Search tips
Search criteria 


Logo of jexpmedHomeThe Rockefeller University PressEditorsContactInstructions for AuthorsThis issue
J Exp Med. 1997 March 17; 185(6): 1035–1042.
PMCID: PMC2196242

Signal Transducer and Activator of Transcription-3 (STAT3) Is Constitutively Activated in Normal, Self-renewing B-1 Cells but Only Inducibly Expressed in Conventional B Lymphocytes


Cytokine and growth factor receptor engagement leads to the rapid phosphorylation and activation of latent, cytosolic signal transducers and activators of transcription (STAT) proteins, which then translocate to the nucleus where they regulate transcriptional events from specific promoter sequences. STAT3 expression in particular has been associated with Abl, Src, and HTLV-1 transformation of normal cells. B-1 lymphocytes are self-renewing, CD5+ B cells that display a propensity for malignant transformation and are the normal counterpart to human chronic lymphocytic leukemias. Further, B-1 cells are characterized by aberrant intracellular signaling, including hyperresponsiveness to phorbol ester PKC agonists. Here we demonstrate that B-1 lymphocytes constitutively express nuclear activated STAT3, which is not expressed by unmanipulated conventional (B-2) lymphocytes. In contrast, STAT3 activation is induced in B-2 cells after antigen receptor engagement in a delayed fashion (after 3 h). Induction of STAT3 is inhibited by both the serine/threonine protein kinase inhibitor H-7 and the immunosuppressive drug rapamycin and requires de novo protein synthesis, demonstrating novel coupling between sIg and STAT proteins that differs from the classical paradigm for STAT induction by cytokine receptors. The inability of prolonged stimulation of conventional B-2 cells with anti-Ig, a treatment sufficient to induce CD5 expression, to result in sustained STAT3 activation suggests that STAT3 is a specific nuclear marker for B-1 cells. Thus, STAT3 may play a role in B cell antigen-specific signaling responses, and its constitutive activation is associated with a normal cell population exhibiting intrinsic proliferative behavior.

The 67-kD pan–T cell surface glycoprotein, CD5, was first detected on the surface of human and murine B cell tumors and subsequently found to specify a subset of normal B lymphocytes in both species (1). CD5+ (or B-1) B lymphocytes are mature B cells that predominate early in life, decline in relative number as the animal matures, and, in mice, become confined to the peritoneal cavity, with few, if any, present in the peripheral lymph nodes (2). Functionally, B-1 cells contribute a disproportionally large fraction of serum Ig, specifically of the μ, α, and γ classes. These Igs are noted to express germline encoded specificities, with little somatic mutation and N-insertion and may be involved in the regulation of idiotype expression (3, 4).

B-1 cells have been linked to both autoantibody production and the pathogenesis of autoimmune disease as well as malignancy (2, 5). CD5+ B cells have been found to be enriched sources of autoantibody-producing cells specific for various self-antigens, and several mouse strains that develop autoimmune pathology have elevated numbers of splenic and peritoneal CD5 B cells (6, 7). Adoptive transfer experiments have demonstrated that B-1 cells have self-renewing capacity (8), and in vitro, these cells are readily immortalized in culture without the use of exogenously induced transformation (9). Coupled with their hyperresponsiveness to PMA stimulation and their inability to enter S phase after sIg cross-linking (10, 11), these observations suggest that B-1 cells differ from B-2 cells in their biochemical makeup in ways that may contribute to autoantibody secretion and unregulated growth.

Signal transducers and activators of transcription (STAT)1 proteins were first characterized by studying signaling in response to interferon and have since been implicated in cellular responses to a plethora of cytokines and growth factors (12, 13). STAT signaling involves the activation of the JAK/tyk family of tyrosine kinases that are believed to be associated with unliganded cytokine receptors and to phosphorylate latent cytoplasmic STAT proteins upon ligand binding (14). Phosphorylated STATs dimerize via interactions between their SH2 domains (15), allowing nuclear translocation and DNA binding activity specific for distinct sequence elements in cytokine and growth factor–stimulated genes. We have previously shown that mitogenic stimulation through surface Ig in B-2 cells induces the activation of STAT proteins (16). This observation, coupled with the association of STAT3 with abnormal cell growth and transformation (1720), led us to compare the status and activational responses of STAT3 proteins in B-1 and B-2 cells. Our results indicate that the nuclear expression of activated STAT proteins differs between B-1 and B-2 cells and that the STAT protein profile may be a distinguishing molecular feature of the B-1 cell phenotype.

Materials and Methods


Male BALB/cByJ mice at 8–14 wk of age were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were housed at least 1 wk before experimentation. Mice were cared for and handled at all times in accordance with National Institutes of Health and institutional guidelines.

B Cell Purification.

B-1 lymphocytes were prepared by negative selection from peritoneal wash-out cells as previously described (21). B-2 cells were purified from spleen cells of 8–12-wk-old naive mice by depletion of T cells using treatment with anti–Thy 1.2 antibody plus rabbit complement and depletion of macrophages by overnight culture on plastic petri dishes, as previously described (22). RBC and nonviable cells were removed by sedimentation over Lympholyte M (Cedarlane, Ontario, Canada). The resulting B cells were cultured at 37°C with 5% CO2 in RPMI 1640 medium (BioWhittaker, Walkersville, MD) supplemented with 5% heat inactivated fetal bovine serum (Sigma Chem. Co., St. Louis, MO), 10 mM Hepes (pH 7.2), 50 μM 2-ME, 2 mM l-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin. In some experiments, B-1 cells were prepared in the presence of serum-free RPMI 1640 medium containing 1% bovine serum albumin and cultured in serum-free AIM-V medium (GIBCO BRL, Gaithersburg, MD).

Nuclear Extracts and Electrophoretic Mobility Shift Assay.

Nuclear extracts from untreated or stimulated primary B cells were prepared using 430 mM NaCl at pH 7.9 as previously described (22), except that 1 mM sodium orthovanadate was added to all extraction buffers. Protein concentrations were determined by the Bradford method (23) (Bio-Rad, Hercules, CA). Nuclear extracted protein was incubated with 32P-labeled double-stranded oligonucleotide containing the high-affinity SIE (m67) derived from the c-fos gene (24) (5′GTGCATTTCCCGTAAATCTTGTCTACAATTC3′) for 20 min before electrophoresis on nondenaturing 5% polyacrylamide gels. Binding reactions contained 1 μg poly(dI-dC) and 2.0 μg salmon sperm DNA. For competition analysis, 20-fold excess unlabeled SIE or NF-AT oligonucleotide (25) was added to binding reactions before addition of nuclear protein and electrophoresis. Supershift/immunoinhibition analysis was performed by addition of 1 μl anti-p91N or antiphosphotyrosine701STAT1 for an additional 30 min at 4°C after the 20-min electrophoretic mobility shift assay (EMSA) binding reaction.

Western Blotting.

Nuclear extracted protein (5 μg) was resolved by 7.5% SDS-PAGE, transferred to nitrocellulose and blocked with 5% nonfat powdered milk in wash buffer (20 mM Tris, pH 7.6, 0.14 M NaCl, and 0.1% Tween-20; TBS-T) overnight at 4°C. The nitrocellulose filters were then probed with antiphosphotyrosine701STAT1 (26), or with antiphosphotyrosine705 STAT3 antiserum, generated by immunization of rabbits with a synthetic peptide containing amino acids 696-709 of human STAT3, with phosphotyrosine at position 705, which was conjugated to bovine serum albumin. Blots were incubated for 1 h at room temperature with antibody in 3% BSA–TBS-T. After washing, blots were developed by ECL.


EMSA was performed as described above except 5 μg of nuclear extracts were added to 1.5× the normal amount of labeled oligonucleotide and electrophoresed on 5% polyacrylamide gels. SIE-binding proteins were separated from retarded labeled oligonucleotide by electrophoretic transfer from the native gel to nitrocellulose paper. Labeled oligonucleotide was detected bound to DE-81 paper (Whatman, Hillsboro, OR) placed under the nitrocellulose filter and on top of Whatman filter paper. After transfer, the nitrocellulose filters were blocked and Western blotted as above and the DE-81/Whatman filters were dried for 10 min before autoradiography.


F(ab′)2 fragments of goat anti–mouse IgM (Jackson Immunoresearch, Inc., West Grove, PA) were used at a concentration of 15 μg/ml. PMA (Sigma) was used at 100 ng/ml. Cells were stimulated with murine recombinant IFN-γ (5 ng/ml) or IL-6 (1,000 U/ml), both from Genzyme (Cambridge, MA). Rabbit antiserum to the NH2-terminal domain of p91 (anti-p91N) was the kind gift of Dr. C. Schindler (Columbia University, New York). Rabbit antiserum specific for only the tyrosine-phosphorylated form of STAT1 was generated by immunization of rabbits with a peptide designed from the STAT1α protein containing phosphorylated Tyr 701 (26). Rapamycin was used at 20 ng/ml, dissolved in ethanol and 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H-7) and N-(2′-guanidinoethyl)-5-isoquinolinesulfonamide (HA-1004) (LC Laboratories, Woburn, MA) were used at 25 μM.

Results and Discussion

To determine whether the unusual growth characteristics of B-1 cells are accompanied by differences in the regulation of STAT proteins, we compared STAT DNA-binding activities between resting B-1 and B-2 cells. Nuclear extracts from untreated B-1 cells formed protein–DNA complexes with the high-affinity sis-inducible element (SIE) of the c-fos gene (27), a recognized STAT-binding site (1), as detected by EMSA (Fig. (Fig.11 A). The major B-1 cell–specific SIE-binding activity was observed to co-migrate with the IL-6–stimulated sis-inducible factor (SIF) A binding complex, with a smaller amount co-migrating similarly to the IFN-γ–induced SIF C complex (24, 2830). In contrast, no SIF A, and little SIF C activity was detected in nuclear extracts obtained from unmanipulated B-2 cells.

Figure 1Figure 1Figure 1
Constitutive expression of specific nuclear SIE-binding activity that co- migrates with IL-6–induced SIF A in B-1 cells. (A) EMSA analysis of nuclear extracts prepared from B-2 cells (15 × 106) incubated in medium alone or treated with ...

The B-1 cell complexes were competed by unlabeled SIE-containing oligonucleotide but not by the consensus binding site for the nuclear factor of activated T cells (NF-AT) (Fig. (Fig.11 B), indicating that these complexes are specific for the SIE. The constitutive expression of SIF complexes in B-1 cells was not the result of serum induction in vitro, as these complexes were still formed from nuclear extracts prepared from B-1 cells purified and cultured in serum-free medium and were not inducible upon subsequent serum treatment (Fig. (Fig.11 C). Antibody to the NH2-terminal region of STAT1α (anti-p91N), which has been shown to recognize STAT3 induced by ciliary neurotrophic factor (CNTF) (31), disrupted SIF A induced by IL-6 in B cells (Fig. (Fig.22 A). The constitutively expressed B-1 SIF A–like complex was also disrupted by anti-p91N but not by an antibody to phosphotyrosine701STAT1 (Fig. (Fig.22 A). Anti-p91N formed supershifted complexes with SIF A in both IL-6–stimulated B cells and untreated B-1 cells which were apparent in longer exposures and showed identical electrophoretic mobilities; antisera to STAT 4, 5, or 6 failed to react with the B-1 cell SIF A complex in EMSA supershift assays or with B-1 cell nuclear extracts in Western blotting experiments, and antibody that supershifted STAT1 activated by IFN-γ immunoinhibited/supershifted only a small amount of the SIF C complex of B-1 cells (data not shown). Because STAT3 is only known to form homodimers or to heterodimerize with STAT1, these results strongly suggest that B-1 cells differ from B-2 cells in the basal nuclear expression of STAT3 homodimers that comprise the SIF A nucleoprotein complex.

Figure 2Figure 2Figure 2Figure 2Figure 2
Immunoreactivity of B-1 cell SIF A with STAT3-specific antisera, and detection of constitutively expressed B-1 cell STAT 1 and 3 isoforms. (A) EMSA supershift/immunoinhibition analysis was performed using nuclear extracts from untreated B-1 cells ( ...

To assess the contribution of phosphorylated STAT3 to the SIF A complex constitutively present in B-1 cells, we performed Shift–Western experiments, using nuclear extracted protein, the SIE-containing oligonucleotide, and antiphosphotyrosine705STAT3. The mobility shift assay is shown in Fig. Fig.22 B, top. Nuclear extracts from either unstimulated B-1 or B-2 cells or from B-2 cells treated with IL-6 for 15 min were incubated with the SIE oligonucleotide before EMSA. The SIF A complexes constitutively present in untreated B-1 cells and IL-6–treated B-2 cells were found to contain phosphotyrosine705STAT3, as determined by immunoblotting material obtained from the native gel (Fig. (Fig.22 B, bottom). As a control, phosphotyrosine705STAT3 electrophoresed in the absence of the SIE-containing oligonucleotide (no DNA control) was observed to migrate more slowly in the gel, distinguishing it from SIE-bound STAT3 (data not shown). These results confirm that STAT3 is constitutively present in B-1 nuclei, as indicated by the supershifting experiments outlined above and show that it is present as a tyrosine phosphorylated protein in the SIF A complex.

We further examined the phosphorylation status of STAT3 in nuclear extracts from B-1 and B-2 cells. CNTF has been reported to induce the tyrosine phosphorylation of two STAT3 isoforms, p88 and p89 (31). These isoforms, whose phosphorylation is also inducible by IL-6 (29, 32, 33), have been termed STAT3f (p88), for faster migrating and STAT3s (p89), for slower migrating (32, 34). Immunoblotting with antiserum specific for STAT3 phosphorylated on tyrosine705 showed that B-2 cells express little nuclear phosphotyrosine705STAT3s or STAT3f, as expected on the basis of EMSA analysis (Fig. (Fig.11 A). In comparison, B-1 cell nuclear extracts were found to contain roughly equal levels of phosphotyrosine705STAT3s and STAT3f, respectively, which co-migrated with IL-6–induced phosphotyrosine705 STAT3 from B-2 cells (Fig. (Fig.22 C). In addition, immunoblotting untreated B-1 cell nuclear extracts with antibody specific for STAT1 phosphorylated on tyrosine701 (26) detected activated STAT1 of the p91 isoform, which was not present in nuclear extracts from untreated B-2 cells but was inducible by IFN-γ treatment (Fig. (Fig.22 D). Thus, the B-1–specific expression of SIF A correlates with the presence of the phosphotyrosine705 forms of STAT3s and STAT3f in nuclei from unstimulated B-1 cells, and B-1 cells also constitutively express a small amount of activated p91-STAT1.

The presence of SIF A and phosphotyrosine705STAT3 in B-1 cells could not be due to macrophage contamination, because purified macrophages isolated by adherence during B cell purification from the same animals did not contain nuclear SIF A or phosphotyrosine705STAT3, and histologic examination of B-1 populations revealed less than 2% macrophage contamination (data not shown). Further, overnight incubation of B-1 cells with neutralizing antibody to IL-10 before preparation of nuclear extracts did not result in diminution of the SIF A complex observed by EMSA (data not shown), suggesting that an IL-10 autocrine loop does not account for the observed elevated levels of STAT3 in unstimulated B-1 cells and that constitutive STAT3 expression is intrinsic to this population.

Previous work has shown that anti-Ig treatment of B-2 cells results in STAT1 activation (35). It has been suggested that B-1 cells represent a population of conventional B cells previously activated through their antigen receptors. For these reasons, STAT3 activation was evaluated in nuclear extracts from B-2 cells treated with anti-Ig. Nuclear extracts from anti-Ig–treated B-2 cells formed a SIF A complex with the SIE similar to that observed in untreated B-1 cells, although this activity was only present in extracts from cells stimulated for 3 h or more (Fig. (Fig.33 A). As with B-1 SIF A, anti-p91N but not antiserum to phosphotyrosine701STAT1 disrupted SIF A induced by anti-Ig in B-2 cells (Fig. (Fig.33 B) and formed a supershifted complex with SIF A that was visible in longer exposures and co-migrated with a similar complex recognized by anti-p91N in IL-6–treated B cells (data not shown). Further, phosphotyrosine705STAT3s was detected by immunoblotting using nuclear extracts from B-2 cells treated for 3 h with anti-Ig, although little phosphotyrosine705STAT3f was observed (Fig. (Fig.44 A). B cells stimulated with anti-Ig for less than 3 h did not contain nuclear phosphotyrosine705STAT3s or STAT3f (data not shown). These results suggest that cross-linking sIg in B-2 cells generates activated nuclear STAT3 of predominantly the STAT3s isoform, much like IL-6 treatment of B-2 cells but dissimilar from the phosphotyrosine705STAT3 profile of unstimulated B-1 cells, in which levels of STAT3s and STAT3f are nearly equal (Fig. (Fig.22 C). Thus, constitutively expressed B-1 cell STAT3 is not the same as STAT3 induced in B-2 cells by sIg or cytokine receptor engagement.

Figure 3Figure 3
Inducible nuclear expression of STAT3 in B-2 cells treated with anti-Ig. (A) Delayed nuclear expression of SIF A in anti-Ig–stimulated B-2 cells. EMSA analysis for SIE-binding activity was carried out using nuclear extracts prepared from B-2 ...
Figure 4Figure 4Figure 4Figure 4Figure 4
Unique features of the surface Ig-mediated STAT3signaling pathway. (A and B) Induction of tyrosine phosphorylated STAT3 by anti-Ig in B-2 cells requires serine/threonine phosphorylation. Nuclear extracts were obtained from B-2 cells stimulated for ...

The formation and transcriptional activity of cytokineinduced STAT3 complexes have been shown to require inducible serine phosphorylation (32, 36). Because many sIg triggered downstream events are PKC dependent, we tested whether anti-Ig induction of STAT3 in B-2 cells is sensitive to inhibition of serine/threonine phosphorylation, using the inhibitor, H7. The induction of phosphotyrosine705STAT3s by anti-Ig was completely inhibited by H7 but not by treatment with (the control analog) HA1004 (Fig. (Fig.44 A). Preincubation with H7 but not with HA1004 also completely blocked the formation of the SIF A–binding complex in EMSA experiments conducted using nuclear extracts from B-2 cells stimulated with anti-Ig for 3 h (Fig. (Fig.44 B). These results suggest that nuclear localization of phosphotyrosine705STAT3s and the appearance of nuclear SIF A in B-2 cells stimulated by anti-Ig requires serine/ threonine phosphorylation and further implicate STAT3s in the composition of the anti-Ig–induced SIF A complex.

The delayed tyrosine phosphorylation of STAT3 after sIg ligation in B-2 cells suggested that the synthesis of an intermediary protein is required for this response. To test this possibility, B-2 cells were stimulated with anti-Ig in the presence of the protein synthesis inhibitor cycloheximide (CHX) and nuclear extracts were prepared. CHX completely blocked the induction of phosphotyrosine705STAT3s in nuclear extracts from B-2 cells treated with anti-Ig for 3 h, whereas CHX had no effect on phosphotyrosine705STAT3 stimulated by IL-6 (Fig. (Fig.44 C). CHX also abrogated the formation of the SIF A–binding complex in EMSA experiments performed using nuclear extracts from B-2 cells stimulated with anti-Ig for 3 h (data not shown). Thus, de novo protein synthesis is required for induction of both SIF A and of phosphotyrosine705STAT3s by anti-Ig.

Since anti-Ig is a mitogenic stimulus for B-2 cells, we reasoned that induction of STAT3 via this novel mechanism may be sensitive to immunosuppressive drugs that inhibit B cell proliferation, such as cyclosporin A, FK506, and rapamycin (37, 38). Immunoblot analysis of nuclear extracted protein showed substantial inhibition of anti- Ig–induced phosphotyrosine705STAT3s by rapamycin (Fig. (Fig.44 D). Rapamycin also significantly blocked the formation of the anti-Ig–inducible SIF A complex (Fig. (Fig.44 E). This effect of rapamycin is specific for sIg-triggered STAT3 because induction of phosphotyrosine705STAT3 by IL-6 was not affected by rapamycin (data not shown). Further, B-2 cell treatment with CsA had a minimal effect on nuclear expression of phosphotyrosine705STAT3s after anti-Ig stimulation but completely inhibited nuclear phosphotyrosine705STAT3s induced by the combination of PMA and the calcium ionophore, ionomycin (data not shown) demonstrating an additional level of specificity for the effect of rapamycin on anti-Ig–induced STAT3.

Both the delayed appearance and dependence on protein synthesis of phosphotyrosine705STAT3 in B-2 cells after anti-Ig stimulation raised the possibility that sIg-mediated STAT3 induction may be due to the release of cytokines from the B cells themselves or from other contaminating cells in the B-2 cell preparation after treatment with antiIg. To address this question, nuclear extracts from the mature B cell line BAL-17 were prepared and immunoblotted for phosphotyrosine705STAT3 after stimulation with anti-Ig. Phosphotyrosine705STAT3s was induced in BAL-17 B cells by anti-Ig treatment with similar kinetics to that observed in B-2 cells (data not shown) ruling out a role for a factor secreted by a contaminating non–B cell. In addition, culture supernatants from B cells stimulated by anti-Ig for 3 h were transfered to naive cells, from which nuclear extracts were prepared after 15 min and tested for the presence of phosphotyrosine705STAT3 by immunoblotting. Supernatants from cultures treated with anti-Ig for 3 h did not induce appreciable rapid tyrosine phosphorylation of STAT3 in previously naive cells (data not shown), as would be expected of a cytokine-mediated response. These results, coupled with the sensitivity of this response to rapamycin, which does not inhibit cytokine-mediated STAT signaling, suggest that the delayed tyrosine phosphorylation of STAT3 is specific to anti-Ig treatment and is not the result of cytokine release or synthesis triggered by cell activation.

Prolonged exposure of B-2 cells to anti-Ig (e.g., for 2.5 d) has been shown to result in the acquisition of surface CD5 expression and proliferative responsiveness to PMA (39, 40). The possibility that prolonged sIg crosslinking produces a B-1–like basal level of nuclear activated STAT3 was tested by treating B-2 cells with anti-Ig for several days before nuclear extraction. Although B-2 cells treated with anti-Ig for 2.5 d responded to PMA by cell cycle progression to S phase, sIg-mediated nuclear SIF A (which was apparent at 3 h) had disappeared by this time (Fig. (Fig.5).5). This result indicates that STAT3 induced by anti-Ig in B-2 cells is only transiently expressed, and thus long term T cell–independent type II (TI-2) antigenic stimulation of B-2 cells does not recapitulate the profile of activated STAT3 characteristic of B-1 cells, despite inducing other B-1–like changes. These results suggest that activated STAT3 expression is an intrinsic and unique characteristic of B-1 cells.

Figure 5
Failure of prolonged anti-Ig treatment of B-2 cells to reproduce the B-1 cell nuclear STAT3 profile. Nuclear extracts were prepared from untreated B-1 cells and from B-2 cells incubated with either medium alone (−), or treated with IL-6 for ...

In conclusion, we have identified constitutive nuclear activated STAT3 in normal murine B-1 lymphocytes, representing the first nuclear transcriptional identifier for this developmentally regulated B cell population. The B-1 cell subset has been linked to spontaneously arising B cell tumors, and STAT3 has been found to be activated in v-abl-transformed B cells, HTLV-I–transformed T cells, and v-src– transformed fibroblasts (1720). Basal levels of nuclear phosphorylated STAT3 may reflect, or may cause, the activated state of B-1 cells, and may contribute to the self-renewing growth characteristics and the oncogenic potential of normal B-1 cells in vivo. In contrast, both egr-1 and c-myc mRNA levels do not differ between B-1 and B-2 cells (41).

There has been considerable debate over whether B-1 cells are derived from a separate lineage of progenitor cells or represent B-2 cells that have undergone internal biochemical and external cell surface marker changes due to prior activational or differentiative responses, such as those delivered by TI-2 antigens (42, 43). Our data suggest that one activity of sIg cross-linking in conventional B cells is to activate STAT3, which occurs in delayed fashion, involves phosphorylation of tyrosine705, and is dependent upon de novo protein synthesis, serine/threonine phosphorylation, and the participation of a rapamycin-inhibitable kinase. Thus, the B cell antigen receptor is coupled to nuclear expression of activated STAT proteins (this work and references 16, 35). Notably, many features of this coupling stand in stark contrast to the accepted paradigm for STAT activation mediated by cytokine receptors, in which STAT phosphorylation occurs rapidly, does not require protein synthesis, and is independent of rapamycin-sensitive kinase activity. However, the basal presence of both activated STAT3s and STAT3f in unstimulated B-1 cells contrasts with the transient induction of predominantly the STAT3s isoform in anti-Ig stimulated B-2 cells and suggests that crosslinking sIg alone does not result in similar nuclear expression, in B-2 cells, of this activated transcription factor present in B-1 cells. Therefore, constitutive B-1 cell STAT3 expression suggests that the development of these B cells cannot be explained by TI-2 antigen–mediated influences alone, and that STAT proteins play a role in directing the unique behavioral and phenotypic characteristics of this population of normal cells.


We are grateful to C. Schindler for his gift of anti-p91N antibody and D. Francis for valuable input.

This work was supported by United States Public Health Service Grant AI29690 to T.L. Rothstein.


1Abbreviations used in this paper: CHX, cycloheximide; CNTF, ciliary neurotrophic factor; EMSA, electrophoretic mobility shift assay; PKC, protein kinase C; SIE, sis-inducible element; SIF, sis-inducible factor; STAT, signal transducers and activators of transcription; TI-2, T cell–independent type II.


1. Kantor AB, Herzenberg LA. Origin of murine B cell lineages. Annu Rev Immunol. 1993;11:501–538. [PubMed]
2. Hayakawa K, Hardy RR, Herzenberg LA. Peritoneal Ly-1 B cells: genetic control, autoantibody production, increased lambda light chain expression. Eur J Immunol. 1986;16:450–456. [PubMed]
3. Sherr DH, Dorf ME. An idiotype-specific helper population that bears immunoglobulin, Ia, and Lyt-1 determinants. J Exp Med. 1984;159:1189–1200. [PMC free article] [PubMed]
4. Hardin JA, Vos K, Kawano Y, Sherr DH. A function for Ly-1+B cells. Proc Soc Exp Biol Med. 1990;195:172–182. [PubMed]
5. Caligaris-Cappio F, Gobbi M, Bofill M, Janossy G. Infrequent normal B lymphocytes express features of B-chronic lymphocytic leukemia. J Exp Med. 1982;155:623–632. [PMC free article] [PubMed]
6. Burastero SE, Casali P, Wilder RL, Notkins AL. Monoreactive high affinity and polyreactive low affinity rheumatoid factors are produced by CD5+B cells from patients with rheumatoid arthritis. J Exp Med. 1988;168:1979–1992. [PMC free article] [PubMed]
7. Sidman CL, Shultz LD, Hardy RR, Hayakawa K, Herzenberg LA. Production of immunoglobulin isotypes by Ly-1+B cells in viable motheaten and normal mice. Science (Wash DC) 1986;232:1423–1425. [PubMed]
8. Kroese FGM, Butcher EC, Stall AM, Lalor PA, Adams S, Herzenberg LA. Many of the IgA producing plasma cells in murine gut are derived from self-replenishing precursors in the peritoneal cavity. Intl Immunol. 1989;1:75–84. [PubMed]
9. Braun J, Citri Y, Baltimore D, Forouzanpour F, King L, Teheranizadeh K, Bray M, Kliewer S. B-Ly1 cells: immortal Ly-1+B lymphocyte cell lines spontaneously arising in murine splenic cultures. Immunol Rev. 1986;93:5–28. [PubMed]
10. Rothstein TL, Kolber DL. Peritoneal B cells respond to phorbol esters in the absence of co-mitogen. J Immunol. 1988;140:2880–2885. [PubMed]
11. Rothstein TL, Kolber DL. Anti-Ig antibody inhibits the phorbol ester-induced stimulation of peritoneal B cells. J Immunol. 1988;141:4089–4093. [PubMed]
12. Darnell JE, Jr, Kerr IM, Stark GM. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science (Wash DC) 1994;264:1415–1421. [PubMed]
13. Schindler C, Darnell JE., Jr Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem. 1995;64:621–651. [PubMed]
14. Ihle JN. Cytokine receptor signaling. Nature (Lond) 1995;377:591–594. [PubMed]
15. Shuai K, Horvarth CM, Tsai-Huang LH, Quereshi SA, Cowburn D, Darnell JE., Jr Interferon activation of the transcription factor stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell. 1994;76:821–828. [PubMed]
16. Karras JG, Wang Z, Coniglio SJ, Frank DA, Rothstein TL. Antigen receptor engagement in B cells induces nuclear expression of STAT5 and STAT6 proteins that bind and transactivate an IFN-γ activation site. J Immunol. 1996;157:39–47. [PubMed]
17. Migone T-S, Lin J-X, Cereseto A, Mulloy JC, O'Shea JJ, Franchini G, Leonard WJ. Constitutively activated Jak-STAT pathway in T cells transformed with HTLV-I. Science (Wash DC) 1995;269:79–81. [PubMed]
18. Yu C-L, Meyer DJ, Campbell GS, Larner AC, Carter-Su C, Schwartz J, Jove R. Enhanced DNAbinding activity of a Stat3-related protein in cells transformed by the Src oncoprotein. Science (Wash DC) 1995;269:81–83. [PubMed]
19. Hilbert DM, Migone T-S, Kopf M, Leonard WJ, Rudikoff S. Distinct tumorigenic potential of abl and raf in B cell neoplasia: ablactivates the IL-6 signaling pathway. Immunity. 1996;5:81–89. [PubMed]
20. Cao X, Tay A, Guy GR, Tan YH. Activation and association of STAT3 with Src in v-Src-transformed cell lines. Mol Cell Biol. 1996;16:1595–1603. [PMC free article] [PubMed]
21. Morris DL, Rothstein TL. Abnormal transcription factor induction through the surface immunoglobulin M receptor of B-1 lymphocytes. J Exp Med. 1993;177:857–861. [PMC free article] [PubMed]
22. Liu J, Chiles TC, Sen R, Rothstein TL. Inducible nuclear expression of NF-κB in primary B cells stimulated through the surface Ig receptor. J Immunol. 1991;146:1685–1691. [PubMed]
23. Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–257. [PubMed]
24. Sadowski HB, Shuai K, Darnell JE, Jr, Gilman MZ. A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science (Wash DC) 1993;261:1739–1744. [PubMed]
25. Francis DA, Karras JG, Ke X, Sen R, Rothstein TL. Induction of the transcription factors NF-κB, AP-1 and NF-AT during B cell stimulation through the CD40 receptor. Int Immunol. 1995;7:151–161. [PubMed]
26. Frank DA, Robertson MJ, Bonni A, Ritz J, Greenberg ME. Interleukin 2 signaling involves the phosphorylation of Stat proteins. Proc Natl Acad Sci USA. 1995;92:7779–7783. [PubMed]
27. Wagner BJ, Hayes TE, Hoban CJ, Cochran BH. The SIF binding element confers sis/PDGF inducibility onto the c-fospromoter. EMBO (Eur Mol Biol Organ) J. 1990;9:4477–4484. [PubMed]
28. Ruff-Jamison S, Chen K, Cohen S. Induction by EGF and interferon-γ of tyrosine-phosphorylated DNA binding proteins in mouse liver nuclei. Science (Wash DC) 1993;261:1733–1736. [PubMed]
29. Zhong Z, Wen Z, Darnell JE., Jr Stat3 and Stat4: members of the family of signal transducers and activators of transcription. Proc Natl Acad Sci USA. 1994;91:4806–4810. [PubMed]
30. Rothman P, Kreider B, Azam M, Levy D, Wegenka U, Eilers A, Decker T, Horn F, Kashleva H, Ihle J, Schindler C. Cytokines and growth factors signal through tyrosine phosphorylation of a family of related transcription factors. Immunity. 1994;1:457–468. [PubMed]
31. Bonni A, Frank DA, Schindler C, Greenberg ME. Characterization of a pathway for ciliary neurotrophic factor signaling to the nucleus. Science (Wash DC) 1993;262:1575–1579. [PubMed]
32. Zhang X, Blenis J, Li H-C, Schindler C, ChenKiang S. Requirement of serine phosphorylation for formation of STAT-promoter complexes. Science (Wash DC) 1995;267:1990–1994. [PubMed]
33. Akira S, Nishio Y, Inoue M, Wang X-J, Wei S, Matsusaka T, Yoshida K, Sudo T, Naruto M, Kishimoto T. Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130mediated signaling pathway. Cell. 1994;77:63–71. [PubMed]
34. Wegenka UM, Lutticken C, Buschmann J, Yuan J, Lottspeich F, Muller-Esterl W, Schindler C, Roeb E, Heinrich PC, Horn F. The interleukin-6-activated acute-phase response factor is antigenically and functionally related to members of the signal transducer and activator of transcription (STAT) family. Mol Cell Biol. 1994;14:3186–3196. [PMC free article] [PubMed]
35. Karras JG, Huo L, Wang Z, Frank DA, Zimmet JM, Rothstein TL. Delayed tyrosine phosphorylation and nuclear expression of STAT1 following antigen receptor stimulation of B lymphocytes. J Immunol. 1996;157:2299–2308. [PubMed]
36. Wen Z, Zhong Z, Darnell JE., Jr Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell. 1995;82:241–250. [PubMed]
37. Wicker LS, Boltz RC, Matt V, Nichols EA, Peterson LB, Sigal NH. Suppression of B cell activation by cyclosporin A, FK506 and rapamycin. Eur J Immunol. 1990;20:2277–2283. [PubMed]
38. Kunz J, Hall MN. Cyclosporin A, FK506 and rapamycin: more than just immunosuppression. Trends Biochem Sci. 1993;18:334–338. [PubMed]
39. Ying-zi C, Rabin E, Wortis HH. Treatment of murine CD5B cells with anti-Ig, but not LPS, induces surface CD5: two B cell activation pathways. Intl Immunol. 1991;3:467–476. [PubMed]
40. Rothstein TL, Kolber DL, Murphy TP, Cohen DP. Induction of phorbol ester responsiveness in conventional B cells after activation via surface Ig. J Immunol. 1991;147:3728–3735. [PubMed]
41. Wang Z, Morris DL, Rothstein TL. Constitutive and inducible levels of egr-1 and c-mycearly growth response gene expression in B-1 lymphocytes. Cell Immunol. 1995;162:309–314. [PubMed]
42. Herzenberg LA, Kantor AB. B cell lineages exist in the mouse. Immunol Today. 1993;14:79–83. [PubMed]
43. Haughton G, Arnold LW, Whitmore AC, Clarke SH. B-1 cells are made, not born. Immunol Today. 1993;14:84–87. [PubMed]

Articles from The Journal of Experimental Medicine are provided here courtesy of The Rockefeller University Press