forming cranial ganglia (Fig. 1H) and this expression is missing in mutant embryos. In the ENS, Foxd3 protein is expressed in the gut coils at 13.5 dpc and is missing in mutant embryos (Fig. 1J-K). These results demonstrate that Foxd3 is deleted specifically in the NC by Wnt1-Cre.

Maintenance of Cranial NC is Dependent on Foxd3

Initially, litters were allowed to progress to term and no mutant mice were found at weaning (21 days). However, we found one dead mutant newborn pup (pictured in Fig. 2A) and began monitoring litters before the mice were born (Table 1). While the majority of 18.5 dpc littermates appeared normal and could survive being delivered by a caesarian section, the mutant mice attempted to breathe several times but then expired. Table 1 summarizes the number of offspring and embryos from both Foxd3flox/+ × Foxd3+/; Wnt1-Cre and Foxd3flox/flox × Foxd3+/; Wnt1-Cre crosses. Embryos were found in the expected ratios at all times in development and no mutant mice survived more than a few hours.

Figure 2
Craniofacial dysmorphogenesis, skeletal abnormalities and PA malformations in Foxd3flox/; Wnt1-Cre mice and embryos

All mutant mice had a severe cleft face and palate incompatible with survival and their inability to breathe is presumably the cause of their death immediately after birth. These defects occurred with 100% penetrance although the width of the cleft sometimes varied in size. Nostrils and whisker pads were present but the facial midline never fused and the eyelids were partially open. Much of the skull vault is derived from cranial NC so we analyzed skeletons using Alcian Blue and Alizarin Red staining. Comparison of the control and mutant skulls in Fig. 2B revealed that the frontalnasal bone and nasal cartilage were missing in the mutants and the interparietal, parietal and basal occipital bones were greatly reduced in size. The maxilla and premaxila were shortened and the mandible was shortened and thickened. These cranial defects were obvious at midgestation stages (Fig. 2C).

To monitor NC and their derivatives, we introduced the ROSA26R (R26R) conditional reporter allele into the mutant background (Soriano, 1999). Upon expression of Cre protein, all cells and their descendants transcribe the lacZ gene, and therefore NC cell fate can be monitored directly with and without Foxd3 function. Note that we are comparing Foxd3flox/; Wnt1-Cre; R26R (mutant) embryos to Foxd3flox/+; Wnt1-Cre; R26R (control) embryos so that the Cre protein will be recombining two sets of loxP sites; one to delete the Foxd3 coding region and one to delete the stop sequence in the ROSA26 locus. Xgal-positive tissue is present in the frontalnasal mesenchyme in both control and mutant embryos indicating that NC cells contribute to these tissues in the absence of Foxd3 (Fig 2D, Sup. Fig 3).

Figure 3
Pharyngeal Arch Defects in Foxd3flox/; Wnt1-Cre embryos

Pharyngeal Arch Defects

At 9.5 dpc, a comparison of lineage-mapped embryos revealed that NC have migrated into pharyngeal arches (PA) 1 and 2 in both mutants and controls (Fig. 3A). However, by 10.5 dpc morphological differences in the PAs were apparent by SEM (Fig. 3B). The maxillary and the mandibular prominences of PA1 were present but reduced in size. There is a striking decrease of NC in PA 3 and 4. Immunohistochemistry for Neurofilament protein showed all cranial ganglia and nerves are present but smaller than normal. Some cranial nerves are slightly misdirected (the glossopharyngeal nerve in Fig. 3C) or have not extended as far as the control (the facial and vestibulocochlear nerves). Spinal nerves along the trunk of the mutant embryos were thinner. Examining expression of Sox10, a marker of early NC, revealed reduced expression in the developing trigeminal, facial and vestibulocochlear ganglia and no expression in the glossopharyngeal and vagus ganglia. Sox10 expression was also reduced along the trunk of the embryo (Fig. 3D). Expression of other NC specific genes in the PAs uniformly showed reduced expression in PA 1 and 2 (Sup. Fig. 1). Together, these data suggest that the initial specification of NC occurs, but there is an overall failure to maintain NC progenitors as demonstrated by a loss of PA-derived structures and a concomitant decrease in expression of NC specific genes.

Reduction of Peripheral Nervous System and Loss of Enteric Nervous System

NC migrate into the limbs during development giving rise to neurons, Schwann cells and terminal glia cells. Cutaneous nerves and the developing sciatic nerve are highlighted in a hindlimb from a 14.5 dpc control embryo by Xgal lineage staining (Fig. 4A). All of these NC-derived cells are missing in the mutant embryos (Fig. 4B). A dorsal view of the same pair of embryos reveals the segmented pattern of spinal nerves exiting the dorsal root ganglia (DRG) and projecting ventrally in the control (Fig. 4C); the spinal nerves are absent in mutant embryos (Fig. 4D).

Figure 4
Peripheral and Enteric Nervous System Defects in Foxd3flox/; Wnt1-Cre embryos

NC that migrate ventrally from the dorsal neural tube contribute to the ENS: the neurons and glia that innervate the entire gastrointestinal tract. Using the ROSA26R reporter allele, NC contribution to the ENS is easily visualized. In control midgestation embryos (14.5 dpc) the intestines are ensheathed in a plexus of NC-derived Xgal-positive cells while in a mutant littermate the gut is completely lacking these cells (Fig. 4E and F). When the gastrointestinal tract is dissected out of a 17.5dpc embryo, the control sample is surrounded in X-gal-positive cells along the entire anterior to posterior axis while the mutant sample has no NC-derived cells around the outside of the gut tube (Fig. 4G and H). Expression of PGP9.5 is readily detectable in neurons of the ENS in control embryos; there are no PGP9.5-positive cells in mutant embryos (Fig. 4I and J). Similar results were obtained with Tuj1 antiserum to detect neurons and FABP7 antiserum to detect glia (data not shown).

Subtle Cardiac Neural Crest Defects

NC from the mid-otic placode to somite 4 migrate through rhombomeres 6–8, into PAs 3, 4 and 6, contributing to the aortic arch arteries and the aorticopulmonary septum of the cardiac outflow tract. In control embryos, NC enter PAs 3,4 and 6 (Fig 3A) and the developing heart field by 9.5 dpc (Fig. 5A arrows) and continue migrating at 10.5 dpc (Fig. 5B). We observed a striking decrease in the cardiac NC of mutant embryos. Fewer cells entered the heart field at 9.5 dpc (Fig. 5C). At 10.5 dpc, there is a paucity of NC in mutant PAs (Fig. 5D, arrow) and greatly reduced number of cells entering the heart (Fig. 5D, arrowhead).

Figure 5
Deletion of Foxd3 in the NC has subtle infrequent effects on heart development

To further investigate development of the cardiac NC we examined patterning of vascular NC derivatives using corrosion casting (Fig 5 E–H). We observed normal patterning of the aortic arch in the majority of Foxd3 mutants (13/17, 76%) between 15.5 dpc until birth. However, in 3 out of 17 Foxd3 mutant embryos examined, we observed a duplication of the left common carotid artery (Fig 5 G and G′). One mutant embryo had severe cardiac NC defects including type A2 persistent truncus arteriosis (PTA) in which the septation of the outflow tract did not occur and the ductus arteriosis was absent (Fig 5H-H′) (Van Praagh and Van Praagh, 1965). We examined the NC lineage in both control and mutant embryos with the ROSA26R reporter allele and saw no differences in NC contribution to the cardiovascular system at 17.5 dpc (n = 7 mutants, Sup. Fig. 2). Histological analysis of eight mutant and control littermates was performed and no septal defects were observed (Sup. Fig. 2), however, while in the process of performing resin casts, 1/17 (the sample shown in Fig. 5H) displayed a ventricular septal defect.

NC Cell Migration, Differentiation, Death, and Proliferation

NC must maintain a delicate balance of proliferation and migration, and timing of differentiation is crucial for their final tissue contributions in the adult. Lineage tracing revealed that DRGs were formed (Fig. 6A and B) but were smaller than normal. The size of the DRGs varies with the angle of section, but in whole mount, mutant DRGs are consistently smaller than controls (Fig. 3A). However, a more ventral field of the same region revealed that while control NC enter the foregut to eventually populate the ENS (Fig. 6C), mutant NC are fewer in number and halt their migration near the dorsal aorta in a position consistent with the final location of sympathetic ganglia (Fig. 6D). No mutant NC enter the developing gut anywhere along the anterior-posterior axis.

Figure 6
Cell migration, survival and proliferation effects

Terminal differentiation of NC occurs as cells reach their final destination. We detected expression of neural and glial markers in control and mutant DRGs. At 9.5 and 14.5 dpc, the neural marker beta III tubulin and the glial marker FABP7 (also called B-FABP) are expressed in both control and mutant DRGs (Fig. 6E–H and data not shown).

We examined cell death in control and mutant embryos and detected an increase in TUNEL-positive apoptotic cells in the dorsal spinal cord while there were few, if any, TUNEL-positive cells in the spinal cord of control embryos (Fig. 6I and J). Confirming this with LysoTracker® Red dye, at 9.0 dpc, mutant embryos showed increased apoptosis in the hindbrain and by 10.5 dpc, apoptosis was more pronounced in the posterior tail of the embryo (Figure 6 K-N). The absence of apoptosis in distal PAs of mutant embryo at 10.5 dpc (Fig 6M) is likely due to the large deficit in NC cell numbers (note morphology of PAs in Fig. 6M and lineage label in Fig. 3B).

To more closely examine the curious recovery of most of the cardiac derivates we analyzed cell proliferation in the cardiac NC using a combination of lineage labeling and immunohistochemistry for phosphorylated histone H3 protein indicating cells in mitosis. Septation is complete by 13.0 dpc so we chose to examine embryos at 12.5 dpc (Hiruma et al., 2002). Representative sections of 12.5 dpc control and mutant embryos are shown in Fig. 6 O-R clearly demonstrating the paucity of NC present in the outflow tract at most rostral and caudal levels. The volume of the outflow tract control and mutant embryos was calculated as 4 mm3 and 0.7 mm3, respectively. The proportion of pH3-positive NC cells was not different between controls and mutants (details in Sup. Fig. 3). These results suggest that although loss of Foxd3 reduced the number of cardiac NC, these cells are still able to pattern the outflow tract and give rise to smooth muscle cells.

Discussion

NC Specification

Previous data from several laboratories has demonstrated that ectopic expression of Foxd3 in the neural tube can change the fate of the neuroepithelium into NC (Cheung et al., 2005; Dottori et al., 2001; Kos et al., 2001; Sasai et al., 2001). However, our loss-of-function analysis suggests that Foxd3 is not required for the initial specification of the NC. In Foxd3flox/; Wnt1-Cre mutant embryos, we do not detect cells expressing Foxd3 at the earliest stages of NC specification (Fig. 1D–G) yet there are still NC present (Fig. 3). There remains the possibility that the Wnt1-Cre transgene does not produce Cre protein early enough and there may be a few Foxd3 expressing cells present, but if so, our data show that they are not maintained. It is more likely that the role of Foxd3 is in maintaining the NC, not in specifying this cell type.

Our findings do not completely agree with those of other model systems, highlighting differences between Xenopus, chick, zebrafish and mouse NC. Ectopic expression of a dominant negative FoxD3 in Xenopus embryos suppresses NC specification as measured by the loss of NC marker expression (Sasai et al., 2001). Electroporation of antisense oligonucleotides specific to Foxd3 in the chick bias the differentiation of NC towards the melanocyte lineage (Kos et al., 2001). There are three recent reports of mutations in the zebrafish Foxd3 locus or knockdown of Foxd3 using morpholinos (Lister et al., 2006; Montero-Balaguer et al., 2006; Stewart et al., 2006). These groups reported that NC was specified normally with a general downregulation of NC markers similar to what we have observed. Craniofacial defects were highlighted by jaw abnormalities in the fish while defects in the mandible of our mice were minor. All three groups demonstrated a complete loss of DRGs while we see smaller DRGs that contain neurons and glia. Similar to what we observe, in all cases the zebrafish ENS was lost and increased cell death in the NC lineage was observed along with defects in migration. Zebrafish are an ideal system to monitor changes in different types of NC melanocytes and all three groups described lineage specific differences in these derivatives. For example, in the Mother Superior mutation, which is a mutation somewhere outside the coding region that affects only NC expression of Foxd3, melanophores are delayed in their development but then recover while iridophores remain greatly reduced (Montero-Balaguer et al., 2006). Zebrafish cardiac NC contributes primarily to the myocardial cell lineage (Li et al., 2003). Despite this, only one group reported a slight edema in the heart in Foxd3 mutants (Montero-Balaguer et al., 2006).

NC Patterning

We did not detect anterior-posterior patterning defects in NC although caudal NC was most severely affected. All mutant embryos had severe facial clefting and were missing many NC-derived facial bones. However, the mandible was present in all mutants examined. It was shortened and thickened similar to Dlx5−/− mice (Acampora et al., 1999), but its presence demonstrates that Foxd3−/− NC can differentiate into cartilage and bone and overt cranial patterning is unaltered. Similarly, trunk NC were present in reduced numbers, but those cells migrated away from the neural tube normally and formed small DRGs that contained both neurons and glia.

In contrast, the vagal and sacral NC destined to contribute to the ENS did not migrate to the gut. There are several possibilities for the loss of this sub-lineage of NC. One hypothesis is that there may be expression of closely related Fox genes in the cranial and cardiac NC but no such compensating family members expressed in the trunk NC caudal to somite 7. A second hypothesis is that ENS progenitors underwent selective cell death in the dorsal neural tube while NC destined to populate the DRGs were maintained. There are no molecular markers to distinguish these lineages prior to migration so we cannot test this hypothesis directly. A third possibility is that NC that underwent apoptosis in the dorsal neural tube were unspecified and the selective loss of the ENS-NC is because this lineage must migrate farther than others. Therefore a general loss in progenitor cell number might affect the ENS-crest more severely. A fourth possibility is that Foxd3/ NC might not be able to enter the foregut (Fig. 6C compared to D). It has been demonstrated that vagal and sacral NC, unlike the rest of the trunk NC, possess a unique ability to enter the gut mesentery (Serbedzija et al., 1991). Recent studies suggest this difference might be at least partially explained by the expression of axon guidance molecules Slit and Robo on vagal NC (De Bellard et al., 2003). In contrast to our results, mice lacking members of the glial cell line-derived neurotrophic factor signaling pathway have enteric neurons in the anterior ENS (Cacalano et al., 1998; Pichel et al., 1996; Sanchez et al., 1996) while mutations in Endothelin-3 or Endothelin Receptor B cause the loss of ENS only in the distal colon (Baynash et al., 1994; Hosoda et al., 1994). In Phox2b−/− embryos, there is an initial migration of vagal NC into the proximal gut mesentery, but these progenitors are not maintained leaving the entire gut without innervation (Pattyn et al., 1999). In fact, the only other mouse model lacking the entire ENS is Sox10Dom/Dom (Kapur, 1999; Southard-Smith et al., 1998) and it is interesting to note that Sox10 is one of the genes severely downregulated in Foxd3/ mutant embryos (Fig. 3C arrowheads). One final hypothesis, not mutually exclusive of those suggested above, is that while Foxd3 appears to be equally expressed throughout the early premigratory crest, it might be differentially required in specific subpopulations of the crest.

Our surprising results showing the minimal phenotype of the mutant cardiac NC supports this last hypothesis. The cardiac crest normally migrates into PA 3, 4 and 6, eventually contributing to the cardiac outflow tract and the aorticopulmonary septum. There is a striking reduction of cardiac NC in PA 3, 4 and 6 in mutant embryos compared to controls (Figs 3A and 5 A–D). However, this greatly reduced population of cardiac NC migrates into the heart field and even though there are far fewer cells (mutants contained 18% the volume of NC compared to controls by lineage label), this reduced number can effectively septate the outflow tract in most cases. We did not observe alterations from the wild type pattern of proliferation as monitored by phosphorylated histone 3 protein at 9.5 dpc. This suggests that the extent of migration of the cardiac NC, rather than the number of cardiac NC cells, is crucial for their ability to effectively septate the outflow tract. One of our future goals is to understand molecular differences between the cardiac NC, which can overcome the loss of Foxd3, and the rest of the NC lineage that is dependent on this transcription factor.

Conservation of Foxd3 function in progenitor cells

Development of all embryonic tissues relies on progenitor cells that are able to self-renew and differentiate appropriately. Our initial description of the Foxd3/ phenotype demonstrated that this protein is required for maintenance of epiblast cells and therefore required for establishing ES cells (Hanna et al., 2002). Foxd3 is similarly required in the trophoblast progenitor lineage (Tompers et al., 2005), a lineage completely disparate from the embryonic one primarily affected in the null mutation. Therefore, the NC is the third multipotent lineage that requires Foxd3 for maintenance of progenitor cells, making an unprecedented molecular connection between these three distinct progenitor populations. These lineages are embryonically-derived and we have yet to demonstrate that Foxd3 can play a similar role in adult-derived stem cells. However, our results support the premise that certain self-renewal mechanisms are likely to be conserved in very different progenitor lineages. There are several other proteins known to regulate multiple progenitor lineages. Bmi1 and other polycomb proteins repress genes that induce cell death in the hematopoetic lineages, neural stem cells, NC stem cells and cancer stem cells (reviewed in (Pardal et al., 2005). Most recently, the transcription factor Zfx is required for self-renewal of ES cells and maintenance of adult hematopoietic stem cells (Galan-Caridad et al., 2007). The proto-oncogene c-Myc has a well documented role in cell proliferation; recent work in Xenopus suggests it may be involved in NC formation while genetic studies in the mouse show that a NC deletion of Myc results in a relatively mild phenotype (Bellmeyer et al., 2003; Wei et al., 2007). In addition to its role in NC development, expression of Myc along with several other “stem cell proteins” is sufficient to change the fate of somatic cells into pluripotent stem cells (Takahashi and Yamanaka, 2006). Finally, Sox2 is required in ES cells, TS cells and embryonic neural lineages (Avilion et al., 2003; Graham et al., 2003). Sox2 is also expressed in early migrating NC, in Schwann cells (Larysa Pevny, personal communication) and in the postnatal ENS (Vohra et al., 2006), all regions competent to give rise to NC stem cells. The role of Sox2 in the NC has not been investigated, and it is tempting to speculate that there may be a genetic interaction between Foxd3 and Sox2.

It is not clear how Foxd3 functions to maintain these progenitor pools. The protein can function as either an activator or a repressor in different contexts; in Xenopus mesoderm induction, Foxd3 recruits Groucho4 to repress target genes (Steiner et al., 2006; Yaklichkin et al., 2007) while in zebrafish somite maturation, Foxd3 activates Myf5 expression directly (Lee et al., 2006). We can not rule out that Foxd3 may behave similarly to Foxa proteins in modifying chromatin structure to allow access for other co-repressors or activators to target genes (Cirillo et al., 2002). Our major challenges ahead are to identify Foxd3 target genes and to determine the signaling pathways in which the protein functions.

Supplementary Material

Sup Fig legend

Sup Figure 1

Sup Figure 2

Sup Figure 3

Acknowledgments

The authors would like to thank Jonathan Epstein, Chris Brown and Diego Porras for analysis of the cardiac defect, Larysa Pevny for communicating unpublished data, Andrew McMahon and David Rowitch for providing Wnt1-Cre mice, Bruce Appel for use of his fluorescent stereomicroscope for imaging Lysotracker staining, Monika Kumanova for blastocyst injection and Alison LeGrone, Rachel Klein, Shang-Jui Wang and Jessica Yuan for technical help. Thanks to Marianne Bronner-Fraser, Brigid Hogan, Rulang Jiang, Randy Johnson, Moisés Mallo and Philippe Soriano for in situ probes. Thanks also to Leigh Compton, Brian Nelms, Jean-Pierre Saint-Jeannet, Vivian Siegel, Michelle Southard-Smith and Chris Wright for their thoughtful comments on the manuscript. This work was supported by grants from the American Heart Association and the NIH (HD36720) to PAL and an AHA predoctoral fellowship to NAM.

References

  • Acampora D, Merlo GR, Paleari L, Zerega B, Postiglione MP, Mantero S, Bober E, Barbieri O, Simeone A, Levi G. Craniofacial, vestibular and bone defects in mice lacking the Distal-less-related gene Dlx5. Development. 1999;126:3795–809. [PubMed]
  • Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 2003;17:126–40. [PubMed]
  • Baynash AG, Hosoda K, Giaid A, Richardson JA, Emoto N, Hammer RE, Yanagisawa M. Interaction of endothelin-3 with endothelin-B receptor is essential for development of epidermal melanocytes and enteric neurons. Cell. 1994;79:1277–85. [PubMed]
  • Bellmeyer A, Krase J, Lindgren J, LaBonne C. The protooncogene c-myc is an essential regulator of neural crest formation in xenopus. Dev Cell. 2003;4:827–39. [PubMed]
  • Cacalano G, Farinas I, Wang LC, Hagler K, Forgie A, Moore M, Armanini M, Phillips H, Ryan AM, Reichardt LF, et al. GFRalpha1 is an essential receptor component for GDNF in the developing nervous system and kidney. Neuron. 1998;21:53–62. [PMC free article] [PubMed]
  • Cheung M, Briscoe J. Neural crest development is regulated by the transcription factor Sox9. Development 2003 [PubMed]
  • Cheung M, Chaboissier MC, Mynett A, Hirst E, Schedl A, Briscoe J. The transcriptional control of trunk neural crest induction, survival, and delamination. Dev Cell. 2005;8:179–92. [PubMed]
  • Cirillo LA, Lin FR, Cuesta I, Friedman D, Jarnik M, Zaret KS. Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. Mol Cell. 2002;9:279–89. [PubMed]
  • Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP. Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr Biol. 1998;8:1323–6. [PubMed]
  • De Bellard ME, Rao Y, Bronner-Fraser M. Dual function of Slit2 in repulsion and enhanced migration of trunk, but not vagal, neural crest cells. J Cell Biol. 2003;162:269–79. [PMC free article] [PubMed]
  • Ding H, Wu X, Kim I, Tam PP, Koh GY, Nagy A. The mouse Pdgfc gene: dynamic expression in embryonic tissues during organogenesis. Mech Dev. 2000;96:209–13. [PubMed]
  • Dolle P, Price M, Duboule D. Expression of the murine Dlx-1 homeobox gene during facial, ocular and limb development. Differentiation. 1992;49:93–9. [PubMed]
  • Dottori M, Gross MK, Labosky P, Goulding M. The winged-helix transcription factor Foxd3 suppresses interneuron differentiation and promotes neural crest cell fate. Development. 2001;128:4127–38. [PubMed]
  • Epstein DJ, Vekemans M, Gros P. Splotch (Sp2H), a mutation affecting development of the mouse neural tube, shows a deletion within the paired homeodomain of Pax-3. Cell. 1991;67:767–74. [PubMed]
  • Feiner L, Webber AL, Brown CB, Lu MM, Jia L, Feinstein P, Mombaerts P, Epstein JA, Raper JA. Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development. 2001;128:3061–70. [PubMed]
  • Galan-Caridad JM, Harel S, Arenzana TL, Hou ZE, Doetsch FK, Mirny LA, Reizis B. Zfx controls the self-renewal of embryonic and hematopoietic stem cells. Cell. 2007;129:345–57. [PMC free article] [PubMed]
  • Graham V, Khudyakov J, Ellis P, Pevny L. SOX2 functions to maintain neural progenitor identity. Neuron. 2003;39:749–65. [PubMed]
  • Hanna LA, Foreman RK, Tarasenko IA, Kessler DS, Labosky PA. Requirement for Foxd3 in maintaining pluripotent cells of the early mouse embryo. Genes Dev. 2002;16:2650–61. [PubMed]
  • Hiruma T, Nakajima Y, Nakamura H. Development of pharyngeal arch arteries in early mouse embryo. J Anat. 2002;201:15–29. [PubMed]
  • Hosoda K, Hammer RE, Richardson JA, Baynash AG, Cheung JC, Giaid A, Yanagisawa M. Targeted and natural (piebald-lethal) mutations of endothelin-B receptor gene produce megacolon associated with spotted coat color in mice. Cell. 1994;79:1267–76. [PubMed]
  • Kapur RP. Early death of neural crest cells is responsible for total enteric aganglionosis in Sox10(Dom)/Sox10(Dom) mouse embryos. Pediatr Dev Pathol. 1999;2:559–69. [PubMed]
  • Kos R, Reedy MV, Johnson RL, Erickson CA. The winged-helix transcription factor FoxD3 is important for establishing the neural crest lineage and repressing melanogenesis in avian embryos. Development. 2001;128:1467–79. [PubMed]
  • Labosky PA, Kaestner KH. The winged helix transcription factor Hfh2 is expressed in neural crest and spinal cord during mouse development. Mech Dev. 1998;76:185–90. [PubMed]
  • Labosky PA, Kaestner KH. Winged Helix transcription factors. Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine 2005
  • Le Douarin NM, Kalcheim C. The Neural Crest. Cambridge: Cambridge University Press; 1999.
  • Lee HC, Huang HY, Lin CY, Chen YH, Tsai HJ. Foxd3 mediates zebrafish myf5 expression during early somitogenesis. Dev Biol. 2006;290:359–72. [PubMed]
  • Li YX, Zdanowicz M, Young L, Kumiski D, Leatherbury L, Kirby ML. Cardiac neural crest in zebrafish embryos contributes to myocardial cell lineage and early heart function. Dev Dyn. 2003;226:540–50. [PubMed]
  • Lister JA, Cooper C, Nguyen K, Modrell M, Grant K, Raible DW. Zebrafish Foxd3 is required for development of a subset of neural crest derivatives. Dev Biol. 2006;290:92–104. [PubMed]
  • Mercola M, Wang CY, Kelly J, Brownlee C, Jackson-Grusby L, Stiles C, Bowen-Pope D. Selective expression of PDGF A and its receptor during early mouse embryogenesis. Dev Biol. 1990;138:114–22. [PubMed]
  • Montero-Balaguer M, Lang MR, Sachdev SW, Knappmeyer C, Stewart RA, De La Guardia A, Hatzopoulos AK, Knapik EW. The mother superior mutation ablates foxd3 activity in neural crest progenitor cells and depletes neural crest derivatives in zebrafish. Dev Dyn. 2006;235:3199–212. [PubMed]
  • Nagy A, Gertsenstein M, Ventersten K, Behringer R. Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2003.
  • Pardal R, Molofsky AV, He S, Morrison SJ. Stem cell self-renewal and cancer cell proliferation are regulated by common networks that balance the activation of proto-oncogenes and tumor suppressors. Cold Spring Harb Symp Quant Biol. 2005;70:177–85. [PubMed]
  • Pattyn A, Morin X, Cremer H, Goridis C, Brunet JF. The homeobox gene Phox2b is essential for the development of autonomic neural crest derivatives. Nature. 1999;399:366–70. [PubMed]
  • Pichel JG, Shen L, Sheng HZ, Granholm AC, Drago J, Grinberg A, Lee EJ, Huang SP, Saarma M, Hoffer BJ, et al. Defects in enteric innervation and kidney development in mice lacking GDNF. Nature. 1996;382:73–6. [PubMed]
  • Presnell JK, Schreibman MP. Humason’s Animal Tissue Techniques. Baltimore, MD: The Johns Hopkins University Press; 1997.
  • Sanchez MP, Silos-Santiago I, Frisen J, He B, Lira SA, Barbacid M. Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature. 1996;382:70–3. [PubMed]
  • Sasai N, Mizuseki K, Sasai Y. Requirement of FoxD3-class signaling for neural crest determination in Xenopus. Development. 2001;128:2525–36. [PubMed]
  • Satokata I, Maas R. Msx1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat Genet. 1994;6:348–56. [PubMed]
  • Schorle H, Meier P, Buchert M, Jaenisch R, Mitchell PJ. Transcription factor AP-2 essential for cranial closure and craniofacial development. Nature. 1996;381:235–8. [PubMed]
  • Serbedzija GN, Burgan S, Fraser SE, Bronner-Fraser M. Vital dye labelling demonstrates a sacral neural crest contribution to the enteric nervous system of chick and mouse embryos. Development. 1991;111:857–66. [PubMed]
  • Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 1999;21:70–1. [PubMed]
  • Southard-Smith EM, Kos L, Pavan WJ. Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nat Genet. 1998;18:60–4. [PubMed]
  • Steiner AB, Engleka MJ, Lu Q, Piwarzyk EC, Yaklichkin S, Lefebvre JL, Walters JW, Pineda-Salgado L, Labosky PA, Kessler DS. FoxD3 regulation of Nodal in the Spemann organizer is essential for Xenopus dorsal mesoderm development. Development. 2006;133:4827–38. [PMC free article] [PubMed]
  • Steventon B, Carmona-Fontaine C, Mayor R. Genetic network during neural crest induction: from cell specification to cell survival. Semin Cell Dev Biol. 2005;16:647–54. [PubMed]
  • Stewart RA, Arduini BL, Berghmans S, George RE, Kanki JP, Henion PD, Look AT. Zebrafish foxd3 is selectively required for neural crest specification, migration and survival. Dev Biol. 2006;292:174–88. [PubMed]
  • Stoner CM, Gudas LJ. Mouse cellular retinoic acid binding protein: cloning, complementary DNA sequence, and messenger RNA expression during the retinoic acid-induced differentiation of F9 wild type and RA-3-10 mutant teratocarcinoma cells. Cancer Res. 1989;49:1497–504. [PubMed]
  • Sutton J, Costa R, Klug M, Field L, Xu D, Largaespada DA, Fletcher CF, Jenkins NA, Copeland NG, Klemsz M, et al. Genesis, a winged helix transcriptional repressor with expression restricted to embryonic stem cells. J Biol Chem. 1996;271:23126–33. [PubMed]
  • Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126:663–76. [PubMed]
  • Tompers DM, Foreman RK, Wang Q, Kumanova M, Labosky PA. Foxd3 is required in the trophoblast progenitor cell lineage of the mouse embryo. Dev Biol. 2005;285:126–37. [PubMed]
  • Tompers DM, Labosky PA. Electroporation of murine embryonic stem cells: a step-by-step guide. Stem Cells. 2004;22:243–9. [PubMed]
  • Van Praagh R, Van Praagh S. The anatomy of common aorticopulmonary trunk (truncus arteriosus communis) and its embryologic implications. A study of 57 necropsy cases. Am J Cardiol. 1965;16:406–25. [PubMed]
  • Vohra BP, Tsuji K, Nagashimada M, Uesaka T, Wind D, Fu M, Armon J, Enomoto H, Heuckeroth RO. Differential gene expression and functional analysis implicate novel mechanisms in enteric nervous system precursor migration and neuritogenesis. Dev Biol. 2006;298:259–71. [PMC free article] [PubMed]
  • Wall NA, Jones CM, Hogan BL, Wright CV. Expression and modification of Hox 2.1 protein in mouse embryos. Mech Dev. 1992;37:111–20. [PubMed]
  • Wei K, Chen J, Akrami K, Galbraith GC, Lopez IA, Chen F. Neural crest cell deficiency of c-myc causes skull and hearing defects. Genesis. 2007;45:382–90. [PubMed]
  • Wijchers PJ, Burbach JP, Smidt MP. In control of biology: of mice, men and Foxes. Biochem J. 2006;397:233–46. [PubMed]
  • Yaklichkin S, Steiner AB, Lu Q, Kessler DS. FoxD3 and Grg4 physically interact to repress transcription and induce mesoderm in Xenopus. J Biol Chem. 2007;282:2548–57. [PMC free article] [PubMed]