PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of actafjournal home pagethis articleInternational Union of Crystallographysearchsubscribearticle submission
 
Acta Crystallogr Sect F Struct Biol Cryst Commun. 2008 July 1; 64(Pt 7): 632–635.
Published online 2008 June 11. doi:  10.1107/S1744309108016278
PMCID: PMC2443972

Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

Abstract

Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å).

Keywords: carbazole, putidaredoxin-type proteins, Rieske nonhaem iron oxygenases

1. Introduction

[2Fe–2S]-type ferredoxins are small iron–sulfur proteins that are found in bacteria, plants and animals, where they participate in a wide variety of electron-transfer reactions. In chloroplast-type ferredoxins, which were the first electron-transfer proteins to be identified in the plant photosystem, the [2Fe–2S] cluster is ligated by four cysteinyl residues that are bound to both of the Fe atoms (Tagawa & Arnon, 1962 [triangle]). In contrast, Rieske-type ferredoxins, which were first isolated from the cytochrome c reductase complex in bovine heart mitochondria, consist of a [2Fe–2S] core with two histidine side chains bound to one Fe atom and two cysteine side chains bound to the other (Rieske et al., 1964 [triangle]). Although the [2Fe–2S] cluster in putida­redoxin-type ferredoxins is ligated by four cysteinyl residues, as in chloroplast-type ferredoxins, they are frequently involved in oxidation reactions, such as those of the P450 monooxygenase system in bacteria (Hannemann et al., 2007 [triangle]).

Rieske nonhaem iron-oxygenase systems (ROSs) are the primary catalysts in the bacterial aerobic degradation of many environmentally significant aromatic compounds, including polycyclic aromatic hydrocarbons, polychlorinated biphenyl and heteroaromatics such as dioxins and carbazole (Nojiri & Omori, 2002 [triangle]; Habe & Omori, 2003 [triangle]; Furukawa et al., 2004 [triangle]; Pieper, 2005 [triangle]). ROSs consist of a terminal oxygenase component and either a single reductase component or ferredoxin and ferredoxin reductase components, which are involved in the transfer of electrons from NAD(P)H to the terminal oxygen­ase. ROSs are divided into five groups (IA, IB, IIA, IIB and III) based on the number of constituents they contain and the nature of their redox centres. The three-component systems are further classified as IIA, IIB or III (Batie et al., 1991 [triangle]). Many ROS members that belong to Batie classes IIB or III contain a Rieske-type ferredoxin that mediates the movement of electrons from the reductase to the terminal oxygenase component. To elucidate the function of Rieske-type ferredoxins in ROS catalysis, the crystal structures and biological functions of several Rieske-type ferredoxins have been analysed (Colbert et al., 2000 [triangle]; Nam et al., 2005 [triangle]; Ferraro et al., 2007 [triangle]). In contrast, a few ROSs belong to class IIA, in which a putida­redoxin-type ferredoxin mediates the movement of electrons between the reductase and terminal oxygenase components (Sauber et al., 1977 [triangle]; Bünz & Cook, 1993 [triangle]; Herman et al., 2005 [triangle]).

Novosphingobium sp. KA1 (formerly Sphingomonas sp. KA1) possesses the carbazole-degradative plasmid pCAR3 (Shintani et al., 2007 [triangle]), which carries several genes (carAaIAcIAdI, carAaIIAcIIAdII, fdxI and fdrI/fdrII) that are involved in the conversion of carbazole to anthranilate (Urata et al., 2006 [triangle]). The initial dioxygenation of carbazole is catalysed by carbazole 1,9a-dioxygenase (CARDO; Fig. 1 [triangle]), which consists of three components: the terminal oxygenase CARDO-O (CarAaI or CarAaII), the ferredoxin CARDO-F (CarAcI, CarAcII or FdxI) and the ferredoxin reductase CARDO-R (FdrI or FdrII) (Urata et al., 2006 [triangle]). The CARDO-F of Novosphingobium sp. KA1 (CARDO-FKA1) is a putidaredoxin-type ferredoxin, while CARDO-­R shows marked homology to the putida­redoxin reductase involved in camphor oxidation by the cytochrome P450 monooxygenase of Pseudomonas putida (Poulos, 2003 [triangle]). Thus, the CARDO of Novosphingobium sp. KA1 (CARDOKA1) belongs to class IIA. We have previously investigated the structures and functions of the CARDOs from several bacterial strains, including P. resinovorans CA10, Janthinobacterium sp. J3 and Nocardioides aromaticivorans IC177, which belong to classes III, III and IIB, respectively (Nojiri & Omori, 2007 [triangle]). The CARDO-Os of many species are coupled with diverse types of electron-transfer components, although they share marked homology (>45% identity and >70% similarity at the primary sequence level) to each other. Therefore, CARDOs are an excellent model for studying the molecular mechanism of electron transfer between the terminal oxygenase and ferredoxin components, which has been largely overlooked compared with that between reductase and ferredoxin components (Senda et al., 2007 [triangle]). To date, we have determined the crystal structures of the components of a class III CARDO, CARDO-F of P. resinovorans CA10 (Nam et al., 2005 [triangle]), CARDO-O of Janthinobacterium sp. J3 (Nojiri et al., 2005 [triangle]) and their electron-transfer complex (Ashikawa et al., 2005 [triangle], 2006 [triangle]). We have also successfully crystallized a class IIB CARDO-O and CARDO-F from N. aromatici­vorans (Inoue et al., 2006 [triangle], 2007 [triangle]) and we recently finalized the structures of both components at resolutions of 2.3 and 2.0 Å, respectively (Inoue et al., unpublished results). Crystal structures of components of class IIA ROSs such as CARDOKA1 have not been reported; however, the crystal structures of homologous ferredoxins, including bovine adrenodoxin (Pikuleva et al., 2000 [triangle]), multiple putida­redoxin mutants (Sevrioukova et al., 2003 [triangle]; Smith et al., 2004 [triangle]) and a ferredoxin from Rhodobacter capsulatus (Sainz et al., 2006 [triangle]), have been determined.

Figure 1
Components and functions of the class IIA CARDO system. The proposed electron-transfer and dioxygenation reactions are illustrated. The subscripts ‘ox’ and ‘red’ indicate the oxidized and reduced states of the CARDO components, ...

Here, we report the crystallization and preliminary X-ray diffraction of class IIA CARDO-FKA1 (109 residues with a molecular mass of 11.5 kDa). The three-dimensional structure of CARDO-FKA1 will provide meaningful insights into the mechanisms of electron transfer and recognition of the proper redox partner.

2. Experimental methods

2.1. Protein expression and purification

carAcII (the accession No. of the corresponding protein is YP_717946) was amplified by PCR using the primers 5′-AAAAA­ATCTAGAATAAGGAGGTGTTCATATG CACCACCACCACCA CCACTCGGAGACCATCCGGCTC-3′ and 5′-AAAAAAGGTACCAAGCTTTCAGAGCTGACTGGCGGGCAG-3′ (the NdeI and HindIII restriction sites and 6×His-tag sequence are italicized and shown in bold, respectively) and the product was ligated into pUC119 (Sambrook & Russell, 2001 [triangle]). The insert was sequenced to verify its accuracy and the 350 bp NdeI–HindIII fragment was inserted into the expression vector pET-26b(+) (Novagen) to create pEKANhAcII, which encodes His-tagged CARDO-FKA1 in which a 6×His tag is inserted between the starting methionine and the following serine residues. Following overnight culture of Escherichia coli BL21 (DE3) (Nova­gen) cells carrying pEKANhAcII at 310 K in LB medium (Sambrook & Russell, 2001 [triangle]) supplemented with kanamycin (50 µg ml−1), this culture was diluted 50-fold into SB medium (12 g tryptone, 24 g yeast extract, 5 ml glycerol, 12.5 g K2HPO4 and 3.8 g KH2PO4 per litre; Nam et al., 2002 [triangle]) with kanamycin and cultivated at 298 K with shaking at 120 rev min−1. When the optical density at 600 nm reached approximately 0.5, isopropyl β-d-1-thiogalacto­pyranoside was added to a final concentration of 0.5 mM. After a 15 h incubation, the cells were harvested by centrifugation at 5000g for 10 min, washed twice with TG buffer (20 mM Tris–HCl pH 7.5 and 10% glycerol; Nam et al., 2002 [triangle]) and resuspended in buffer A (TG buffer containing 0.5 M NaCl and 10 mM imidazole). A crude cell extract was then prepared by sonication and centrifugation at 25 000g for 1 h and the supernatant was applied onto a HiTrap Chelating HP column (GE Healthcare) on an ÄKTA FPLC instrument (GE Healthcare) according to the manufacturer’s recommendations. CARDO-FKA1 was eluted using a gradient of 10–200 mM imidazole in buffer A. The fractions containing CARDO-FKA1 were pooled and concentrated by ultrafiltration using Centriprep YM-10 columns (Millipore). The concentrated fraction was applied onto a Hi-Prep 16/10 DEAE (GE Healthcare) column equilibrated with TG buffer and eluted using a gradient of 0–1.0 M NaCl in TG buffer. The fractions containing CARDO-FKA1 were pooled and concentrated as described above. The resultant preparation was further purified by gel-filtration chromatography using a Superdex75 prep-grade (GE Healthcare) column and GFC buffer (20 mM Tris–HCl buffer pH 7.5 containing 0.2 M NaCl and 10% glycerol; Nam et al., 2002 [triangle]). The homogeneity of the purified CARDO-FKA1 (molecular mass of 12.5 kDa) was confirmed by SDS–PAGE. The amount of CARDO-FKA1 harvested was approximately 4 mg per litre of SB medium. Protein concentrations were estimated using a protein-assay kit (Bio-Rad) according to the method of Bradford (1976 [triangle]) with BSA as a standard. Prior to crystallization, the ability of the purified CARDO-FKA1 to transfer electrons from CARDO-RKA1 to CARDO-OKA1 was confirmed in vitro by the detection of oxygenation activity using carbazole (data not shown).

2.2. Crystallization

CARDO-FKA1 appeared to be unstable under aerobic conditions, given that the colour of the protein solution changed from dark brown to colourless. No putidaredoxins had been crystallized in recent years because of instability until Sevrioukova et al. (2003 [triangle]) reported the crystallization of putidaredoxin mutants with Ser residues substituted for several Cys residues located on the surface of the protein. Based on their data, the stabilization of CARDO-FKA1 under anaerobic conditions was presumed to be the consequence of a reduction in the auto-oxidation of Cys residues located on the surface of the protein. In fact, we found that under anaerobic conditions CARDO-FKA1 was stable in 5 mM Tris–HCl pH 7.5 for several weeks. Therefore, the crystallization of CARDO-FKA1 was performed in an anaerobic chamber (Te-Her Anaerobox ANX-3, Hirasawa) filled with 80% N2, 10% CO2 and 10% H2. All remaining oxygen molecules in the chamber were removed using a Pd catalyst, which catalyses the conversion of H2 to H2O. The gas mixture was introduced for 2 min every 24 h in order to maintain anaerobic conditions. Anaerobic conditions were verified prior to the experiment using a BR0055B anaerobic indicator (Oxoid).

For crystallization, a solution of CARDO-FKA1 containing 5–20 mg ml−1 protein in 5 mM Tris–HCl pH 7.5 was used. Crystallization was performed by the hanging-drop vapour-diffusion method at 293 K. Drops containing 2 µl protein solution and 2 µl mother liquor were equilibrated against 500 µl reservoir solution. The initial crystallization conditions were screened using Crystal Screens I and II and Index Screen (Hampton Research). Several crystals were obtained using Index Screen condition No. 54 [0.05 M calcium chloride dihydrate, 0.1 M bis-tris pH 6.5 and 30%(v/v) polyethylene glycol monomethyl ether 550]. The crystals, which appeared within two weeks at a protein concentration of 5 mg ml−1, grew to approximate dimensions of 0.25 × 0.2 × 0.05 mm (Fig. 2 [triangle]).

Figure 2
A CARDO-FKA1 crystal. The scale bar indicates 0.16 mm.

2.3. Data collection

The crystals were directly flash-cooled in a nitrogen stream at 100 K. Diffraction experiments were conducted on beamline BL-6A at Photon Factory, Tsukuba, Japan. The data were collected at a wavelength of 1.000 Å with a Quantum 4R CCD X-ray detector (ADSC) using a single crystal in 0.5° oscillation steps over a range of 180° with a 60 s exposure per frame. The crystals diffracted to a diffraction limit of 1.6 Å. The data sets were integrated and scaled using the HKL-2000 program suite (Otwinowski & Minor, 1997 [triangle]) to 1.9 Å resolution. The criterion for determination of the resolution range used was the resolution at which the R merge remains less than 0.35. Our data-collection and processing statistics are summarized in Table 1 [triangle].

Table 1
Crystal parameters and data-collection statistics

3. Results and discussion

We have obtained crystals of CARDO-FKA1. The space group of the crystal was determined to be C2221, with unit-cell parameters a = 53.4, b = 77.8, c = 43.5 Å, α = β = γ = 90°. Initial analysis of the crystal solvent content using the Matthews coefficient (Matthews, 1968 [triangle]) suggested that the asymmetric unit contained one molecule (33.0% solvent content) with an acceptable packing density V M of 1.83 Å3 Da−1.

The crystal structure solution was attempted using molecular replacement with the solution structure of putidaredoxin (PDB code 1pdx; 45% primary sequence identity; Pochapsky et al., 1999 [triangle]) as a search model and yielded a satisfactory solution. A full description of the structure determination followed by interpretation of the structure–function relationship will be published elsewhere.

Acknowledgments

This work was supported by a Grant-in-Aid for Scientific Research (17380052 to HN) from the Ministry of Education, Culture, Sports, Science and Technology of Japan and by the Institute for Bioinformatics Research Development, Japan Science Technology Agency (BIRD-JST). The use of synchrotron radiation was approved by the Photon Factory Advisory Committee and KEK (High-Energy Accelerator Research Organization), Tsukuba (proposals 04G137, 2006G171 and 2007G135).

References

  • Ashikawa, Y., Fujimoto, Z., Noguchi, H., Habe, H., Omori, T., Yamane, H. & Nojiri, H. (2005). Acta Cryst. F61, 577–580. [PMC free article] [PubMed]
  • Ashikawa, Y., Fujimoto, Z., Noguchi, H., Habe, H., Omori, T., Yamane, H. & Nojiri, H. (2006). Structure, 14, 1779–1789. [PubMed]
  • Batie, C. J., Ballou, D. P. & Correll, C. C. (1991). Chemistry and Biochemistry of Flavoenzymes, Vol. 3, edited by F. Muller, pp. 543–556. Boca Raton: CRC Press.
  • Bradford, M. M. (1976). Anal. Chem.72, 248–254. [PubMed]
  • Bünz, P. V. & Cook, A. M. (1993). J. Bacteriol.175, 6467–6475. [PMC free article] [PubMed]
  • Colbert, C. L., Couture, M. M., Eltis, L. D. & Bolin, J. T. (2000). Structure, 8, 1267–1278. [PubMed]
  • Ferraro, D. J., Brown, E. N., Yu, C. L., Parales, R. E., Gibson, D. T. & Ramaswamy, S. (2007). BMC Struct. Biol.7, 10. [PMC free article] [PubMed]
  • Furukawa, K., Suenaga, H. & Goto, M. (2004). J. Bacteriol.186, 5189–5196. [PMC free article] [PubMed]
  • Habe, H. & Omori, T. (2003). Biosci. Biotechnol. Biochem.67, 225–243. [PubMed]
  • Hannemann, F., Bichet, A., Ewen, K. M. & Bernhardt, R. (2007). Biochim. Biophys. Acta, 1770, 330–344. [PubMed]
  • Herman, P. L., Behrens, M., Chakraborty, S., Chrastil, B. M., Barycki, J. & Weeks, D. P. (2005). J. Biol. Chem.280, 24759–24767. [PubMed]
  • Inoue, K., Ashikawa, Y., Usami, Y., Noguchi, H., Fujimoto, Z., Yamane, H. & Nojiri, H. (2006). Acta Cryst. F62, 1212–1214. [PMC free article] [PubMed]
  • Inoue, K., Ashikawa, Y., Usami, Y., Noguchi, H., Fujimoto, Z., Yamane, H. & Nojiri, H. (2007). Acta Cryst. F63, 855–857. [PMC free article] [PubMed]
  • Matthews, B. W. (1968). J. Mol. Biol.33, 491–497. [PubMed]
  • Nam, J.-W., Noguchi, H., Fujimoto, Z., Mizuno, H., Ashikawa, Y., Abo, M., Fushinobu, S., Kobashi, K., Wakagi, T., Iwata, K., Yoshida, T., Habe, H., Yamane, H., Omori, T. & Nojiri, H. (2005). Proteins, 58, 779–789. [PubMed]
  • Nam, J.-W., Nojiri, H., Noguchi, H., Uchimura, H., Yoshida, T., Habe, H., Yamane, H. & Omori, T. (2002). Appl. Environ. Microbiol.68, 5882–5890. [PMC free article] [PubMed]
  • Nojiri, H., Ashikawa, Y., Noguchi, H., Nam, J.-W., Urata, M., Fujimoto, Z., Yoshida, T., Habe, H. & Omori, T. (2005). J. Mol. Biol.351, 355–370. [PubMed]
  • Nojiri, H. & Omori, T. (2002). Biosci. Biotechnol. Biochem.66, 2001–2016. [PubMed]
  • Nojiri, H. & Omori, T. (2007). Pseudomonas, Vol. 5, A Model System in Biology, edited by J. L. Ramos & A. Filloux, pp. 107–145. New York, USA: Kluwer Academic/Plenum Publishers.
  • Otwinowski, Z. & Minor, W. (1997). Methods Enzymol.276, 307–326.
  • Pieper, D. H. (2005). Appl. Microbiol. Biotechnol.67, 170–191. [PubMed]
  • Pikuleva, I. A., Tesh, K., Waterman, M. R. & Kim, Y. (2000). Arch. Biochem. Biophys.373, 44–55. [PubMed]
  • Pochapsky, T. C., Jain, N. U., Kuti, M., Lyons, T. A. & Heymont, J. (1999). Biochemistry, 38, 4681–4690. [PubMed]
  • Poulos, T. L. (2003). Biochem. Biophys. Res. Commun.312, 35–39. [PubMed]
  • Rieske, J. S., MacLennan, D. H. & Coleman, R. (1964). Biochem. Biophys. Res. Commun.15, 338–344.
  • Sainz, G., Jakoncic, J., Sieker, L. C., Stojanoff, V., Sanishvili, N., Asso, M., Bertrand, P., Armengaud, J. & Jouanneau, Y. (2006). J. Biol. Inorg. Chem.11, 235–246. [PubMed]
  • Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: A Laboratory Manual, 3rd ed. New York: Cold Spring Harbor Laboratory Press.
  • Sauber, K., Fröhner, C., Rosenberg, G., Eberspächer, J. & Lingens, F. (1977). Eur. J. Biochem.74, 89–97. [PubMed]
  • Senda, M., Kishigami, S., Kimura, S., Fukuda, M., Ishida, T. & Senda, T. (2007). J. Mol. Biol.373, 382–400. [PubMed]
  • Sevrioukova, I. F., Garcia, C., Li, H., Bhaskar, B. & Poulos, T. L. (2003). J. Mol. Biol.333, 377–392. [PubMed]
  • Shintani, M., Urata, M., Inoue, K., Eto, K., Habe, H., Omori, T., Yamane, H. & Nojiri, H. (2007). J. Bacteriol.189, 2007–2020. [PMC free article] [PubMed]
  • Smith, N., Mayhew, M., Holden, M. J., Kelly, H., Robinson, H., Heroux, A., Vilker, V. L. & Gallagher, D. T. (2004). Acta Cryst. D60, 816–822. [PubMed]
  • Tagawa, K. & Arnon, D. I. (1962). Nature (London), 195, 537–543. [PubMed]
  • Urata, M., Uchimura, H., Noguchi, H., Sakaguchi, T., Takemura, T., Eto, K., Habe, H., Omori, T., Yamane, H. & Nojiri, H. (2006). Appl. Environ. Microbiol.72, 3206–3216. [PMC free article] [PubMed]

Articles from Acta Crystallographica Section F: Structural Biology and Crystallization Communications are provided here courtesy of International Union of Crystallography