PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Genesis. Author manuscript; available in PMC 2008 June 17.
Published in final edited form as:
PMCID: PMC2430471
NIHMSID: NIHMS53694

Tissue-specific expression of Cre recombinase from the Tgfb3 locus

Summary

Tgfb3, a member of the TGF-β superfamily, is tightly regulated, both spatially and temporally, during embryogenesis. Previous mouse knockout studies have demonstrated that Tgfb3 is absolutely required for normal palatal fusion and pulmonary development. We have generated a novel tool to ablate genes in Tgfb3-expressing cells by targeting the promoterless Cre-pgk-Neo cassette into exon 1 of the mouse Tgfb3 gene, which generates a functionally null Tgfb3 allele. Using the Rosa26 reporter assay, we demonstrate that Cre-induced recombination was already induced at embryonal day 10 (E10) in the ventricular myocardium, limb buds and otic vesicles. At E14, robust recombination was detected in the prefusion palatal epithelium. Deletion of the TGF-β type I receptor Alk5 (Tgfbr1) specifically in Tgfb3 expressing cells using the Tgfb3-Cre driver line lead to a cleft palate phenotype similar to that seen in conventional Tgfb3 null mutants. In addition, Alk5/Tgfb3-Cre mice displayed hydrocephalus, and severe intracranial bleeding due to germinal matrix hemorrhage.

Keywords: TGF-β, palatogenesis, cleft palate, Transforming growth factor, development, mouse

In mammals, three different TGF-β-isoforms (TGF-β1, -β2 and –β3) are encoded by three separate genes. Their expression patterns are both spatially and temporally distinct during embryogenesis, and knockout studies have demonstrated that they display specialized roles in vivo (Shull et al. 1992;Proetzel et al. 1995;Kaartinen et al. 1995;Sanford et al. 1997). Mice lacking Tgfb3 display a specific non-redundant role in palatal fusion, which is consistent with its strong and specific expression in the epithelium of the prefusion palatal shelves. Subsequent studies have shown that during palatogenesis TGF-β3 regulates adhesion and intercalation of midline epithelial cells, programmed cell death, and degradation of the basement membrane (Blavier et al. 2001;Cuervo et al. 2002;Martinez-Alvarez et al. 2000;Gato et al. 2002).

TGF-βs signal through functional heterotetrameric complexes that contain two type II (Tgfbr2) and two type I (Alk5) transmembrane serine/threonine kinase receptors (Derynck and Feng 1997;Massague 1998). Deletion of Alk5 and Tgfbr2 in the palatal epithelium using the cytokeratin-14 (K14) promoter-driven Cre recombinase has demonstrated the importance of these two genes in palatal fusion (Dudas et al. 2006;Xu et al. 2006). Although cytokeratin promoter regions, e.g., K5 and K14, are valuable for targeting transgene expression to epithelia with different differentiation states, none of the existing keratin promoters can mimic the spatio-temporal expression of Tgfb3 during palatogenesis.

To provide a tool to study genes involved in palatal fusion and other developmental processes controlled by TGF-β3, we generated a Tgfb3-Cre knockin mouse model (Fig. 1). This was achieved by replacing the coding region of the Tgfb3 gene with the promoterless Cre-pgkneo cassette. Since all the promoter and regulatory elements of the Tgfb3 gene were essentially preserved, we predicted that Cre expression would faithfully recapitulate the endogenous expression pattern of the Tgfb3 gene. Once the heterozygote mice carrying the Cre-PGK-Neo cassette in the Tgfb3 locus were obtained, we analyzed Tgfb3-Cre-induced recombination during embryogenesis using the ROSA26R reporter assay (Soriano 1999). Cre-induced lacZ expression was examined by X-gal staining of the Tgfb3-Cre;R26R embryos from timed pregnancies in order to confirm the correlation between tissue-specific Cre activity and the previously published Tgfb3 expression pattern detected by in situ hybridization (Pelton et al. 1990;Millan et al. 1991). Moreover, in this analysis, β-galactosidase expression also marks cells that have expressed Tgfb3 at any earlier developmental time point.

FIG. 1
Generation of Tgfb3-Cre mice. (a) A schematic diagram of the Tgfb3-Cre targeting construct and the strategy for identifying the tar- geted allele. Gray shaded pl Cre/Neo box: the promotorless Cre gene followed by the neomycin-resistant gene driven by ...

Using whole mount lacZ staining, we observed the earliest β-galactosidase activity around embryonal day 8 (6–8 somite pairs) when a few scattered positively-staining cells became detectable (Fig. 2A, inset). At E9 (~16 somite pairs), β-galactosidase staining could be seen in the heart, pharyngeal arches and otic vesicle (Fig. 2B). At E10.0, scattered staining was observed in the ectoderm including the pharyngeal arches and limb buds. Strong lacZ staining was also detected in the otic vesicles, mid-brain, heart, somites, and tail (Fig. 2D, E). By E11, positive staining was more apparent at the pharyngeal arches and somatic regions. The left ventricle also stained strongly positive for lacZ (Fig. 2F, G). Sagittal sections of the X-gal stained embryos revealed that primodia of the mid-brain and hindbrain were LacZ-positive (Fig. 3A). At E14.0, the Cre-induced recombination was strikingly strong in the palatal epithelium (Fig. 2 I, L, M), while some sporadic positively staining cells could also be seen in the palatal mesenchyme (Fig. 2L, M). Positive staining was also detectable in the whisker follicles (Fig. 2H, J) and in the cartilaginous structures of the developing limbs (Fig. 2H), as well as in many mesenchymal structures in the lower jaw and the tongue (Fig. 2N). In contrast to the K14 expression pattern, which was restricted to relatively undifferentiated basal keratinocytes of the epidermis, transverse sections of the skin at E14 showed punctate staining in the epidermis (Fig. 2K). Coronal sections through the head showed positive staining in the choroid plexus of the IVth ventricle and lateral ventricles (Fig. 3B, C), as well as in the nasal epithelium (Fig. 3F). Sagittal sections through the head showed positive staining in vascular structures of the germinal matrix (Fig. 3 D, E). To summarize, lacZ positive staining of the palatal epithelium, the nasal epithelium, and the epithelium of the choroid plexus recapitulate the expression pattern previously reported for Tgfb3 via in situ hybridization (Pelton et al. 1990;Fitzpatrick et al. 1990;Millan et al. 1991). The expression of Tgfb3 in the vessel-like structures of the germinal matrix is previously unreported, indicating that TGFβ signaling may play a role in germinal matrix development.

FIG. 2
Analysis of the Tgfb3 expression pattern by Cre-induced recombination in Rosa26 reporter (R26R) mice. Embryos from timed matings between the R26R and the Tgfb3-Cre mice were stained with X-gal to follow Tgfb3 expressing cell lineages (a–g). Positive ...
FIG. 3
Tgfb3-Cre-induced recombination in Rosa26 reporter (R26R) mice. (a) Sagittal sections of the X-gal-stained embryos at E11 show positive staining in the primodia of midbrain and hindbrain (arrows). L: lateral ventricle; III: third ventricle; IV: fourth ...

To test whether the Tgfb3-Cre allele can induce efficient recombination in the palatal epithelium, we crossed male mice heterozygous for the Tgfb3-Cre and Alk5 knockout alleles with female mice homozygous for the floxed Alk5 allele (Larsson et al. 2001). Specific ablation of the Alk5 gene in Tgfb3-expressing cells, including the palatal epithelium, should theoretically lead to a cleft palate phenotype, since TGF-β3 knockout mice display complete cleft palate (Kaartinen et al. 1995;Proetzel et al. 1995). Embryos were harvested at E17.0 and the palatal phenotype was analyzed using stereomicroscopic and histological analyses (Fig. 4). Indeed, Alk5KO/FX/Tgfb3-CreHE (termed herein Alk5/Tgfb3-Cre) mice displayed a complete cleft of the secondary palate identical to that seen in Tgfb3 knockout mice. This result demonstrated that Tgfb3-Cre mice can be used as a tool to assess the function of genes in the palatal epithelium during palate formation.

FIG. 4
Tgfb3-Cre driven abrogation of the TGF-β type I receptor Alk5 leads to a palatal phenotype identical to that seen in Tgfb3 null mice. Stereoscopic images of the formalin-fixed E17 heads from wildtype (a), Tgfb3−/− (b), and Alk5/Tgfb3-Cre ...

In addition to cleft palate, at E17 Alk5/Tgfb3-Cre mice displayed intracranial hemorrhage and tissue destruction at the hindbrain region (Fig. 5 A-F). Coronal sections of the brain revealed that mutant mice suffer from hydrocephalus, with pronounced dilatation of all the ventricles. Pressure generated from the increased volume of cerebrospinal fluid (CSF) led to compression of the cerebellum. Subsequent studies indicated that the intracranial bleeding was already detectable in embryos at E14 stage. We excluded the cause of this bleeding being secondary to incompetence of the major arteries of the brain by injection of Indian ink to the left cardiac ventricle at E14 (Fig. 5 G, H). Instead, detailed analysis of this intracranial bleeding revealed a blood clot that was trapped in the region surrounding the venous sinuses (Fig. 5I), the site where CSF is absorbed into the venous system. This observation, together with the finding that all ventricles were dilated and the neural tube was not completely closed at E17, suggest that deletion of Alk5 in the TGF-β3 expressing cells caused a non-obstructive type of hydrocephalus with blood clotting at the CSF absorption area, possibly the arachnoid villi. Moreover, histological analysis of sagittal sections of the mutant head at E14 demonstrated bleeding in the germinal matrix, resulting in intraventricular bleeding (Fig. 5J-O). These results imply a role for TGFβ signaling in maintenance of vasculature integrity within the germinal matrix. Therefore, the Tgfb3-Cre mouse also provides a powerful tool for studies of the blood-brain barrier.

FIG. 5
Analysis of the intracranial hemorrhage phenotype resulting from Tgfb3-Cre driven abrogation of the TGF-β type I receptor Alk5. (a–f) Stereoscopic and histological images of the control (a–c) and Alk5/Tgfb3-Cre mutant samples (d–f) ...

To conclude, the Tgfb3-Cre mouse model will be a valuable tool to analyze genes of interest in the prefusion palatal epithelium during facial development. We expect that in these mice, temporal control of Cre expression will be more accurately achieved than in K14-Cre mice, which have been traditionally used to induce recombination in the palatal epithelium (Gritli-Linde 2007;Wang et al. 2006;Xu et al. 2006). Moreover, these mice may be used to assess gene function in other organs and cell types, including vasculature of the central nervous system.

Material and Methods

Generation of the Tgfb3-Cre mouse line

A targeting vector was generated by combining a 9-kb clone isolated from the B6xCBA (F1) mouse genomic library (right arm), a 1.6-kb PCR fragment amplified from the R1-ES cell DNA (left arm), and a cassette containing a promoterless Cre gene and a neomycin-resistant gene driven by the phosphoglycerate kinase promoter (PGK-Neo) to replace the coding region of the ATG containing exon 1 of the Tgfb3 gene. Briefly, a 1.6-kb PCR-amplified 5′ XbaI-BamHI genomic fragment, the Cre-pgk-Neo, and a 10-kb 3′ NotI-EcoRI genomic fragment (generated by fusing a 2.6-kb Not1-Kpn1 PCR fragment with a 7.6-kb KpnI-EcoRI fragment from the library clone) containing exons 2 and 3 were subcloned into the pKOdt plasmid (Stratagene). R1-ES cells were cultured, electroporated and screened as previously described (Kaartinen et al., 1995; Kaartinen et al., 2004). Targeted colonies were initially identified by PCR amplification of a 2-kb fragment using a 5′-arm outside sense primer, primer1 (GCATGCTCCAGACTGCCTTGGGA) and a Cre anti-sense primer, primer 2 (CCTCATTCACTCGTTGCATCGACCGG). Southern blot analyses of genomic DNAs, digested with both ClaI and KpnI, were used to confirm homologous recombination of the targeted allele using the Cre and Neo probes. A total of 7 positive homologous recombinant ES cells clones were obtained from 260 G418-resistant clones. ES cells from two independent targeted clones were microinjected into C57/BL6J blastocysts by the transgenic core facility at the University of Southern California. Three male chimeras (male/female ratio was 9:3) were used to produce heterozygote Tgfb3-Cre mice.

Mouse breeding, embryo isolation, and genotype assays

ROSA26 Cre reporter mice were obtained from the Jackson laboratory (Bar Harbor, ME, USA). Mice carrying the Alk5flox and Alk5ko alleles were obtained from S. Karlsson (Lund University Hospital, Lund, Sweden). Tgfb3-Cre mice were generated as described above. All mice were bred to have a mixed genetic background. Mice were mated during the dark period of the controlled light cycle. Female mice acquiring vaginal plugs were designated as day 0. At the time interval indicated in respective figures (E14 to E17), females were euthanized by CO2 and embryos were extracted in PBS (Invitrogen) followed by further analyses. All studies and procedures performed on mice were carried out at the Animal Care Facility of the Saban Research Institute, and were approved by the CHLA Animal Care and Use Committee (IACUC). Mouse tail biopsies were colleted and genotyped by PCR. Oligos for genotyping of the Alk5flox, Alk5ko, and Cre alleles have been described elsewhere (Dudas et al. 2006).

Histological analyses and X-gal staining

Mouse embryos or tissues were fixed in 4% formaldehyde plus 0.2% glutaraldehyde for 24 h, and paraffin sections were stained with hematoxylin-eosin following the standard procedure. For whole-mount X-gal staining, embryos or tissues were fixed in 2% formaldehyde plus 0.2% glutaraldehyde for 20 minutes at RT, washed in a detergent wash solution, and developed in X-gal solution for 4 hours to overnight. For X-gal staining of frozen sections, tissues were fixed in 4% formaldehyde for 30 minutes on ice, and embedded in OCT. Frozen sections were then stained with X-gal solution for 5 hours (Hogan et al., 1994).

Acknowledgments

We thank S. Karlsson for the Alk5FXFX mice and I. Gonzalez-Gomez for help in phenotype analyses. LTY was supported by a grant from the CIRM (T2-00005) and VK by grants from the NIH (HL074862 and DE013085).

Reference List

  • Blavier L, Lazaryev A, Groffen J, Heisterkamp N, DeClerck YA, Kaartinen V. TGF-beta3-induced palatogenesis requires matrix metalloproteinases. Mol Biol Cell. 2001;12:1457–1466. [PMC free article] [PubMed]
  • Cuervo R, Valencia C, Chandraratna RA, Covarrubias L. Programmed cell death is required for palate shelf fusion and is regulated by retinoic acid. Dev Biol. 2002;245:145–156. [PubMed]
  • Derynck R, Feng XH. TGF-beta receptor signaling. Biochim Biophys Acta. 1997;1333:F105–F150. [PubMed]
  • Dudas M, Kim J, Li WY, Nagy A, Larsson J, Karlsson S, Chai Y, Kaartinen V. Epithelial and ectomesenchymal role of the type I TGF-beta receptor ALK5 during facial morphogenesis and palatal fusion. Dev Biol. 2006;296:298–314. [PMC free article] [PubMed]
  • Fitzpatrick DR, Denhez F, Kondaiah P, Akhurst RJ. Differential expression of TGF beta isoforms in murine palatogenesis. Development. 1990;109:585–595. [PubMed]
  • Gato A, Martinez ML, Tudela C, Alonso I, Moro JA, Formoso MA, Ferguson MW, Martinez-Alvarez C. TGF-beta(3)-induced chondroitin sulphate proteoglycan mediates palatal shelf adhesion. Dev Biol. 2002;250:393–405. [PubMed]
  • Gritli-Linde A. Molecular control of secondary palate development. Dev Biol. 2007;301:309–326. [PubMed]
  • Kaartinen V, Voncken JW, Shuler C, Warburton D, Bu D, Heisterkamp N, Groffen J. Abnormal lung development and cleft palate in mice lacking TGF-beta 3 indicates defects of epithelial-mesenchymal interaction. Nat Genet. 1995;11:415–421. [PubMed]
  • Larsson J, Goumans MJ, Sjostrand LJ, van Rooijen MA, Ward D, Leveen P, Xu X, ten Dijke P, Mummery CL, Karlsson S. Abnormal angiogenesis but intact hematopoietic potential in TGF-beta type I receptor-deficient mice. EMBO J. 2001;20:1663–1673. [PubMed]
  • Martinez-Alvarez C, Bonelli R, Tudela C, Gato A, Mena J, O’Kane S, Ferguson MW. Bulging medial edge epithelial cells and palatal fusion. Int J Dev Biol. 2000;44:331–335. [PubMed]
  • Massague J. TGF-beta signal transduction. Annu Rev Biochem. 1998;67:753–791. [PubMed]
  • Millan FA, Denhez F, Kondaiah P, Akhurst RJ. Embryonic gene expression patterns of TGF beta 1, beta 2 and beta 3 suggest different developmental functions in vivo. Development. 1991;111:131–143. [PubMed]
  • Pelton RW, Dickinson ME, Moses HL, Hogan BL. In situ hybridization analysis of TGF beta 3 RNA expression during mouse development: comparative studies with TGF beta 1 and beta 2. Development. 1990;110:609–620. [PubMed]
  • Proetzel G, Pawlowski SA, Wiles MV, Yin M, Boivin GP, Howles PN, Ding J, Ferguson MW, Doetschman T. Transforming growth factor-beta 3 is required for secondary palate fusion. Nat Genet. 1995;11:409–414. [PubMed]
  • Sanford LP, Ormsby I, Gittenberger-de Groot AC, Sariola H, Friedman R, Boivin GP, Cardell EL, Doetschman T. TGFbeta2 knockout mice have multiple developmental defects that are non- overlapping with other TGFbeta knockout phenotypes. Development. 1997;124:2659–2670. [PubMed]
  • Shull MM, Ormsby I, Kier AB, Pawlowski S, Diebold RJ, Yin M, Allen R, Sidman C, Proetzel G, Calvin D. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature. 1992;359:693–699. [PubMed]
  • Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 1999;21:70–71. [PubMed]
  • Wang J, Nagy A, Larsson J, Dudas M, Sucov HM, Kaartinen V. Defective ALK5 signaling in the neural crest leads to increased postmigratory neural crest cell apoptosis and severe outflow tract defects. BMC Dev Biol. 2006;6:51–51. [PMC free article] [PubMed]
  • Xu X, Han J, Ito Y, Bringas P, Jr, Urata MM, Chai Y. Cell autonomous requirement for Tgfbr2 in the disappearance of medial edge epithelium during palatal fusion. Dev Biol. 2006;297:238–248. [PubMed]