PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of mbcLink to Publisher's site
 
Mol Biol Cell. 2008 February; 19(2): 498–508.
PMCID: PMC2230594

B-RAF Regulation of Rnd3 Participates in Actin Cytoskeletal and Focal Adhesion Organization

Jean Schwarzbauer, Monitoring Editor

Abstract

The actin cytoskeleton controls multiple cellular functions, including cell morphology, movement, and growth. Accumulating evidence indicates that oncogenic activation of the mitogen-activated protein kinase kinase/extracellular signal-regulated kinase 1/2 (MEK/ERK1/2) pathway is accompanied by actin cytoskeletal reorganization. However, the signaling events contributing to actin cytoskeleton remodeling mediated by aberrant ERK1/2 activation are largely unknown. Mutant B-RAF is found in a variety of cancers, including melanoma, and it enhances activation of the MEK/ERK1/2 pathway. We show that targeted knockdown of B-RAF with small interfering RNA or pharmacological inhibition of MEK increased actin stress fiber formation and stabilized focal adhesion dynamics in human melanoma cells. These effects were due to stimulation of the Rho/Rho kinase (ROCK)/LIM kinase-2 signaling pathway, cumulating in the inactivation of the actin depolymerizing/severing protein cofilin. The expression of Rnd3, a Rho antagonist, was attenuated after B-RAF knockdown or MEK inhibition, but it was enhanced in melanocytes expressing active B-RAF. Constitutive expression of Rnd3 suppressed the actin cytoskeletal and focal adhesion effects mediated by B-RAF knockdown. Depletion of Rnd3 elevated cofilin phosphorylation and stress fiber formation and reduced cell invasion. Together, our results identify Rnd3 as a regulator of cross talk between the RAF/MEK/ERK and Rho/ROCK signaling pathways, and a key contributor to oncogene-mediated reorganization of the actin cytoskeleton and focal adhesions.

INTRODUCTION

Oncogene-mediated alterations in the actin cytoskeleton and focal adhesions play an important role in promoting tumor cell motility and invasion. A recently identified oncogene is the serine/threonine kinase B-RAF (Davies et al., 2002 blue right-pointing triangle; Wellbrock et al., 2004 blue right-pointing triangle). Mutations in B-RAF have been found in ~70% of melanomas, 35% of thyroid carcinomas, 14% of borderline ovarian cancers, and 11% of colorectal cancers (Davies et al., 2002 blue right-pointing triangle; Rajagopalan et al., 2002 blue right-pointing triangle; Kimura et al., 2003 blue right-pointing triangle). The most common mutation encodes for a glutamic acid substitution (V600E) within the activation loop of B-RAF, resulting in enhanced activation of B-RAF and the mitogen-activated protein kinase kinase/extracellular signal-regulated kinase 1/2 (MEK/ERK1/2) pathway (Davies et al., 2002 blue right-pointing triangle). A higher proportion of B-RAF mutations are present in invasive, vertical growth phase (VGP) tumors (62%) compared with noninvasive radial growth phase tumors (10%) (Dong et al., 2003 blue right-pointing triangle). Furthermore, B-RAFV600E and MEK activity have been shown to be required for melanoma cell invasion in vitro (Huntington et al., 2004 blue right-pointing triangle; Sumimoto et al., 2004 blue right-pointing triangle). However, the mechanisms underlying B-RAF regulation of tumor invasion are incompletely understood.

Rho GTPases are key regulators of the actin cytoskeleton and focal adhesions. RhoA/B/C (hereafter collectively referred to as Rho) enhance actin stress fiber formation via multiple effectors (Ridley and Hall, 1992 blue right-pointing triangle; Chrzanowska-Wodnicka and Burridge, 1996 blue right-pointing triangle). One effector pathway involves the serine/threonine kinases, Rho kinase (ROCK)I/II, which increase actin polymerization by inhibiting the actin-severing activity of cofilin via LIM kinases-1/2 (Ohashi et al., 2000a blue right-pointing triangle). ROCKs also promote myosin-mediated cross-linking of actin filaments through increasing myosin light chain phosphorylation (Kimura et al., 1996 blue right-pointing triangle), although recent studies indicate that ROCKI and ROCKII elicit distinct effects on the actin cytoskeleton (Yoneda et al., 2007 blue right-pointing triangle). Independently of ROCKs, Rho also promotes actin polymerization through binding and activation of the formin protein mDia1 (Watanabe et al., 1999 blue right-pointing triangle). Notably, alterations in the control of Rho GTPases have been linked to cancer (Jaffe and Hall, 2005 blue right-pointing triangle).

Other Rho GTPase family members counterbalance Rho activity (Aspenstrom et al., 2004 blue right-pointing triangle). In particular, Rnd3/RhoE/Rho8 (referred to as Rnd3) has been shown to antagonize Rho/ROCK signaling and to disrupt actin stress fibers and focal adhesions in fibroblast and epithelial cells (Guasch et al., 1998 blue right-pointing triangle; Nobes et al., 1998 blue right-pointing triangle; Aspenstrom et al., 2004 blue right-pointing triangle; Chardin, 2006 blue right-pointing triangle). These effects of Rnd3 have been attributed to enhanced activity of p190RhoGAP (Wennerberg et al., 2003 blue right-pointing triangle) and inhibition of ROCKI (Riento et al., 2003 blue right-pointing triangle). The influence of Rnd3 on actin cytoskeletal organization has been implicated in the regulation of cell migration (Guasch et al., 1998 blue right-pointing triangle) and invasion (Gadea et al., 2007 blue right-pointing triangle). In addition, Rnd3 may also play an important role in cell transformation (Hansen et al., 2000 blue right-pointing triangle; Villalonga et al., 2004 blue right-pointing triangle) and ROCK-mediated apoptosis (Ongusaha et al., 2006 blue right-pointing triangle).

In this study, we provide evidence that mutant B-RAF in melanoma cells disrupts actin cytoskeletal organization and focal adhesion dynamics through control of Rho GTPase signaling. These effects were mediated through B-RAF-MEK suppression of the Rho/ROCK/LIM kinase/cofilin pathway and control of Rnd3 expression.

MATERIALS AND METHODS

Cell Culture

Human WM793 and WM115 VGP melanoma cells were kindly provided by Dr. Meenhard Herlyn (Wistar Institute, Philadelphia, PA) (Satyamoorthy et al., 1997 blue right-pointing triangle). Melanoma cells were cultured in MCDB 153 (Sigma-Aldrich, St. Louis, MO) containing 20% Leibovitz L-15 medium (Mediatech, Herndon, VA), 2% fetal bovine serum (HyClone Laboratories, Logan, UT), 0.2% (wt/vol) sodium bicarbonate (Mediatech), and 5 μg/ml insulin (Sigma-Aldrich) at 37°C with 5% CO2. Neonatal foreskins were obtained according to Albany Medical College Institutional Review Board procedures. Normal human epidermal melanocytes (NHEMs) were isolated and cultured, as described previously (Conner et al., 2003 blue right-pointing triangle).

Antibodies and Inhibitors

The following antibodies were used: ROCKI (611136) and ROCKII (610623) were from BD Biosciences (San Jose, CA); phospho-(S3)-cofilin (3311), phospho-ERK1/2 (9106), phospho-MEK1/2 (9121), myc-tag (2276 and 2272), and hemagglutinin (HA)-tag (2367) were from Cell Signaling Technology (Danvers, MA); total cofilin (ACFL02) was from Cytoskeleton (Denver, CO); B-RAF (sc5284), ERK2 (sc154), total MEK1 (sc219), and Rho (sc179, which detects RhoA/B/C) were from Santa Cruz Biotechnology (Santa Cruz, CA); RhoE/Rnd3 (05-723) and phospho-tyrosine (clone 4G10) were from Upstate Biotechnology (Lake Placid, NY); and vinculin (V4505) and Flag-tag (F3165) were from Sigma-Aldrich. In some experiments, cells were treated with the MEK inhibitor U0126 (Cell Signaling Technology) or the ROCK inhibitor Y27632 (Calbiochem, San Diego, CA).

Plasmids, Transfections, and Infections

The following plasmids were used in this study: pRc-CMV-C3 encoding the C3 transferase exotoxin (Sekine et al., 1989 blue right-pointing triangle; kindly provided by Dr. Jeffrey Settleman, Massachusetts General Hospital, Boston, MA); HA-tagged wild-type and kinase-dead versions of LIM kinase-1 and -2 in pcDNA3 (Sumi et al., 1999 blue right-pointing triangle; kindly provided by Drs. Toshikazu Nakamura and Tomoyuki Sumi, Biomedical Research Center, Osaka University, Osaka, Japan); myc-tagged nonphosphorylatable S3A cofilin in pcDNA3 (Arber et al., 1998 blue right-pointing triangle; kindly provided by Dr. Pico Caroni, Friedrich Miescher Institute, Basel, Switzerland); green fluorescent protein (GFP)-vinculin (Balaban et al., 2001 blue right-pointing triangle; kindly provided by Dr. Benjamin Geiger, Weizmann Institute of Science, Rehovot, Israel); glutathione transferase (GST)-rhotekin Rho binding domain (RBD) (Ren et al., 1999 blue right-pointing triangle; kindly provided by Dr. Martin Schwartz, University of Virginia, Charlottesville, VA), pFL-mDia1N1 encoding the Rho-binding domain of mDia1 (Watanabe et al., 1999 blue right-pointing triangle; kindly provided by Dr. Shuh Narumiya, Kyoto University, Kyoto, Japan); and myc-tagged Rnd3 in pRK5-myc (Aspenstrom et al., 2004 blue right-pointing triangle; kindly provided by Dr. Pontus Aspenström, Uppsala University, Uppsala, Sweden). For transient transfections, cells were grown to 50–60% confluency, and then they were transfected with expression plasmids using TransIT-LT1 reagent (Mirus Bio, Madison, WI) in complete medium, according to manufacturer's instructions. Cells were processed 36 h after the start of the transfection, unless otherwise indicated.

Adenoviral infections were performed as described previously (Bhatt et al., 2005 blue right-pointing triangle). The delta B-RAF-ER* cDNA in pBabepuro3 was a generous gift from Dr. Martin McMahon (Cancer Research Institute and Department of Cellular and Molecular Pharmacology, UCSF, San Francisco, CA). Delta B-RAF-ER* expresses an N-terminally truncated active form of B-RAF fused to a modified (G525R) estrogen receptor hormone domain (McMahon, 2001 blue right-pointing triangle). The delta B-RAF-ER* sequence was subcloned into pAdTrack vector, and recombinant adenovirus was generated (Bhatt et al., 2005 blue right-pointing triangle). NHEMs were infected with either pAdTrack that encodes GFP or pAdTrack delta B-RAF-ER* for 12 h and treated with 1 μM tamoxifen (Sigma-Aldrich) for 18 h.

RNA Interference

B-RAF#1 small interfering RNA (siRNA) to knockdown total B-RAF and B-RAFV600E siRNA designed to target B-RAF harboring the V600E mutation have been described previously (Calipel et al., 2003 blue right-pointing triangle; Boisvert-Adamo and Aplin, 2006 blue right-pointing triangle). Two different siRNA duplexes targeting Rnd3 were used: Rnd#1 (CUACAGUGUUUGAGAAUUAUU) and Rnd#2 (GCGGACAGAUGUUAGUACAUU) (Dharmacon RNA Technologies, Lafayette, CO). The nontargeting siControl#1 was also used (Dharmacon RNA Technologies). The siRNAs were transfected into melanoma cells at a final concentration of 25 nM, using Oligofectamine (Invitrogen, Carlsbad, CA). After transfection, cells were cultured for an additional 72 h in complete medium, and then they were processed for further analysis.

Site-directed Mutagenesis

A siRNA-resistant version of B-RAFV600E (B-RAFV600E*) was constructed from pEF-myc-B-RAFV600E donated by Dr. Richard Marais (Institute of Cancer Research, London, United Kingdom) (Davies et al., 2002 blue right-pointing triangle). pEF-myc-B-RAFV600E was mutated via inverse-polymerase chain reaction (PCR) mutagenesis by using forward primer ATCGCGATCTCAAGAGTAATAATATATTTCTTCAT and reverse primer GGATGATTGACTTGGCGTGTAAGTAA (underlined bases signify silent mutations intended to disrupt siRNA:mRNA interactions). The PCR-generated amplicons were cleaned with GeneClean kit (Qbiogene, Irvine, CA) and treated with PNK (MBI Fermentas, Hanover, MD) following manufacturer's protocol. DNA was treated with T4 DNA ligase (Invitrogen) and used to transform competent DH5α cells. Colonies were screened by complete DNA sequencing to verify proper mutagenesis.

Imaging

Cells on glass coverslips were washed with phosphate-buffered saline (PBS), fixed with 3.7% paraformaldehyde for 20 min, permeabilized with 0.2% Triton X-100 for 5 min, and blocked in 1% bovine serum albumin (BSA)/PBS for 2 h at room temperature. Coverslips were then incubated with primary antibodies diluted 1:200 in 1% BSA/PBS overnight at 4°C. Coverslips were washed three times with PBS before incubation with appropriate Alexa Fluor-conjugated secondary antibodies (Invitrogen), diluted 1:1000; for 1 h at room temperature. In some instances, the coverslips were incubated with tetramethylrhodamine B isothiocyanate (TRITC)-conjugated phalloidin (Sigma- Aldrich) diluted 1:2000 in 1% BSA/PBS for 1 h to visualize F-actin. Coverslips were mounted using Gel/Mount (Biomedia, Foster City, CA). An Olympus BMX-60 microscope equipped with a cooled charge-coupled device (CCD) sensi-camera (Cooke, Auburn Hills, MI) was used to examine samples. Images were acquired using Slidebook software (Intelligent Imaging Innovations, Denver, CO).

The percentage of cells displaying alterations in cytoskeletal organization was determined in cells costained for F-actin and the appropriate epitope-tag. Quantitation was determined from counting at least 200 transfected cells from multiple experiments, and these cells were compared with cells expressing GFP. Focal adhesion numbers and size were quantified using Image-Pro Plus software (Media Cybernetics, Silver Springs, MD). An integrated morphometric analysis was performed on images to select objects of a size range of 0.1 ≤ n ≤ 100 μm2 as focal adhesions based on the anti-vinculin staining.

Focal adhesion turnover was examined using previously described methods (Webb et al., 2004 blue right-pointing triangle). In brief, subconfluent WM793 cells treated with siRNA for 72 h were transfected with a GFP-vinculin expression plasmid for an additional 24 h. Cells were then imaged using an Olympus BMX-60 inverted microscope. Images were acquired every 2 min over a 20-min interval with a cooled CCD sensi-camera using Image-Pro Plus software. GFP-vinculin containing adhesions were monitored by marking the position of each adhesion at the initial frame and by monitoring its dynamics throughout the experiment.

Cellular Invasion

The polycarbonate filters of transwell cell culture chambers (8-μm pore size; Corning, Lowell, MA) were coated with 50 μl of growth factor-reduced Matrigel (BD Biosciences). Knockdown melanoma cells were added (3 × 104 cells in 100 μl) to the upper chamber in serum-free medium. The lower chamber was filled with normal melanoma growth medium, thereby establishing a soluble gradient of chemoattractants that promoted cellular invasion. The cells were allowed to invade for 24 h at 37°C, at which time the Matrigel and cells associated with the upper surface of the membranes were removed with cotton swabs. Cells that had invaded through the Matrigel were fixed in 3.7% formaldehyde, and nuclei were stained with Hoechst reagent 33342 (Invitrogen). The extent of cell invasion was determined from random fields at 10× magnification and quantified using Image-Pro Plus software.

SDS-Polyacrylamide Gel Electrophoresis and Western Blotting

Cell were lysed and analyzed as described previously (Conner et al., 2003 blue right-pointing triangle; Boisvert-Adamo and Aplin, 2006 blue right-pointing triangle). Immunoreactive bands were developed using enhanced chemiluminescence kits (Pierce Chemical, Rockford, IL). Protein bands were detected with a Fluor-S MultiImager (Bio-Rad, Hercules, CA), and band intensity was quantified using Quantity One image analysis (Bio-Rad).

Rho Pull-Down Assays

Cells were washed with ice-cold PBS and lysed in 50 mM Tris, pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 500 mM NaCl, and 10 mM MgCl2, supplemented with protease inhibitors. Cleared cell lysates were incubated with GST-rhotekin RBD (Ren et al., 1999 blue right-pointing triangle) attached to glutathione-Sepharose at 4°C for 1 h. The beads were washed three times with wash buffer (50 mM Tris, pH 7.2, 1% Triton X-100, 150 mM NaCl2, and 10 mM MgCl2) and resuspended in Laemmli's sample buffer. Precipitated Rho-GTP was determined by Western blot analysis.

Real-Time Quantitative Reverse Transcription (RT)-PCR

After knockdown, total RNA was extracted using the PURESCRIPT RNA Isolation kit (Gentra Systems, Minneapolis, MN). RNA was reverse transcribed, and the resulting cDNA was used to detect mRNA abundance with primers for actin (forward TACCTCATGAAGATCCTCACC and reverse TTTCGTGGATGCCACAGGAC) and Rnd3 (forward 5′-AATAGAGTTGAGCCTGTGGG-3′ and reverse 5′-CTAATGTACTAACATCTGTCCGC-3′). Rnd3 primers give a product of ~230 base pairs, and their specificity was confirmed by melt curve analysis. Reactions were performed using SYBR Green mix and the MyiQ Real-Time PCR detection system (Bio-Rad). Final concentrations of the reaction components were: 50 mM KCl, 20 mM Tris-HCl, pH 8.4, 0.2 mM dATP/dCTP/dGTP/dTTP, 25 U/ml DNA polymerase, 3 mM MgCl2, and 200 nM forward and reverse primers. Reaction conditions were denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and elongation at 72°C for 30 s; 40 cycles in total. Relative mRNA levels were calculated using the comparative Ct method (ΔCt) (Pfaffl, 2001 blue right-pointing triangle).

RESULTS

Mutant B-RAF Disrupts the Actin Cytoskeleton in Melanoma Cells

B-RAF depletion in WM793 cells, a human VGP melanoma cell line harboring a constitutive active B-RAFV600E allele, with siRNA targeting either total B-RAF (B-RAF#1) or B-RAFV600E (B-RAFV600E) decreased expression of B-RAF and phosphorylation of its downstream targets, MEK and ERK1/2 (Figure 1A). Knockdown was selective because no effect was observed on either C-RAF or A-RAF (Boisvert-Adamo and Aplin, 2006 blue right-pointing triangle). B-RAF knockdown WM793 cells were less refractive and displayed increased cell area by an average of 39.6% (Supplemental Figure S1, A and B) (Hingorani et al., 2003 blue right-pointing triangle). These observations prompted us to investigate the role of B-RAF in regulating the actin cytoskeleton in melanoma cells.

Figure 1.
B-RAF knockdown enhances actin stress fiber formation. WM793 cells were transfected with control, total B-RAF (B-RAF#1), or mutant B-RAF (B-RAFV600E) siRNA. (A) Cell lysates were analyzed by Western blotting for B-RAF, phospho-MEK1/2, MEK1, phospho-ERK1/2, ...

F-actin organization was determined in control and B-RAF knockdown cells by fluorescent microscopy. In control WM793 cells, F-actin structures were formed around the periphery of the cells with a few thin stress fibers located within the cell body (Figure 1B). By contrast, B-RAF knockdown in WM793 cells with either of the two B-RAF targeting siRNAs displayed enhanced levels of actin stress fibers, which traversed the cell body (Figure 1B). To address the specificity of B-RAF knockdowns, we mutated the human B-RAFV600E cDNA to introduce four base changes within the B-RAF#1 siRNA target site without altering the amino acid sequence, thereby allowing for expression of B-RAFV600E in melanoma cells treated with B-RAF#1 siRNA. The activity of this siRNA-resistant B-RAF (B-RAFV600E*) was comparable with the nonmutagenized B-RAFV600E, as measured by its ability to phosphorylate MEK1 in COS-7 cell cotransfection experiments (Supplemental Figure S2). Expression of siRNA-resistant B-RAFV600E* in B-RAF#1 knockdown WM793 cells led to the disruption of actin stress fiber organization in 74% of cells (Figure 1C). In control experiments, expression of GFP prevented B-RAF knockdown-induced actin stress fiber formation in only 7% of cells (Figure 1C). To ensure the effects of B-RAF knockdown on the actin cytoskeleton were applicable to more than one cell line, we performed similar experiments in WM115 cells, a VGP cell line that expresses the activating B-RAFV600D mutation (Davies et al., 2002 blue right-pointing triangle). Overall, the F-actin content seemed to be less structured in control WM115 cells compared with the WM793 cells. Importantly, B-RAF knockdown enhanced actin stress fiber formation in WM115 cells (Figure 1D and Supplemental Figure S3). In summary, these results show that mutant B-RAF regulates the actin cytoskeletal organization in melanoma cells.

The effects of B-RAF knockdown could possibly be attributed to cell cycle arrest because B-RAF knockdown inhibits cyclin D1 expression and G1-S cell cycle progression (Hingorani et al., 2003 blue right-pointing triangle; Sharma et al., 2005 blue right-pointing triangle; Bhatt et al., 2007 blue right-pointing triangle). However, knockdown of cyclin D1, which efficiently inhibits G1-S cell cycle progression in WM793 cells (Bhatt et al., 2005 blue right-pointing triangle), failed to promote actin stress fiber formation (Supplemental Figure S4). This provides evidence that B-RAF effects on the actin cytoskeleton are not mediated by cyclin D1-dependent downstream actions.

B-RAF Knockdown Regulates Focal Adhesions Dynamics

Focal adhesions mediate integrin-attachment to the extracellular matrix, anchor actin stress fibers, and modulate cell migratory behavior. We next determined whether B-RAF regulated focal adhesion organization. Control and B-RAF knockdown WM793 cells were stained for vinculin, a component of focal adhesions. Control knockdown cells displayed small punctate focal adhesions; by contrast, B-RAF knockdown cells displayed large elongated focal adhesions, which colocalized with the ends of stress fibers (Figure 2A). Quantitation showed no dramatic difference in the numbers of vinculin-staining focal adhesions between control and B-RAF knockdown cells (Figure 2B). However, the average area of focal adhesions and the number of large (>1 μm2) focal adhesions were increased after B-RAF knockdown (Figure 2, C and D). Focal adhesions are enriched in tyrosine-phosphorylated proteins, and larger focal adhesions were also detected after B-RAF knockdown by immunofluorescence with anti-phosphotyrosine antibodies (Figure 2E).

Figure 2.
B-RAF influences focal adhesion morphology and dynamics. WM793 cells were transfected with control or B-RAF#1 siRNA for 72 h. Subsequently, cells were fixed and processed for indirect immunofluorescence by staining with vinculin and Alexa Fluor 488-conjugated ...

The formation of larger focal adhesions in B-RAF knockdown cells is suggestive of altered focal adhesion turnover. Hence, we monitored focal adhesion dynamics by examining cells expressing GFP-vinculin. Control and B-RAF knockdown cells were transiently transfected with a GFP-vinculin expression plasmid before acquiring time-lapse images of vinculin-containing focal adhesions. In control siRNA knockdown cells (Figure 2F, top, and Supplemental Figure S5A and S5C), GFP-vinculin formed small focal adhesion structures that frequently assembled, disassembled, and translocated along the cell periphery during the 20-min imaging period. In contrast, B-RAF knockdown cells displayed GFP-vinculin that was incorporated into larger focal adhesions, and its presence in these structures was stable over the time period measured (Figure 2F, bottom, and Supplemental Figure S5B and S5D).

Mutant B-RAF Regulates Rho Activity but Does Not Alter ROCK Expression

Actin stress fiber formation is a characteristic feature of Rho GTPase signaling (Ridley and Hall, 1992 blue right-pointing triangle); hence, we analyzed Rho GTPase levels by using the rhotekin-RBD pull-down assay. Total levels of Rho did not change after B-RAF knockdown in WM793 cells (Figure 3A), as measured using an antibody that recognizes RhoA/B/C; however, GST-RBD pulled down 3.9-fold more GTP-bound RhoA/B/C from lysates of B-RAF knockdown cells compared with controls (Figure 3, A and B), suggesting enhanced Rho activity.

Figure 3.
B-RAF controls actin organization via the Rho/ROCK pathway. (A) Activation of Rho in control and B-RAF knockdown cells was measured using the GST-rhotekin pull-down assay. Levels of GTP-bound Rho were determined by Western blot analysis by using a pan-RhoA/B/C ...

We next determined whether the effects of B-RAF knockdown on the actin cytoskeleton were dependent on increased Rho activity. Initially, B-RAF knockdown WM793 cells were transfected with a C3 transferase expression construct. C3 transferase is a clostridium botulinum exoenzyme that ADP-ribosylates and inhibits Rho GTPase activity (Sekine et al., 1989 blue right-pointing triangle). Expression of C3 transferase in WM793, as determined by cotransfection with GFP, disrupted actin stress fibers in B-RAF knockdown cells (Figure 3C). We also used a construct encoding the Rho binding domain of mDia1 (mDia1N1) that interacts selectively with Rho-GTP, but not Rac1-GTP or Cdc42-GTP, and it blocks GTP-Rho activation of multiple downstream effectors (Watanabe et al., 1999 blue right-pointing triangle). Similar to expression of C3, mDiaN1 potently inhibited stress fiber formation in B-RAF knockdown WM793 cells (Figure 3D).

The findings that Rho signaling was required for enhanced actin stress fiber formation in B-RAF knockdown cells led to analysis of the Rho effector pathways used. Previous studies have shown that active MEK down-regulates expression of ROCKI and/or ROCKII (Sahai et al., 2001 blue right-pointing triangle; Pawlak and Helfman, 2002a blue right-pointing triangle,b blue right-pointing triangle). By Western blot analysis, we did not detect an alteration in the expression level of either ROCKI or ROCKII after B-RAF knockdown (Figure 3E). However, treatment of B-RAF knockdown cells with the ROCK inhibitor Y27632 attenuated actin stress fiber formation (Figure 3F). Together, these data show that signaling through the Rho/ROCK pathway enhances stress fiber formation after B-RAF knockdown. Our data do not rule out the involvement of additional Rho effectors.

LIM Kinase-2 Mediates Enhanced Actin Stress Fibers in B-RAF Knockdown Cells

Major effectors of Rho/ROCK signaling are the LIM kinases-1/2 (Maekawa et al., 1999 blue right-pointing triangle; Ohashi et al., 2000b blue right-pointing triangle; Sumi et al., 2001 blue right-pointing triangle). To determine whether LIM kinases play a role in melanoma actin organization, we expressed HA-tagged forms of LIM kinase-1 or -2 in WM793 cells, and we analyzed actin stress fiber formation. Ectopic expression of wild-type LIM kinase-2 led to enhanced actin stress fiber formation; whereas LIM kinase-1 elicited moderate effects (Figure 4, A and B). Quantitation showed that 66% of the LIM kinase-1 and 75% of the LIM kinase-2–expressing cells displayed enhanced stress fibers. In control experiments with GFP-expressing cells, only 16% of cells displayed prominent stress fibers (data not shown). Additionally, expression of kinase-dead LIM kinase-2 inhibited stress fiber formation induced by B-RAF knockdown in 67% of cells; whereas kinase-dead LIM kinase-1 only disrupted stress fibers in 17% of cells (Figure 4, C and D). These results suggest that, after B-RAF knockdown, LIM kinase-2 participates in the pathway activated by Rho to affect actin cytoskeletal organization.

Figure 4.
LIM kinase-2 mediates actin stress fiber formation after B-RAF knockdown. WM793 cells were transfected with HA-tagged wild-type (A) LIM kinase-1 or (B) LIM kinase-2. B-RAF knockdown WM793 cells were transfected with either kinase-dead HA-tagged (C) LIM ...

Cofilin Phosphorylation Is Regulated by B-RAF

The actin-severing protein cofilin is the principal known LIM kinase substrate (Arber et al., 1998 blue right-pointing triangle; Yang et al., 1998 blue right-pointing triangle). To investigate whether B-RAF signaling alters cofilin activity, we monitored phosphorylation at serine-3, which negatively regulates cofilin activity. B-RAF knockdown WM793 cells showed an average 4.5-fold increase in the level of phospho-cofilin compared with that of control transfectants (Figure 5A). Likewise, B-RAF knockdown in WM115 cells increased cofilin phosphorylation by an average of 3.1-fold (Figure 5B and Supplemental Figure S3). To examine the role of cofilin in melanoma cytoarchitecture, we analyzed the actin organization in B-RAF-depleted WM793 cells cotransfected with a constitutively active myc-tagged cofilin(S3A) mutant. Immunofluorescence staining showed that expression of myc-cofilin(S3A) prevented B-RAF knockdown generation of actin stress fibers (Figure 5C).

Figure 5.
Increased cofilin phosphorylation at serine-3 upon B-RAF knockdown. (A) Western blot analysis of phospho-(S3)-cofilin and total cofilin levels in WM793 cells transfected with control or B-RAF#1 siRNA. The graph represents the relative amounts of phospho-cofilin ...

We next assessed the involvement of ROCKI/II in B-RAF-mediated cofilin activation by treating cells with a ROCK inhibitor Y27632. Treatment with Y27632 lowered basal phospho-cofilin levels in control knockdown cells, and it moderately suppressed the increase in cofilin phosphorylation accompanying B-RAF knockdown (Figure 5D). This partial effect likely reflects an incomplete inhibition of ROCK activity by Y27632 and/or the involvement of additional Rho effectors. Nevertheless, these data implicate ROCKI/II signaling in B-RAF regulation of cofilin activation.

MEK Signaling Is Required for Actin Cytoskeletal Disruption and Cofilin Activation

Studies show that B-RAF is the main RAF activator of the MEK/ERK1/2 pathway (Huser et al., 2001 blue right-pointing triangle; Mikula et al., 2001 blue right-pointing triangle; Pritchard et al., 2004 blue right-pointing triangle). Treatment of WM793 cells with the pharmacological MEK inhibitor U0126, blocked ERK1/2 phosphorylation (Figure 6A) and it enhanced actin stress fiber formation (Figure 6B). Notably, despite the rapid inhibition of ERK1/2 phosphorylation by U0126, no alteration in actin organization was observed after short-term drug treatment. Rather, prolonged MEK inhibition (>12 h) was required to increase stress fiber formation. Consistent with a role for MEK signaling in the regulation of cofilin activity, treatment with U0126 enhanced cofilin phosphorylation (Figure 6A). Importantly, the kinetics of U0126-induced cofilin phosphorylation correlated with actin stress fiber formation. These data indicate that sustained MEK inactivation is necessary before the formation of stress fibers.

Figure 6.
MEK signaling regulates actin stress fibers and cofilin phosphorylation. WM793 cells were incubated with the MEK inhibitor U0126 (10 μM) or an equal volume of dimethyl sulfoxide (DMSO) (−) for 1, 6, 12, 24, and 48 h. (A) Cells lysates ...

Oncogenic B-RAF Activation of the MEK-ERK1/2 Pathway Increases Rnd3 Expression

Rnd3 is a member of the Rho-family of small GTP-binding proteins that has been implicated in the negative regulation of actin stress fiber formation (Riento et al., 2003 blue right-pointing triangle; Wennerberg et al., 2003 blue right-pointing triangle; Chardin, 2006 blue right-pointing triangle). Furthermore, Rnd3 has been shown to be regulated by ectopic expression of C-RAF and MEK activity in Madin-Darby canine kidney (MDCK) cells (Hansen et al., 2000 blue right-pointing triangle). We determined whether B-RAF-MEK signaling was necessary for Rnd3 expression in melanoma cells. Incubation of WM793 cells with the MEK inhibitor U0126 resulted in a time-dependent reduction in the level of Rnd3 (Figure 7A). The reduction in Rnd3 levels by U0126 preceded the accompanying increases in cofilin phosphorylation and actin stress fibers (compare Figure 7A and Figure 6, A and B). Expression of Rnd3 was also reduced after knockdown of total B-RAF or B-RAFV600E in WM793 cells (Figure 7B). Similar results were obtained in B-RAF knockdown WM115 cells (Figure 7C and Supplemental Figure S3). Real-time quantitative RT-PCR analysis showed that Rnd3 mRNA abundance was decreased following B-RAF knockdown (Figure 7D), indicating that B-RAF regulates Rnd3 mRNA levels.

Figure 7.
B-RAF and MEK regulate the expression of Rnd3. (A) WM793 cells were treated with 10 μM U0126 or equal volume DMSO for increasing times, as indicated. Cell lysates were western blotted using antibodies to Rnd3 and total MEK, as a loading control. ...

To determine whether B-RAF activation is sufficient to induce Rnd3 expression, normal human melanocytes were infected with an adenovirus to express a conditionally activated B-RAF (ΔB-RAF:ER*). Infected cells were cultured for 18 h in the absence or presence of tamoxifen, which enhances expression and activates the fusion protein. As expected, the addition of tamoxifen increased ERK1/2 phosphorylation in ΔB-RAF:ER*-infected melanocytes (Figure 7E). The elevated ERK1/2 phosphorylation in the absence of tamoxifen is probably due to low amounts of agonist within serum or incomplete binding of 90-kDA heat-shock protein to the ΔB-RAF:ER fusion (McMahon, 2001 blue right-pointing triangle). Western blot analysis showed that expression and activation of ΔB-RAF:ER* was sufficient to induce the expression of Rnd3 in melanocytes and reduce cofilin phosphorylation at serine-3 (Figure 7E). These data show that B-RAF-MEK signaling regulates Rnd3 protein expression in melanocytic cells.

Rnd3 Regulates Stress Fiber Formation, Focal Adhesion Remodeling, and Invasion

To determine whether Rnd3 participated in mutant B-RAF suppression of stress fibers, we transfected B-RAF knockdown WM793 cells with myc-tagged Rnd3 (Figure 8A) (Aspenstrom et al., 2004 blue right-pointing triangle). Expression of Rnd3 attenuated the increase in actin stress fiber formation that followed B-RAF knockdown (Figure 8B). Additionally, focal adhesions were more punctate in B-RAF knockdown cells expressing the myc-tagged Rnd3 (Figure 8C).

Figure 8.
Involvement of Rnd3 in B-RAF knockdown induced stress fiber and focal adhesion formation. WM793 cells were transfected with B-RAF#1 siRNA for 72 h, followed by transfection with cDNA encoding myc-epitope tagged Rnd3. (A) Western blot analysis with Rnd3, ...

Finally, we determined the role of endogenous Rnd3 expression in WM793 cells. Depletion of Rnd3 using two different siRNA duplexes resulted in a modest yet consistent increase in cofilin phosphorylation (Figure 9, A and B) and actin stress fiber formation (Figure 9C). Because alterations in the actin cytoskeleton and focal adhesions play an important role in promoting tumor cell invasion, Rnd3 knockdown cells were plated on Matrigel-coated transmembrane filters, and cell invasion was measured. Rnd3 knockdown cells displayed an approximate 40–50% reduction in cell invasion compared with controls (Figure 9D). Together, these observations identify Rnd3 as a downstream target of mutant B-RAF that participates in oncogene-mediated regulation of actin organization and focal adhesion remodeling, and support, at least in part, the acquisition of an invasive phenotype.

Figure 9.
Rnd3 knockdown regulates the actin cytoskeleton and invasion in melanoma cells. WM793 cells were transfected with control or Rnd3 (Rnd3#1 or Rnd3#2) siRNA. (A) Cell lysates analyzed by Western blotting for Rnd3, phospho-(S3)-cofilin, and total cofilin. ...

DISCUSSION

Oncogenic signaling frequently leads to actin cytoskeletal reorganization; however, the underlying mechanisms are not completely understood. The serine/threonine kinase B-RAF is mutated in ~7% of all cancers (Davies et al., 2002 blue right-pointing triangle). Here, we demonstrate that mutant B-RAF expression in melanoma cells regulates actin cytoskeletal and focal adhesion organization. Furthermore, B-RAF control of the Rho antagonist Rnd3 contributes to oncogene-mediated reorganization of actin cytoskeleton and focal adhesions.

We initially focused on mutant B-RAF down-regulation of actin stress fiber formation and Rho activity. Our findings are consistent with studies in colon carcinoma cells that demonstrate that constitutive K-RAS signaling via MEK inhibits Rho activation and actin stress fiber formation (Vial et al., 2003 blue right-pointing triangle; Pollock et al., 2005 blue right-pointing triangle). Although Rho activity is reduced in both melanoma and colon carcinoma cells, the molecular mechanisms mediating these changes are distinct. In colon cancer cells, MEK-regulated expression of Fra-1, an AP-1 family member, reduced actin stress fiber formation by inactivating β1 integrins (Vial et al., 2003 blue right-pointing triangle; Pollock et al., 2005 blue right-pointing triangle). Our results suggest a model in which mutant B-RAF promotes melanoma cell invasion at least in part through its control of Rnd3, which inhibits the Rho/ROCK/LIM kinase/cofilin signaling pathway leading to actin stress fiber suppression and focal adhesion turnover (Figure 9E). The combined data reinforce the notion that the MEK/ERK pathway balances Rho activation, although context dependent differences in the mechanism of cross talk may exist.

In contrast to our findings in human melanoma cells, Pritchard et al. (2004) blue right-pointing triangle have shown that B-RAF−/− mouse embryonic fibroblasts (MEFs) have disorganized actin stress fibers and reduced ROCKII expression. Differences may be due to a transient depletion of B-RAF in our knockdown experiments compared with long-term knockout. Consistent with this notion, we found that knockdown of B-RAF in human foreskin fibroblasts was not associated with discernible changes in actin stress fibers or ROCKII expression (Supplemental Figure S6). Others have shown MEK-dependent alterations in the Rho effectors ROCKI/II disrupt actin stress fiber organization (Sahai et al., 2001 blue right-pointing triangle; Pawlak and Helfman, 2002a blue right-pointing triangle; Pawlak and Helfman, 2002b blue right-pointing triangle). We found that ROCKI/II expression was not regulated by B-RAF, although ROCK and LIM kinase signaling were required for B-RAF knockdown mediated stress fiber formation. Cofilin is known to be an important contributor to actin organization downstream of ROCK/LIM kinase (Maekawa et al., 1999 blue right-pointing triangle) and its activation has been linked to the formation of cell protrusions (Ghosh et al., 2004 blue right-pointing triangle), the assembly and stability of invadopods (Yamaguchi et al., 2005 blue right-pointing triangle), and the invasion and metastasis of breast cancer cells (Wang et al., 2006 blue right-pointing triangle). Our results show that mutant B-RAF controlled cofilin phosphorylation. Because cofilin regulates focal adhesions (Sumi et al., 1999 blue right-pointing triangle; Dang et al., 2006 blue right-pointing triangle), it is likely to contribute, at least in part, to altered focal adhesion dynamics after B-RAF knockdown.

Although our studies in VGP melanoma cells implicate inhibition of Rho/ROCK signaling in the suppression of actin stress fibers, we cannot rule out a requirement for enhanced Rho GTPase activity during later stages of melanoma progression. Enhanced expression of RhoC has been correlated with the metastasis of melanoma cells (Clark et al., 2000 blue right-pointing triangle), and Rho/ROCK signaling is required for the invasive activity of metastatic melanoma cells (Sahai and Marshall, 2003 blue right-pointing triangle). Notably, in a mammary adenocarcinoma model, RhoC is dispensable for the initiation and progression of primary tumors, but it is essential for metastasis (Hakem et al., 2005 blue right-pointing triangle).

Finely balanced Rho activation regulates cell migration in part through its control of focal adhesion turnover (Webb et al., 2004 blue right-pointing triangle; Gupton and Waterman-Storer, 2006 blue right-pointing triangle). We show that mutant B-RAF signaling regulates focal adhesions in melanoma cells. ERK1/2 activation has previously been shown to regulate focal adhesion turnover (Webb et al., 2004 blue right-pointing triangle), through its modulation of focal adhesion proteins (Fincham et al., 2000 blue right-pointing triangle; Ishibe et al., 2004 blue right-pointing triangle), proteases (Carragher et al., 2003 blue right-pointing triangle), and/or contractile machinery (Klemke et al., 1997 blue right-pointing triangle). Importantly, our data suggest that ERK regulation of Rnd3 expression is a contributing factor to focal adhesion remodeling in cells expressing mutant B-RAF.

Our studies highlight Rnd3 as a regulator of cross talk between B-RAF/MEK/ERK and the Rho/ROCK signaling pathways. We demonstrate that B-RAF is necessary in melanoma and sufficient in melanocytes to elevate Rnd3 levels. These findings corroborate and extend the previous findings that Rnd3 expression is increased in MDCK cells transformed by the expression of activated C-RAF (Hansen et al., 2000 blue right-pointing triangle) and MEK-regulated in melanoma lines (Shields et al., 2007 blue right-pointing triangle). In the latter study, Rnd3 mRNA levels were typically elevated in mutant B-RAF or N-RAS cell lines compared with melanocytes and melanoma lines that contained wild-type B-RAF/N-RAS (Shields et al., 2007 blue right-pointing triangle).

Rnd3 is largely GTP-bound within cells, due to structural alterations that lower its GTP hydrolysis rates (Foster et al., 1996 blue right-pointing triangle; Guasch et al., 1998 blue right-pointing triangle). Consequently, alterations in Rnd3 expression (Hansen et al., 2000 blue right-pointing triangle; Villalonga et al., 2004 blue right-pointing triangle; Riento et al., 2005 blue right-pointing triangle) and/or localization (Foster et al., 1996 blue right-pointing triangle; Nobes et al., 1998 blue right-pointing triangle) have been proposed to be responsible for its effects. The importance of Rnd3 expression in cancer progression is poorly understood. Rnd3 is down-regulated in prostate cancer (Bektic et al., 2005 blue right-pointing triangle), whereas it is up-regulated in pancreatic cancer (Gress et al., 1996 blue right-pointing triangle). Although in one study the expression of Rnd3 correlated with transformation (Hansen et al., 2000 blue right-pointing triangle), others have shown that Rnd3 expression inhibits Ras and C-RAF–induced transformation of NIH-3T3 cells (Villalonga et al., 2004 blue right-pointing triangle; Riento et al., 2005 blue right-pointing triangle). Furthermore, Rnd3 expression supports increased cell migration of MDCK cells (Guasch et al., 1998 blue right-pointing triangle), but it suppresses p53−/− MEF invasion through Matrigel (Gadea et al., 2007 blue right-pointing triangle). Together, these reports suggest that Rnd3 may have a complicated role in cell transformation, migration, and invasion.

Our results implicate mutant B-RAF control of Rnd3 in the disruption of the actin cytoskeleton and large/mature focal adhesions in melanoma. Consistent with Rnd3 acting as an antagonist of Rho/ROCK signaling, Rnd3 knockdown led to the formation of actin stress fibers, albeit not as prominent as those formed after B-RAF knockdown. Therefore, it seems likely that additional mutant B-RAF controlled mechanisms participate in the regulation of melanoma cytoskeletal organization. Nevertheless, our results implicate Rnd3 as a B-RAF target and regulator of the actin cytoskeleton and cell invasion in melanoma.

In summary, we provide the first evidence that B-RAF regulates cytoskeletal organization and focal adhesion turnover in melanoma cells. These effects are mediated through control of the Rho/ROCK/LIM kinase/cofilin pathway. Furthermore, Rnd3 acts downstream of B-RAF and serves as an important regulator of cross talk between the RAF/MEK/ERK and Rho/ROCK signaling pathways. These findings underscore the need to identify mechanisms contributing to the expression and function of Rnd3 in melanoma.

Supplementary Material

[Supplemental Materials]

ACKNOWLEDGMENTS

We are grateful to Dr. M. Herlyn for providing melanoma cell lines. We thank Drs. K. Pumiglia, J. Settleman, R. Marais, T. Nakamura, T. Sumi, P. Caroni, B. Geiger, S. Narumiya, and P. Aspenström for providing valuable reagents. We also thank Dr. K. Boisvert-Adamo for purifying adenoviruses, Dr. G. Liu for technical assistance, and Drs. P. Higgins and P. Vincent for critically reviewing this manuscript. We appreciate The Birth Place at Albany Medical Center for providing tissue samples for melanocyte isolation. This work was supported by National Institutes of Health grant GM-067893 (to A.E.A.).

Abbreviations used:

NHEM
normal human epidermal melanocyte
VGP
vertical growth phase.

Footnotes

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E07-09-0895) on November 28, 2007.

REFERENCES

  • Arber S., Barbayannis F. A., Hanser H., Schneider C., Stanyon C. A., Bernard O., Caroni P. Regulation of actin dynamics through phosphorylation of cofilin by LIM-kinase. Nature. 1998;393:805–809. [PubMed]
  • Aspenstrom P., Fransson A., Saras J. Rho GTPases have diverse effects on the organization of the actin filament system. Biochem. J. 2004;377:327–337. [PubMed]
  • Balaban N. Q., et al. Force and focal adhesion assembly: a close relationship studied using elastic micropatterned substrates. Nat. Cell Biol. 2001;3:466–472. [PubMed]
  • Bektic J., Pfeil K., Berger A. P., Ramoner R., Pelzer A., Schafer G., Kofler K., Bartsch G., Klocker H. Small G-protein RhoE is underexpressed in prostate cancer and induces cell cycle arrest and apoptosis. Prostate. 2005;64:332–340. [PubMed]
  • Bhatt K. V., Hu R., Spofford L. S., Aplin A. E. Mutant B-RAF signaling and cyclin D1 regulate Cks1/S-phase kinase-associated protein 2-mediated degradation of p27Kip1 in human melanoma cells. Oncogene. 2007;26:1056–1066. [PubMed]
  • Bhatt K. V., Spofford L. S., Aram G., McMullen M., Pumiglia K., Aplin A. E. Adhesion control of cyclin D1 and p27Kip1 levels is deregulated in melanoma cells through BRAF-MEK-ERK signaling. Oncogene. 2005;12:3459–3471. [PubMed]
  • Boisvert-Adamo K., Aplin A. E. B-RAF and PI-3 kinase signaling protect melanoma cells from anoikis. Oncogene. 2006;25:4848–4856. [PubMed]
  • Calipel A., Lefevre G., Pouponnot C., Mouriaux F., Eychene A., Mascarelli F. Mutation of B-Raf in human choroidal melanoma cells mediates cell proliferation and transformation through the MEK/ERK pathway. J. Biol. Chem. 2003;278:42409–42418. [PubMed]
  • Carragher N. O., Westhoff M. A., Fincham V. J., Schaller M. D., Frame M. C. A novel role for FAK as a protease-targeting adaptor protein: regulation by p42 ERK and Src. Curr. Biol. 2003;13:1442–1450. [PubMed]
  • Chardin P. Function and regulation of Rnd proteins. Nat. Rev. Mol. Cell Biol. 2006;7:54–62. [PubMed]
  • Chrzanowska-Wodnicka M., Burridge K. Rho-stimulated contractility drives the formation of stress fibers and focal adhesions. J. Cell Biol. 1996;133:1403–1415. [PMC free article] [PubMed]
  • Clark E. A., Golub T. R., Lander E. S., Hynes R. O. Genomic analysis of metastasis reveals an essential role for RhoC. Nature. 2000;406:532–535. [PubMed]
  • Conner S. R., Scott G., Aplin A. E. Adhesion-dependent activation of the ERK1/2 cascade is by-passed in melanoma cells. J. Biol. Chem. 2003;278:34548–34554. [PubMed]
  • Dang D., Bamburg J. R., Ramos D. M. Alpha V Beta 3 integrin and cofilin modulate K1735 melanoma cell invasion. Exp. Cell Res. 2006;312:468–477. [PubMed]
  • Davies H., et al. Mutations of the BRAF gene in human cancer. Nature. 2002;417:949–954. [PubMed]
  • Dong J., Phelps R. G., Qiao R., Yao S., Benard O., Ronai Z., Aaronson S. A. BRAF oncogenic mutations correlate with progression rather than initiation of human melanoma. Cancer Res. 2003;63:3883–3885. [PubMed]
  • Fincham V. J., James M., Frame M. C., Winder S. J. Active ERK/MAP kinase is targeted to newly forming cell-matrix adhesions by integrin engagement and v-Src. EMBO J. 2000;19:2911–2923. [PubMed]
  • Foster R., Hu K. Q., Lu Y., Nolan K. M., Thissen J., Settleman J. Identification of a novel human Rho protein with unusual properties: GTPase deficiency and in vivo farnesylation. Mol. Cell. Biol. 1996;16:2689–2699. [PMC free article] [PubMed]
  • Gadea G., de Toledo M., Anguille C., Roux P. Loss of p53 promotes RhoA-ROCK-dependent cell migration and invasion in 3D matrices. J. Cell Biol. 2007;178:23–30. [PMC free article] [PubMed]
  • Ghosh M., Song X., Mouneimne G., Sidani M., Lawrence D. S., Condeelis J. S. Cofilin promotes actin polymerization and defines the direction of cell motility. Science. 2004;304:743–746. [PubMed]
  • Gress T. M., Muller-Pillasch F., Geng M., Zimmerhackl F., Zehetner G., Friess H., Buchler M., Adler G., Lehrach H. A pancreatic cancer-specific expression profile. Oncogene. 1996;13:1819–1830. [PubMed]
  • Guasch R. M., Scambler P., Jones G. E., Ridley A. J. RhoE regulates actin cytoskeleton organization and cell migration. Mol. Cell. Biol. 1998;18:4761–4771. [PMC free article] [PubMed]
  • Gupton S. L., Waterman-Storer C. M. Spatiotemporal feedback between actomyosin and focal-adhesion systems optimizes rapid cell migration. Cell. 2006;125:1361–1374. [PubMed]
  • Hakem A., Sanchez-Sweatman O., You-Ten A., Duncan G., Wakeham A., Khokha R., Mak T. W. RhoC is dispensable for embryogenesis and tumor initiation but essential for metastasis. Genes Dev. 2005;19:1974–1979. [PubMed]
  • Hansen S. H., Zegers M.M.P., Woodrow M., Rodriguez-Viciana P., Chardin P., Mostov K. E., McMahon M. Induced expression of Rnd3 is associated with transformation of polarized epithelial cells by the Raf-MEK-extracellular signal-regulated kinase pathway. Mol. Cell. Biol. 2000;20:9364–9375. [PMC free article] [PubMed]
  • Hingorani S. R., Jacobetz M. A., Robertson G. P., Herlyn M., Tuveson D. A. Suppression of BRAF(V599E) in human melanoma abrogates transformation. Cancer Res. 2003;63:5198–5202. [PubMed]
  • Huntington J. T., Shields J. M., Der C. J., Wyatt C. A., Benbow U., Slingluff C. L., Jr, Brinckerhoff C. E. Overexpression of collagenase 1 (MMP-1) is mediated by the ERK pathway in invasive melanoma cells: role of BRAF mutation and fibroblast growth factor signaling. J. Biol. Chem. 2004;279:33168–33176. [PubMed]
  • Huser M., Luckett J., Chiloeches A., Mercer K., Iwobi M., Giblett S., Sun X. M., Brown J., Marais R., Pritchard C. MEK kinase activity is not necessary for Raf-1 function. EMBO J. 2001;20:1940–1951. [PubMed]
  • Ishibe S., Joly D., Liu Z.-X., Cantley L. G. Paxillin serves as an ERK-regulated scaffold for coordinating FAK and Rac activation in epithelial morphogenesis. Mol. Cell. 2004;16:257–267. [PubMed]
  • Jaffe A. B., Hall A. Rho GTPases: biochemistry and biology. Annu. Rev. Cell Dev. Biol. 2005;21:247–269. [PubMed]
  • Kimura E. T., Nikiforova M. N., Zhu Z., Knauf J. A., Nikiforov Y. E., Fagin J. A. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 2003;63:1454–1457. [PubMed]
  • Kimura K., et al. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase) Science. 1996;273:245–248. [PubMed]
  • Klemke R. L., Cai S., Giannini A. L., Gallagher P. J., de Lanerolle P., Cheresh D. A. Regulation of cell motility by mitogen-activated protein kinase. J. Cell Biol. 1997;137:481–492. [PMC free article] [PubMed]
  • Maekawa M., Ishizaki T., Boku S., Watanabe N., Fujita A., Iwamatsu A., Obinata T., Ohashi K., Mizuno K., Narumiya S. Signaling from Rho to the actin cytoskeleton through protein kinases ROCK and LIM-kinase. Science. 1999;285:895–898. [PubMed]
  • McMahon M. Steroid receptor fusion proteins for conditional activation of Raf-MEK-ERK signaling pathway. Methods Enzymol. 2001;332:401–417. [PubMed]
  • Mikula M., Schreiber M., Husak Z., Kucerova L., Ruth J., Wieser R., Zatloukal K., Beug H., Wagner E. F., Baccarini M. Embryonic lethality and fetal liver apoptosis in mice lacking the c-raf-1 gene. EMBO J. 2001;20:1952–1962. [PubMed]
  • Nobes C. D., Lauritzen I., Mattei M. G., Paris S., Hall A., Chardin P. A new member of the Rho family, Rnd1, promotes disassembly of actin filament structures and loss of cell adhesion. J. Cell Biol. 1998;141:187–197. [PMC free article] [PubMed]
  • Ohashi K., Hosoya T., Takahashi K., Hing H., Mizuno K. A Drosophila homolog of LIM-kinase phosphorylates cofilin and induces actin cytoskeletal reorganization. Biochem. Biophys. Res. Commun. 2000a;276:1178–1185. [PubMed]
  • Ohashi K., Nagata K., Maekawa M., Ishizaki T., Narumiya S., Mizuno K. Rho-associated kinase ROCK activates LIM-kinase 1 by phosphorylation at threonine 508 within the activation loop. J. Biol. Chem. 2000b;275:3577–3582. [PubMed]
  • Ongusaha P. P., Kim H.-G., Boswell S. A., Ridley A. J., Der C. J., Dotto G. P., Kim Y.-B., Aaronson S. A., Lee S. W. RhoE is a pro-survival p53 target gene that inhibits ROCK I-mediated apoptosis in response to genotoxic stress. Curr. Biol. 2006;16:2466–2472. [PMC free article] [PubMed]
  • Pawlak G., Helfman D. M. MEK mediates v-Src-induced disruption of the actin cytoskeleton via Inactivation of the Rho-ROCK-LIM kinase pathway. J. Biol. Chem. 2002a;277:26927–26933. [PubMed]
  • Pawlak G., Helfman D. M. Post-transcriptional down-regulation of ROCKI/Rho-kinase through an MEK-dependent pathway leads to cytoskeleton disruption in Ras-transformed fibroblasts. Mol. Biol. Cell. 2002b;13:336–347. [PMC free article] [PubMed]
  • Pfaffl M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29 e45.
  • Pollock C. B., Shirasawa S., Sasazuki T., Kolch W., Dhillon A. S. Oncogenic K-RAS is required to maintain changes in cytoskeletal organization, adhesion, and motility in colon cancer cells. Cancer Res. 2005;65:1244–1250. [PubMed]
  • Pritchard C. A., Hayes L., Wojnowski L., Zimmer A., Marais R. M., Norman J. C. B-Raf acts via the ROCKII/LIMK/cofilin pathway to maintain actin stress fibers in fibroblasts. Mol. Cell. Biol. 2004;24:5937–5952. [PMC free article] [PubMed]
  • Rajagopalan H., Bardelli A., Lengauer C., Kinzler K. W., Vogelstein B., Velculescu V. E. Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature. 2002;418
  • Ren X. D., Kiosses W. B., Schwartz M. A. Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J. 1999;18:578–585. [PubMed]
  • Ridley A. J., Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell. 1992;70:389–399. [PubMed]
  • Riento K., Guasch R. M., Garg R., Jin B., Ridley A. J. RhoE binds to ROCK I and inhibits downstream signaling. Mol. Cell. Biol. 2003;23:4219–4229. [PMC free article] [PubMed]
  • Riento K., Totty N., Villalonga P., Garg R., Guasch R., Ridley A. J. RhoE function is regulated by ROCK I-mediated phosphorylation. EMBO J. 2005;24:1170–1180. [PubMed]
  • Sahai E., Marshall C. J. Differing modes of tumour cell invasion have distinct requirements for Rho/ROCK signalling and extracellular proteolysis. Nat. Cell Biol. 2003;5:711–719. [PubMed]
  • Sahai E., Olson M. F., Marshall C. J. Cross-talk between Ras and Rho signalling pathways in transformation favours proliferation and increased motility. EMBO J. 2001;20:755–766. [PubMed]
  • Satyamoorthy K., DeJesus E., Linnenbach A. J., Kraj B., Kornreich D. L., Rendle S., Elder D. E., Herlyn M. Melanoma cell lines from different stages of progression and their biological and molecular analyses. Melanoma Res. 1997;7:S35–S42. [PubMed]
  • Sekine A., Fujiwara M., Narumiya S. Asparagine residue in the Rho gene product is the modification site for botulinum ADP-ribosyltransferase. J. Biol. Chem. 1989;264:8602–8605. [PubMed]
  • Sharma A., Trivedi N. R., Zimmerman M. A., Tuveson D. A., Smith C. D., Robertson G. P. Mutant V599E B-Raf regulates growth and vascular development of malignant melanoma tumors. Cancer Res. 2005;65:2412–2421. [PubMed]
  • Shields J. M., et al. Lack of extracellular signal-regulated kinase mitogen-activated protein kinase signaling shows a new type of melanoma. Cancer Res. 2007;67:1502–1512. [PubMed]
  • Sumi T., Matsumoto K., Nakamura T. Specific activation of LIM kinase 2 via phosphorylation of threonine 505 by ROCK, a Rho-dependent protein kinase. J. Biol. Chem. 2001;276:670–676. [PubMed]
  • Sumi T., Matsumoto K., Takai Y., Nakamura T. Cofilin phosphorylation and actin cytoskeletal dynamics regulated by Rho- and Cdc42-activated LIM-kinase 2. J. Cell Biol. 1999;147:1519–1532. [PMC free article] [PubMed]
  • Sumimoto H., Miyagishi M., Miyoshi H., Yamagata S., Shimizu A., Taira K., Kawakami Y. Inhibition of growth and invasive ability of melanoma by inactivation of mutated BRAF with lentivirus-mediated RNA interference. Oncogene. 2004;23:6031–6039. [PubMed]
  • Vial E., Sahai E., Marshall C. J. ERK-MAPK signaling coordinately regulates activity of Rac1 and RhoA for tumor cell motility. Cancer Cell. 2003;4:67–79. [PubMed]
  • Villalonga P., Guasch R. M., Riento K., Ridley A. J. RhoE inhibits cell cycle progression and Ras-induced transformation. Mol. Cell. Biol. 2004;24:7829–7840. [PMC free article] [PubMed]
  • Wang W., Mouneimne G., Sidani M., Wyckoff J., Chen X., Makris A., Goswami S., Bresnick A. R., Condeelis J. S. The activity status of cofilin is directly related to invasion, intravasation, and metastasis of mammary tumors. J. Cell Biol. 2006;173:395–404. [PMC free article] [PubMed]
  • Watanabe N., Kato T., Fujita A., Ishizaki T., Narumiya S. Cooperation between mDia1 and ROCK in Rho-induced actin reorganization. Nat. Cell Biol. 1999;1:136–143. [PubMed]
  • Webb D. J., Donais K., Whitmore L. A., Thomas S. M., Turner C. E., Parsons J. T., Horwitz A. F. FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly. Nat. Cell Biol. 2004;6:154–161. [PubMed]
  • Wellbrock C., Ogilvie L., Hedley D., Karasarides M., Martin J., Niculescu-Duvaz D., Springer C. J., Marais R. V599E B-RAF is an oncogene in melanocytes. Cancer Res. 2004;64:2338–2342. [PubMed]
  • Wennerberg K., Forget M.-A., Ellerbroek S. M., Arthur W. T., Burridge K., Settleman J., Der C. J., Hansen S. H. Rnd proteins function as RhoA antagonists by activating p190 RhoGAP. Curr. Biol. 2003;13:1106–1115. [PubMed]
  • Yamaguchi H., et al. Molecular mechanisms of invadopodium formation: the role of the N-WASP-Arp2/3 complex pathway and cofilin. J. Cell Biol. 2005;168:441–452. [PMC free article] [PubMed]
  • Yang N., Higuchi O., Ohashi K., Nagata K., Wada A., Kangawa K., Nishida E., Mizuno K. Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated actin reorganization. Nature. 1998;393:809–812. [PubMed]
  • Yoneda A., Ushakov D., Multhaupt H.A.B., Couchman J. R. Fibronectin matrix assembly requires distinct contributions from Rho kinases I and -II. Mol. Biol. Cell. 2007;18:66–75. [PMC free article] [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology