PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of plosntdPLoS Neglected Tropical DiseasesView this ArticleSubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)
 
PLoS Negl Trop Dis. Oct 2008; 2(10): e311.
Published online Oct 1, 2008. doi:  10.1371/journal.pntd.0000311
PMCID: PMC2553280
Dermal-Type Macrophages Expressing CD209/DC-SIGN Show Inherent Resistance to Dengue Virus Growth
Wing-Hong Kwan,#1,2,3 Erika Navarro-Sanchez,#4,5 Hélène Dumortier,1 Marion Decossas,1 Hortense Vachon,1 Flavia Barreto dos Santos,6 Hervé W. Fridman,2,3 Félix A. Rey,5 Eva Harris,6 Philippe Despres,4* and Christopher G. Mueller1*
1CNRS, Laboratory of Therapeutic Immunology and Chemistry, IBMC, Université Louis Pasteur, Strasbourg, France
2INSERM U872, Centre de Recherches Biomédicales des Cordeliers, Paris V UMRS 872, France
3INSERM U872, Centre de Recherches Biomédicales des Cordeliers, Paris VI UMRS 872, France
4Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris, France
5Unité de Recherche de Virologie Structurale, CNRS URA 3015, Institut Pasteur, Paris, France
6Division of Infectious Diseases, School of Public Health, University of California, Berkeley, California, United States of America
Ricardo Toshio Fujiwara, Editor
George Washington University, United States of America
#Contributed equally.
* E-mail: pdespres/at/pasteur.fr (PD); c.mueller/at/ibmc.u-strasbg.fr (CGM)
Conceived and designed the experiments: WHK ENS HD MD EH PD CGM. Performed the experiments: WHK ENS HD MD HV FBdS CGM. Analyzed the data: WHK ENS HD MD HV FBdS EH PD CGM. Contributed reagents/materials/analysis tools: WHK ENS HD HV FBdS HWF FAR EH PD CGM. Wrote the paper: PD CGM.
Received April 18, 2008; Accepted September 4, 2008.
Background
An important question in dengue pathogenesis is the identity of immune cells involved in the control of dengue virus infection at the site of the mosquito bite. There is evidence that infection of immature myeloid dendritic cells plays a crucial role in dengue pathogenesis and that the interaction of the viral envelope E glycoprotein with CD209/DC-SIGN is a key element for their productive infection. Dermal macrophages express CD209, yet little is known about their role in dengue virus infection.
Methods and Findings
Here, we showed that dermal macrophages bound recombinant envelope E glycoprotein fused to green fluorescent protein. Because dermal macrophages stain for IL-10 in situ, we generated dermal-type macrophages from monocytes in the presence of IL-10 to study their infection by dengue virus. The macrophages were able to internalize the virus, but progeny virus production was undetectable in the infected cells. In addition, no IFN-α was produced in response to the virus. The inability of dengue virus to grow in the macrophages was attributable to accumulation of internalized virus particles into poorly-acidified phagosomes.
Conclusions
Aborting infection by viral sequestration in early phagosomes would present a novel means to curb infection of enveloped virus and may constitute a prime defense system to prevent dengue virus spread shortly after the bite of the infected mosquito.
Mosquito-transmitted pathogens are a major challenge to humans due to ever-increasing distribution of the vector worldwide. Dengue virus causes morbidity and mortality, and no anti-viral treatment or vaccine are currently available. The virus is injected into the skin when an infected mosquito probes for blood. Among the skin immunocytes, dendritic cells and macrophages are equipped with pathogen-sensing receptors. Our work has shown that dermal macrophages bind the dengue virus envelope protein. We demonstrate that monocyte-derived dermal macrophages are resistant to infection and present evidence that this is due to sequestration of the virus into fusion-incompetent intracellular vesicles. This identifies skin macrophages as the first innate immune cell potentially capable of protecting the human host from infection by dengue virus shortly after a mosquito bite. These findings have important implications for better understanding the early infection events of dengue virus and of other skin-penetrating pathogens.
Dengue is probably the most important mosquito-transmitted viral disease of humans worldwide. It is caused by dengue virus (DV), which exists as four serotypes (DV1-4) and circulates in an endemic-epidemic mode in most tropical and sub-tropical territories. Transmission of DV to humans occurs when an infected mosquito probes for blood vessels and during a blood meal, through injection of infectious saliva into the human dermis. As a member of the Flaviviridae family, DV infection involves virus uptake into endosomal vesicles that undergo acidification. The low pH induces structural alterations in the envelope (E) protein that lead to membrane fusion and the release of the nucleocapsid into the cytoplasm [1]. After uncoating, the RNA genome is translated to initiate virus replication. It has been proposed that non-neutralizing antibodies raised against one DV serotype may enhance infection by a heterotypic serotype [2]. This may explain why secondary infections are often associated with the more severe forms of dengue fever (hemorrhagic fever with or without shock).
Much research on DV relies on relevant human cell culture models due to the difficulty of establishing appropriate animal models. Progress has been made by showing that DV E protein recognizes the C-type lectin CD209 and its homologue L-SIGN and that expression of either of these lectins is sufficient to render cells permissive to DV grown in mosquito cells [3],[4]. Recently, the mannose receptor (MR) has also been shown to mediate DV binding and infection [5]. Dendritic cells (DC), generated from monocytes in the presence of GM-CSF and IL-4, express CD209, L-SIGN and the MR and are highly susceptible to DV infection [3],[4],[6]. These monocyte-derived DC are thought to be representative of dermal DC (dDC), yet there is increasing evidence that CD209 is not expressed by dDC but primarily by dermal macrophages (dM[var phi]) [7][9]. This underscores the importance of dM[var phi] in early infection events and raises the question of whether dM[var phi] are permissive for productive DV infection. Studies of these cells have been hampered by the lack of suitable isolation techniques from human skin and culture methods to generate the cells from monocytic precursors.
Here, we confirmed that human dM[var phi] express CD209 and showed that they bind DV E protein. Based on the finding that dM[var phi] stained for intracellular IL-10, we developed a method to generate the cells from monocytes in the presence of IL-10. The monocyte-derived dM[var phi] bound E protein and acquired DV in intracellular vesicles, but were resistant to viral replication. The inability of DV to grow in these dermal-type M[var phi] was attributable to accumulation of internalized virus particles into poorly-acidified phagosomes. These findings advance our understanding of the host innate resistance to DV at the early stages of infection and have implications for other pathogens recognizing CD209.
Dermal cell suspensions
Before blood and tissue samples were collected for the study, all healthy donors and patients gave written informed consent in agreement with the Helsinki Declaration and French legislation. A prospective IRB approval was not obtained since there was no need as specified by French law of the health protection act when employing healthy material destined for disposal or one-time biomedical research. A retrospective IRB approval was given. Fresh skin (about 50 cm2) was obtained from patients undergoing breast reduction surgery or abdominoplasty. The skin was trypsinized to peel off the epidermis and the remaining dermis was processed as described elsewhere [10] with the modification that only collagenase type I (1 mg/ml, Invitrogen) was used for 18 h at 37°C. The resulting cell suspension was pipetted and serially filtered through 100 µm and 70 µm cell strainers (BD Biosciences) to remove undigested tissue fragments and to obtain a homogeneous cell suspension.
Protein sE-eGFP production
A DNA fragment containing the DV3 genomic region (Swiss-Prot accession number P27915) coding for the prM-E protein (1674 nt in total, including all of prM and the E ectodomain, ending at codon 392 of E, at the end of domain III) was amplified by PCR with forward primer 5′TTATGCATATTACTGGCCGTCGTGGCC and reverse primer 5′CTCGCCCGCAGACATGGCCTTATCGTCATCGTCGGGCCCCTTCCTGTACCA-GTTGATTTT and inserted into the plasmid pT352. This is a shuttle vector containing selection markers for yeast and E. coli, as well as a metallotheionein-inducible expression cassette for Drosophila cells. In the construct, called pT352/DV3 sE-GFP, the DV prM-E sequence is in-frame with the Drosophila BiP signal peptide, which directs the recombinant protein to the secretory pathway. Drosophila S2 cells (Invitrogen) were co-transfected with pT352/DV3 sE-GFP and a vector conferring resistance to blasticidine, using the effectene transfection reagent (Qiagen). The selected cells were adapted to serum-free growth medium and grown to high density before induction with CuSO4 at 500 µM. The supernatant was collected 10 days later and concentrated using a flow concentration system with a 10 KDa-cutoff membrane (Vivascience), and DV3 sE-GFP was purified by affinity chromatography using a Steptactin column. The eluate was concentrated and further purified by size-exclusion chromatography, using a Superdex 200 10/300 column (GE Healthcare) with 0.5 M NaCl and 50 mM Tris (pH 8.0). Purified DV3 sE was concentrated to 10 g/liter in Vivaspin ultrafiltration spin columns (Sartorius).
DV3 sE protein binding and CD209 expression of dermal cells
Dermal cells were collected 48 h after culturing in complete medium, RPMI medium supplemented 10% fetal calf serum (FCS) and antibiotics (Invitrogen), and 3×105 cells were incubated with 1, 2, 4 or 8 µg recombinant DV3 sE-eGFP fusion protein in 0.1 ml complete medium at 37°C for 30 min. The cells were then washed twice with complete medium and incubated with anti-CD14-APC, anti-CD1a-PE and anti-HLA-DR-PerCP mAb (BD Biosciences) in PBS/2% FCS for 15 min. Following 3 washes, the cells were fixed in 0.4% formaldehyde and analyzed by flow cytometry (FACS Calibur, BD Biosciences). The relative MFI for 3 donors was determined in triplicate after gating for CD1a+HLA-DR+ or CD14+HLA-DR+ cells using the following formula: (MFI (FL1) protein sE-eGFP – MFI (FL1) no protein sE-eGFP)/MFI (FL1) no protein sE-eGFP. To determine CD209 expression, 3×105 cells were incubated with anti-CD209-PerCPCy5.5 (clone DCN46, BD Biosciences), anti-CD14-APC, anti-CD1a-PE and anti-HLA-DR-PerCP mAb in PBS/2% FCS for 15 min and, after washing, fixed and analyzed by flow cytometry.
Immunofluorescence of skin sections
Formaldehyde-fixed, paraffin sections were rehydrated and antigen was retrieved in citrate buffer pH 6 at 97°C for 45 min. Biotin was blocked using the avidin-biotin blocking kit (Vector Inc.), and sections were saturated in 5% human serum at room temperature for 40 min. The following primary Abs were used: goat-anti IL-10 (1[ratio]75 dilution, R&D Systems), mouse anti-CD209 (2 µg/ml, R&D Systems), mouse anti-CD1a (Immunotech) and mouse anti-CD14 (1[ratio]40 dilution, Novocastra). The secondary Ab (Jackson) were: biotin-conjugated donkey anti-goat followed by streptavidin-Alexa 488 (Molecular Probes-Invitrogen) and F(ab)'2 rabbit anti-mouse followed by Cy3-conjugated donkey anti-rabbit. Sections were observed by confocal microscopy (LSM510 Zeiss).
Cell culture and phenotypic analysis
Monocytes were isolated from 200 ml of adult human peripheral blood using negative-depletion beads (Dynal-Invitrogen) or by counterflow centrifugal elutriation. To obtain MDdM[var phi], 3×106 monocytes were cultured for 5 days in 5 ml of complete medium containing 10 ng/ml M-CSF (R&D Systems), 20 ng/ml IL-10 (Immunotools) and 20 ng/ml GM-CSF (Schering-Plough) with refreshment of GM-CSF (10 ng/ml) and IL-10 (10 ng/ml) at day 3. For MDDC, 3×106 monocytes were cultured for 5 days in 5 ml of complete medium containing 50 ng/ml GM-CSF and 10 ng/ml IL-4 (Schering-Plough) with readdition of cytokines at day 3. Non-adherent cells were harvested. Expression of markers was measured by FACS using specific antibodies and their corresponding isotype controls. To assay for DV3 sE protein binding, cells were pre-incubated for 10 min in complete medium in the absence or presence of 5 mM EDTA before adding 3 µg DV3 sE-eGFP protein. After 30 min at 37°C, the cells were washed three times in complete medium and analyzed by flow cytometry.
Viral infections
5×105 MDdM[var phi] and MDDC were exposed to DV serotype 1 (strain FGA/NA d1d) [11], serotype 2 (strain 16681), or serotype 3 (strain PaH 881, isolated in 1988 in Thailand) in RPMI medium supplemented with 0.2% bovine serum albumin for 2 h. Viral growth was determined at 40 h post-infection. Virus titration was performed as previously described [3]. Infectivity titers were expressed as focus forming unit (FFU) on mosquito AP61 cell line (DV1 and DV3) or plaque forming unit (PFU) on mammalian BHK cell line (DV2). Different titering assays were performed to independently confirm our findings, despite the fact both methods may not be equivalent. The limit of titer determination was fixed at 103, below which viral production was considered non-significant. For FACS analysis, infected cells were fixed and labeled for intracellular viral antigens with antiserum raised in mice that had received intracerebral DV injection [3]. IFN-α released from DV1-infected MDdM[var phi] and MDDC was measured by ELISA (R&D Systems).
Microscopy on cultured cells
To observe live DV internalization by MDDC and MDdM[var phi], the cells were exposed to DV1 at an MOI of 100 at 4°C for 30 min or at 37°C for 1 h and fixed in 2.5% glutaraldehyde. Cells were postfixed in osmium tetroxide, dehydrated in ethanol containing 1% uranyl acetate, treated with propylene oxide and embedded in resin (Durcupan ACM, Fluka). Ultrathin sections were stained with lead citrate and examined by transmission electron microscopy (TEM) (Hitachi H600). Images were acquired using a CCD camera (Hamamatsu). To visualize DV3 sE-eGFP internalization and endosomal acidification, cells were incubated with 10 µM LysoSensor Blue DND-167 (Molecular Probes-Invitrogen) for 30 min at 37°C. Protein sE-eGFP was added at a concentration of 3 µg/ml, and cells were viewed after different incubation times using a confocal microscope (LSM510, Zeiss). The blue color emitted by the LysoSensor dye was digitally converted into red. For TEM, cells were fixed in 2% paraformaldehyde and 0.2% glutaraldehyde. Cells were embedded in 1% agarose, permeabilized with 0.2% saponin and saturated with 2% BSA before incubation with 5 µg/ml polyclonal rabbit anti-GFP antibody (Rockland). The antibody was visualized by pre-embedding labeling using a goat anti-rabbit IgG conjugated to 0.8 nm gold particles, according to manufacturer's instructions (Aurion). Cells were fixed in 1% glutaraldehyde, and gold particles were enhanced using a silver kit (HQ silver, Nanoprobes). Cells were then treated and observed as above.
We wished to determine whether human dM[var phi] are targets of DV infection. To this end, healthy human skin from patients undergoing plastic surgery was processed to obtain a dermal cell suspension. The cells were then cultured without additional cytokines for 48 h to allow re-expression of cell surface markers, such as CD1a and CD209, lost during the collagenase treatment (data not shown). Binding of DV3 E protein to dermal cells was assessed by flow cytometry after staining with CD14 and CD1a-specific antibodies. CD14 is expressed by dM[var phi] and CD1a by dDC [7][9]. To detect E protein binding, the soluble form of DV3 E protein (sE) was fused to the reporter protein eGFP and purified from a Drosophila expression system. As shown in Figure 1A, CD1a+ dDC showed only a limited capacity to interact with DV3 sE protein, whereas CD14+ dM[var phi] readily bound the protein. This is corroborated by the distinct expression of CD209 by dM[var phi] (Fig. 1A), whereas dDC expressed little, if any, CD209 (data not shown). Increasing amounts of DV3 sE protein were added to the dermal cell suspension to test if dDC bound the protein at higher concentrations. Figure 1B shows that even at high concentrations, there was little binding of DV3 sE protein to dDC, whereas it bound to dM[var phi] in a dose-dependent fashion. These findings identify dM[var phi] as potential key cellular targets of DV.
Figure 1
Figure 1
Dermal M[var phi] bind DV3 sE protein.
To address the question of whether dM[var phi] are infected by DV and whether they are permissive for viral production, we established cell culture conditions to generate dermal-type M[var phi] from monocytes. We observed on human skin tissue sections that dM[var phi] expressing CD14 or CD209, but not the CD1a+ dDC, stained for IL-10 (Fig. 2A). When purified human monocytes were cultured in M-CSF and increasing concentrations of IL-10, the cells expressed CD14 and CD209 in an IL-10 dose-dependent manner (Fig. 2B). Similar to DC [12], the addition of GM-CSF increased CD209 levels (Fig. 2B), so that a homogeneous CD14+CD209+ cell population could be obtained with CD209 expression nearly identical to that of DC derived from monocytes in the presence of GM-CSF and IL-4 (Figure S1A). Western blotting of cell lysates confirmed the presence of CD209 as a major band of 49 kDa in both cell-types [13] (Figure S1B). The M[var phi] expressed coagulation factor XIIIa and CD163, two other cell surface markers of dM[var phi] [14] (Fig. 2C). The M[var phi] and the DC were both able to bind eGFP-tagged DV3 sE protein, which was inhibited by EDTA (Fig. 2C). This distinguishes the monocyte-derived DC from dDC. Upon activation by lipopolysaccharide (LPS), the M[var phi] rapidly released IL-10, whereas DC or monocytes produced little of this cytokine (Figure S1C).
Figure 2
Figure 2
Generation of dermal-type M[var phi] with IL-10.
Monocyte-derived dM[var phi] (MDdM[var phi]) and monocyte-derived DC (MDDC) were analyzed for DV infection using low-passage DV1 and DV3 strains grown in mosquito cells [3] as well as the prototype DV2 strain 16681 [15]. The cells were exposed to DV1 at a multiplicity of infection (MOI) of 1 for 2 h, washed, and then cultured for 40 h. As shown in Figure 3A, intracellular viral antigen was clearly detected in MDDC by flow cytometry, whereas no specific immuno-labeling was observed in MDdM[var phi]. An analysis of DV replication in these cells infected at an MOI of 1 (DV1 and DV3) or 2 (DV2) showed that MDDC were highly permissive to productive infection (~105 FFU/ml or PFU/ml) (Fig. 3B); in contrast, progeny virus production was undetectable in DV-infected MDdM[var phi] (<103 FFU/ml or PFU/ml). Consistent with this finding, no IFN-α was produced by DV-infected MDdM[var phi], even at an MOI of 10, whereas MDDC readily released IFN-α when infected with DV at an MOI of 1 or 10 [16] (Fig. 3C). To verify that MDdM[var phi] acquired the virus, both myeloid cell-types were exposed to high DV input (MOI of 100) and electron microscopy analysis was performed after 30 min at 4°C and after 1 h at 37°C (Fig. 3D). Cell surface-bound (at 4°C) and endosomal vesicle-associated virus particles (at 37°C) were clearly detected in both cell-types. Thus, internalization of DV can occur in MDdM[var phi] but does not result in productive infection.
Figure 3
Figure 3
MDdM[var phi] are resistant to permissive DV infection.
In an effort to define the molecular basis of the inability of DV to grow in MDdM[var phi]. we asked whether internalized DV was sequestered in a manner that hampers productive infection, using DV3 sE-eGFP fusion protein. To monitor DV3 sE protein internalization in MDdM[var phi] and MDDC, the cells were incubated with pH-sensitive LysoSensor dye and analyzed by confocal microscopy (Fig. 4). This dye accumulates in acidic organelles, where its fluorescence emission is highest. After 5 min at 37°C, DV3 sE protein was observed in vesicle-like structures in both cell-types. By 30 min and 60 min, DV3 sE protein dispersed to acidified perinuclear lysosomes in MDDC. In marked contrast, when MDdM[var phi] were examined at these time-points, a large fraction of internalized DV3 sE protein was excluded from the acidic compartment and remained in non-acidic, large endosomes. Electron microscopy analysis using a colloidal gold-conjugated antibody to GFP demonstrated that DV3 sE protein accumulated in large phagosomes in MDdM[var phi], located close to the plasma membrane (Fig. 5). On the other hand, at 30 min, in MDDC, DV3 sE protein was mostly found in small perinuclear vesicles in the environment of the endoplasmic reticulum. Taken together, these data suggest that the inability of DV to productively infect MDdM[var phi] is due to accumulation of virus particles in immature endosomal vesicles whose pH does not allow efficient viral-cell membrane fusion and subsequent virus uncoating.
Figure 4
Figure 4
DV3 sE-eGFP protein is excluded from acidic compartments in MDdM[var phi].
Figure 5
Figure 5
DV3 sE-eGFP protein-containing vesicles are distinct in MDDC and MDdM[var phi].
In the present study, we demonstrated for the first time the interaction of dM[var phi] with DV3 sE glycoprotein, which correlates with the expression of the DV attachment receptor CD209. Dermal DC displayed only a limited capacity to interact with DV3 sE protein and expressed little CD209. In accordance with these findings, in situ immuno-labeling of human skin section revealed CD209 expression by dM[var phi] but little on DC [7][9]. Both cell types carry the MR [7], which also recognizes DV E protein [5]. Due to the nature of our binding assay, the dermal cells with the highest affinity for DV3 sE protein would acquire the most DV3 sE protein, suggesting that dDC may capture the recombinant envelope protein when physically isolated from dM[var phi]. In the skin, the abundance, the location and the co-expression of CD209, L-SIGN and MR are likely to determine the nature of the DV-capturing immune cell.
Based on the observations that dM[var phi] stained for intracellular IL-10 in situ and that IL-10 is produced by dM[var phi] ex vivo [17],[18], we tested the effect of IL-10 on the formation of dM[var phi] from monocytes. By combining IL-10, M-CSF and GM-CSF, a homogenous cell population was obtained which carried CD209 and other markers characteristic of dM[var phi], rapidly produced IL-10 in response to LPS or other toll-like receptor ligands (data not shown), and bound DV3 sE protein. Like MDDC, the MDdM[var phi] were capable of internalizing live DV but, distinct from MDDC, they displayed an inherent resistance to viral growth. In contrast to DV3 sE protein found in acidified compartments in MDDC, we observed that DV3 sE protein accumulated in non-acidified phagosomes in MDdM[var phi]. The DC vesicles containing DV3 sE protein or live virus were bell-shaped or tubular, whereas they were round, larger and close to the plasma membrane in the M[var phi]. To our knowledge, this identifies MDdM[var phi] as the first innate immune cell capable of protecting the human host from DV infection and virus propagation. From this data, we propose that dM[var phi] can act to trap infecting virions in a fusion-incompetent endosomal environment and thus to prevent DV spread to dDC at the anatomical site of the mosquito bite. We cannot formally exclude the possibility that downstream delays in the viral life cycle contribute to the inability of DV to replicate in MDdM[var phi], but the finding that West Nile virus productively infects these cells (data not shown) indicates that they are not generally refractory to flavivirus growth.
IL-10, required for CD209 expression and blockage of endosome acidification, is likely to be produced by the dM[var phi] themselves, constitutively, or in response to stimuli such as UV-light [17]. In this context, a key question is whether mosquito salivary proteins, co-injected with the infectious virus, would also trigger IL-10 production by dM[var phi] or, on the contrary, provoke an inflammatory response. Inflammatory cytokines of the Th2 T-helper cell type, IL-4 and IL-13, may be responsible for the formation of CD209+MR+ DC, which are permissive for DV infection and viral progeny production [3][6]. Alternatively, the presence of anti-DV non-neutralizing antibodies raised against a heterotypic DV serotype may render dDC susceptible to DV infection at the site of the mosquito bite.
The abundance and strategic position of the M[var phi] in the dermis is consistent with their function as first defense barrier against pathogens by isolating and eliminating them and thus avoiding unnecessary immune activation. However, other pathogens that recognize C-type lectins, such as mycobacteria, may exploit these cells to escape immune attack. Accumulating CD209+ M[var phi] in leprosy skin lesions have been associated with mycobacterial persistence [19]. Important questions to address in future are whether DV is eliminated in MDdM[var phi], whether infected MDdM[var phi] gradually release DV, as shown for the foot-and-mouth disease virus and pulmonary M[var phi] [20], and whether rapid DV growth can occur when the Mα convert to DC. Improved knowledge of the molecular mechanisms for suppressing pathogen growth in MDdM[var phi] will provide new insight into the crucial role of dM[var phi] in protective immunity to infectious agents at the skin level.
Supporting Information
Figure S1
Comparison of monocyte-derived DC and dermal-type macrophages
(0.95 MB TIF)
Alternative Language Abstract S1
Translation of the abstract into French by M. Decossas
(0.02 MB DOC)
Alternative Language Abstract S2
Translation of the abstract into Spanish by E. Navarro-Sanchez
(0.02 MB DOC)
Alternative Language Abstract S3
Translation of the abstract into German by C. Mueller
(0.02 MB DOC)
Acknowledgments
We thank Daniel Hanau for human skin, the Hôpital Européen George Pompidou and Cécile Badual for skin biopsies and Schering-Plough for cytokines; Evelyne Schaeffer and other members of the laboratories for technical help and discussion; the personnel of the imaging platform Strasbourg/Esplanade; and Yves Jacob, Carlos Kikuti and Thomas Krey for providing plasmid pT352.
Footnotes
The authors have declared that no competing interests exist.
This work was supported by INSERM, CNRS, the Fondation de la Recherche Médicale, the Agence Nationale de Recherche Microbiologie Immunologie Maladies Emergentes (contract ARBO-CELLGUARD), the Pediatric Dengue Vaccine Initiative (PDVI), and the European Commission (INCO-DEV, contract DENFRAME No. 51711). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
1. Stiasny K, Heinz FX. Flavivirus membrane fusion. J Gen Virol. 2006;87:2755–2766. [PubMed]
2. Halstead SB. Pathogenesis of dengue: challenges to molecular biology. Science. 1988;239:476–481. [PubMed]
3. Navarro-Sanchez E, Altmeyer R, Amara A, Schwartz O, Fieschi F, et al. Dendritic-cell-specific ICAM3-grabbing non-integrin is essential for the productive infection of human dendritic cells by mosquito-cell-derived dengue viruses. EMBO Rep. 2003;4:723–728. [PubMed]
4. Tassaneetrithep B, Burgess TH, Granelli-Piperno A, Trumpfheller C, Finke J, et al. DC-SIGN (CD209) mediates dengue virus infection of human dendritic cells. J Exp Med. 2003;197:823–829. [PMC free article] [PubMed]
5. Miller JL, Dewet BJ, Martinez-Pomares L, Radcliffe CM, Dwek RA, et al. The Mannose Receptor Mediates Dengue Virus Infection of Macrophages. PLoS Pathog. 2008;4:e17. doi:10.1371/journal.ppat.0040017. [PMC free article] [PubMed]
6. Wu SJ, Grouard-Vogel G, Sun W, Mascola JR, Brachtel E, et al. Human skin Langerhans cells are targets of dengue virus infection. Nat Med. 2000;6:816–820. [PubMed]
7. Turville SG, Cameron PU, Handley A, Lin G, Pohlmann S, et al. Diversity of receptors binding HIV on dendritic cell subsets. Nat Immunol. 2002;3:975–983. [PubMed]
8. Angel CE, Lala A, Chen CJ, Edgar SG, Ostrovsky LL, et al. CD14+ antigen-presenting cells in human dermis are less mature than their CD1a+ counterparts. Int Immunol. 2007;5:5. [PubMed]
9. Zaba LC, Fuentes-Duculan J, Steinman RM, Krueger JG, Lowes MA. Normal human dermis contains distinct populations of CD11c+BDCA-1+ dendritic cells and CD163+FXIIIA+ macrophages. J Clin Invest. 2007;117:2517–2525. [PMC free article] [PubMed]
10. Angel CE, George E, Ostrovsky LL, Dunbar PR. Comprehensive analysis of MHC-II expression in healthy human skin. Immunol Cell Biol. 2007;85:363–369. [PMC free article] [PubMed]
11. Despres P, Frenkiel MP, Ceccaldi PE, Duarte Dos Santos C, Deubel V. Apoptosis in the mouse central nervous system in response to infection with mouse-neurovirulent dengue viruses. J Virol. 1998;72:823–829. [PMC free article] [PubMed]
12. Relloso M, Puig-Kroger A, Pello OM, Rodriguez-Fernandez JL, de la Rosa G, et al. DC-SIGN (CD209) expression is IL-4 dependent and is negatively regulated by IFN, TGF-beta, and anti-inflammatory agents. J Immunol. 2002;168:2634–2643. [PubMed]
13. Granelli-Piperno A, Pritsker A, Pack M, Shimeliovich I, Arrighi JF, et al. Dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin/CD209 is abundant on macrophages in the normal human lymph node and is not required for dendritic cell stimulation of the mixed leukocyte reaction. J Immunol. 2005;175:4265–4273. [PMC free article] [PubMed]
14. Nestle FO, Nickoloff BJ. Deepening our understanding of immune sentinels in the skin. J Clin Invest. 2007;117:2382–2385. [PMC free article] [PubMed]
15. Kwan WH, Helt AM, Maranon C, Barbaroux JB, Hosmalin A, et al. Dendritic cell precursors are permissive to dengue virus and human immunodeficiency virus infection. J Virol. 2005;79:7291–7299. [PMC free article] [PubMed]
16. Ho LJ, Wang JJ, Shaio MF, Kao CL, Chang DM, et al. Infection of human dendritic cells by dengue virus causes cell maturation and cytokine production. J Immunol. 2001;166:1499–1506. [PubMed]
17. Kang K, Gilliam AC, Chen G, Tootell E, Cooper KD. In human skin, UVB initiates early induction of IL-10 over IL-12 preferentially in the expanding dermal monocytic/macrophagic population. J Invest Dermatol. 1998;111:31–38. [PubMed]
18. Morelli AE, Rubin JP, Erdos G, Tkacheva OA, Mathers AR, et al. CD4+ T cell responses elicited by different subsets of human skin migratory dendritic cells. J Immunol. 2005;175:7905–7915. [PubMed]
19. Krutzik SR, Tan B, Li H, Ochoa MT, Liu PT, et al. TLR activation triggers the rapid differentiation of monocytes into macrophages and dendritic cells. Nat Med. 2005;11:653–660. [PMC free article] [PubMed]
20. Rigden RC, Carrasco CP, Summerfield A, KC MC. Macrophage phagocytosis of foot-and-mouth disease virus may create infectious carriers. Immunology. 2002;106:537–548. [PubMed]
Articles from PLoS Neglected Tropical Diseases are provided here courtesy of
Public Library of Science