PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Gene. Author manuscript; available in PMC Nov 15, 2008.
Published in final edited form as:
PMCID: PMC2045687
NIHMSID: NIHMS32667
CD13/APN transcription is regulated by the proto-oncogene c-Maf via an atypical response element
Kathleen M. M. Mahoney, Nenad Petrovic,1 Wolfgang Schacke, and Linda H. Shapiro*
Center for Vascular Biology, Department of Cell Biology, University of Connecticut Health Center, Farmington, Connecticut
Address for Correspondence: Linda H. Shapiro, Center for Vascular Biology MC3501, Department of Cell Biology, University of Connecticut Health Center for Vascular Biology, 263 Farmington Ave, Farmington, CT 06030-3501, lshapiro/at/neuron.uchc.edu
1Present affiliations: Faculty of Pharmacy, University of Sydney, Sydney, Australia
Angiogenic growth factors induce the transcription of the cell surface peptidase CD13/APN in activated endothelial cells of the tumor vasculature. Inhibition of CD13/APN abrogates endothelial invasion and morphogenesis in vitro and tumor growth in vivo suggesting a critical functional role for CD13 in angiogenesis. Experiments to identify the transcription factors responsible for this regulation demonstrated that exogenous expression of the proto-oncogene c-Maf, but not other bZip family members tested, potently activates transcription from a critical regulatory region of the CD13 proximal promoter between −115 and −70 bp which is highly conserved among mammalian species. Using promoter mutation, EMSA and ChIP analyses we established that both endogenous and recombinant c-Maf directly interact with an atypical Maf response element contained within this active promoter region via its basic DNA/leucine zipper domain. However full activity of c-Maf requires the amino-terminal transactivation domain, and site-directed mutation of putative phosphorylation sites within the transactivation domain (serines 15 and 70) shows that these sites behave in a dramatic cell type-specific manner. Therefore, this atypical response element predicts a broader range of c-Maf target genes than previously appreciated and thus impacts its regulation of multiple myeloma as well as endothelial cell function and angiogenesis.
Keywords: endothelial, aminopeptidase, angiogenesis, bZIP
The CD13 or aminopeptidase N (CD13/APN) cell surface glycoprotein is not expressed on resting vessels but its expression is induced on activated endothelial cells in response to angiogenic growth factors (Pasqualini et al., 2000; Bhagwat et al., 2001). In vitro inhibition of CD13 with peptidase inhibitors or antibodies abrogates endothelial invasion and morphogenesis (Bhagwat et al., 2001; Bhagwat et al., 2003; Petrovic et al., 2003) and in vivo inhibition reduces angiogenesis and halts tumor growth (Pasqualini et al., 2000). Investigation into the pathways regulating the expression of CD13 in activated endothelium may identify novel factors and fundamental processes involved in the activation of endothelial cells.
Two distinct promoters regulate the transcriptional expression of CD13 in a tissue specific manner (Shapiro et al., 1991). CD13 expression in cells committed to the myeloid lineage is regulated by its distal promoter located eight kilobases upstream of the translational start codon, while transcription in endothelial cells and epithelial cells is directed by the proximal promoter immediately upstream of the start codon (Bhagwat et al., 2001). Through Ras-dependent mitogen-activated pathway kinase (MAPK) and phospatidylinositol-3 kinase signaling pathways, angiogenic factor such as bFGF and VEGF activate the transcription factor Ets-2-directed transcription of CD13 in endothelial cells (Bhagwat et al., 2001; Bhagwat et al., 2003; Petrovic et al., 2003). However, further experiments indicated that additional transcriptional mechanisms independent Ets-2 controlled CD13 expression. In the current study we sought to identify auxiliary transcription factors that contribute to the regulation of CD13 expression in endothelial cells.
Similar to the Ets family of transcription factors, the role of the AP-1 transcription factor is well established in vascular biology (Lelievre et al., 2001). The AP-1 factor is a heterodimeric complex consisting of members of either the Jun, Fos, ATF or Maf families of transcription factors (Eferl and Wagner, 2003). While the roles of Jun and Fos are established in vascular biology, the structurally related Maf proteins have not been studied in angiogenesis. In this investigation we establish the proto-oncogene c-Maf as a positive regulator of the CD13 proximal promoter by its direct binding to a region highly conserved across mammalian species. Furthermore we demonstrate that the activity of c-Maf requires its transactivation domain where it is differentially regulated by two conserved serine residues. Our work suggests that not only can c-Maf activate transcription of its target genes via a novel response element, but that c-Maf may also regulate CD13 in activated endothelial cells, identifying it as a potential therapeutic target in pathologic angiogenesis.
2.1 Cell Culture and Transfections
Kaposi sarcoma derived endothelial (Ogawa et al., 2000., Herndier et al., 1994) and mouse hemangioendothelioma cell lines (Obeso et al., 1990) were maintained in Dulbecco modified Eagle medium (DMEM) under standard culture conditions. Human umbilical vein endothelial cells (HUVEC) were obtained from Clonetics Corporation (San Diego, CA) and maintained according to the manufacturer’s protocol.
Plasmids were transfected into EOMA cells as described (Petrovic et al., 2003) and luciferase values normalized to protein content. The siRNA were constructed with the Silencer siRNA Construction Kit (Ambion, Austin, TX) to target three different sequences within the coding region of c-Maf: 1179 Sense strand: aacttccaggtgcgccttctgcctgtctc; 1184S: aagtagtcttccaggtgcgcc cctgtctc, 1996S: aattgtcgctgctcgagccgtcctgtctc (Hurt et al., 2004). The siRNA were tested for their specificity and efficiency of knocking down protein expression of newly transcribed RNA by co-transfecting various expression plasmids (c-Maf, MafB, and c-Fos) and 10nM of each individual siRNA.
2.2. Details of reporter and expression plasmids
The 5′ deleted 153-bp reporter plasmid (153/luc) was previously characterized (Petrovic et al., 2003). The 115-bp reporter (115/luc) and the 70-bp reporter plasmid (70/luc) were constructed using PCR and incorporating a 5′ XmaI and 3′ HindIII site for cloning into pGL2 basic. Deletion of the c-Maf response element in the 153-bp reporter plasmid (Δ120-87/luc) was made by incorporation of a KpnI site into the region by PCR mutagenesis. Site-directed mutation of motifs (113mut/luc, 104mut/luc, and 97mut/luc) were made using PCR to incorporate XmaI and HindIII sites for insertion into pGL2 vector. The IL-4 (M1) promoter (−797) plasmid was provided by Dr. M. Brown of Northwestern University (Tara et al., 1993). The −305/+5 IL-4 promoter region was subcloned into pGL2 basic as described above with primers also used in the chromatin immunoprecipitation assay for the positive control: (IL-4.-302F 5′-tccccccgggggaggagagccagtggcaacc; IL-4. +5.R 5′-atgccaagcttatgcaatgctggcagagatc). MafB, c-Maf and c-Maf mutant (C-term, PLER, R22E and L2P4P) expression plasmids were a gift of Dr. C. Kurschner; p18/MafK plasmid from Dr. P. Ney; c-Fos plasmid from Dr. T. Curran. The cJun plasmid was purchased from ATCC. c-MafS15A, c-MafS70A, c-Maf S15A/S70A mutants were made by PCR with internal primers incorporating the mutation and external primers with 5′ MluI and 3′ApaI sites, cloned into the c-Maf/RcRSV plasmid and sequence confirmed.
2.3. GST-fusion protein purification and electrophoretic mobility shift assay (EMSA)
The GST-cMaf plasmid (Hegde et al., 1998) consists of GST fused 5′ of the C-terminal domain of c-Maf (aa 257–360) and contains the bZip domain essential for dimerization and DNA binding. Recombinant c-Maf was produced as previously described (Hegde et al., 1998) and proper binding was assayed by EMSA with Maf response elements (Kataoka et al., 1994). Gel shift assay reactions were performed with 1–2 μg of nuclear lysate or 0.5 μg purified c-Maf and 5,000–25,000 cpm probe as previously described (Hegde et al., 1998).
2.4. RT-PCR analysis and Southern blot hybridization
Total RNA was isolated using RNAStat (Iso-Tex Diagnostics, Inc., Friendswood, TX). cDNA was reverse transcribed with SuperscriptII (Invitrogen) and amplified with the forward (5′-gcttcc gagaaaacggctc-3′) and reverse (5′-tgcgag tgggctcagttatg-3′) primers as described (Hurt et al., 2004). PCR products were probed with the internal oligo 5′-cgacaacccgtcctctcc cgagttt-3′ probe by Southern blot.
2.5. Western blot analysis
Whole cells were scraped directly into Laemmli buffer (Bio-Rad, Hercules, CA) and β-mercaptoethanol. Nuclear lysates were prepared as described (Schreiber et al., 1989). Antibodies (c-Maf, M153 and N15; v-Maf, N15; MafB, P20; MafF/G/K, C-18; c-Jun, D; and c-Fos, K-25) were purchased from Santa Cruz Biotechnologies (Santa Cruz, CA). To immunoprecipitate c-Maf, 500 μg of KS1767 nuclear lysate was precleared and incubated with 10 μg of M153 c-Maf rabbit antibody (or reagent grade IgG), immunoprecipitated as specified by the manufacturer and immunoblotted with N14 c-Maf goat antibody.
2.6. Chromatin Immunoprecipitation (ChIP) Assay
ChIP was performed following the Upstate ChIP Assay Kit (−295, Upstate Cell Signaling Solution, a Serological Company) protocol with an additional step of nuclear preparation before sonication (Cao et al., 2005, Weinmann et al., 2001). Nuclei were resuspended in lysis buffer and sonicated with the Dismembranator to produce chromatin fragments between 300 and 500-bp. Immunoprecipitation was performed with the anti-c-Maf (M153) antibody and twenty percent of the supernatant from the rabbit IgG immunoprecipitation was kept as a PCR positive control as the ‘input’. ChIP samples were eluted from agarose beads, ethanol precipitated and resuspended in 50μl water. PCR analysis (conditions 95°C, 5min; 95°C, 30s; 60°C, 45s; 72°C, 45s; for cycles indicated per primer pair; 72°C, 10 minutes) was performed on 5μl sample with primers specific for the proximal promoter of CD13 (153.F: agtccagtgacctt cgcctgttggagccctggttaatt; 33R: tttggggaggcgg ctcagggagcctcaggcca); as a negative control, for the distal promoter of CD13 (411F: tctagactacgagtcccaggtacc; 130R: gtgtcccgcaggg agccttgt) and as a positive control, for IL-4 promoter (primers described in section 2.2). Relative intensities were calculated with the Kodak Molecular Imaging Software (Eastman Kodak Company, Rochester, NY).
3.1. The region between −153 and −70 of the proximal promoter is essential for activity in endothelial cells
To identify essential cis-acting elements regulating CD13 transcription in endothelial cells, we assayed the transcriptional activity of a series of reporter plasmids containing progressive 5′ deletions of the one-kilobase proximal promoter which we have previously shown to control endothelial CD13 transcription [ref. (Bhagwat et al., 2001) Fig. 1A]. We used the murine hemangioendothelioma cell line (EOMA) as our model system which faithfully recapitulates CD13 regulation in primary endothelial cells (Bhagwat et al., 2001, Bhagwat et al., 2003, Petrovic et al., 2003). While the −153bp promoter fragment (153/luc) was marginally less active (81%) than the full-length promoter (1kb/luc), further deletion of the sequences upstream of either −115bp (115/luc) or −70bp (70/luc) significantly compromised promoter activity (29% and 3% respectively). These experiments distinguished what appears to be two essential transcriptional regions; one located in a 38-nucleotide region between −153 and −115 bp; and the second located between −114 and −70 bp upstream of the start codon. Sequence alignment shows that the region between −153 and −70 is highly conserved across a number of mammalian species (Fig. 1B). This region has also been shown to contain multiple functional cis-acting elements that regulate CD13 transcription in the porcine liver and intestine (Olsen et al., 1991). We have previously established that in endothelial cells, Ets-2 transactivates CD13 through an element located in the region between −153 and −115bp (Petrovic et al., 2003). However, based on our deletion assays, Ets-2 is clearly not solely responsible for the CD13 transcriptional activity in endothelial cells.
Figure 1
Figure 1
The region between −153 and −70 of the proximal promoter of CD13/APN is essential for activity in endothelial cells
3.2. The bZip transcription factor c-Maf transactivates the CD13 promoter in endothelial cells
The bZip transcription factors, particularly AP-1, play important roles in angiogenesis and cellular differentiation (Blank and Andrews, 1997). To test whether CD13 may be a bZip target, we co-transfected endothelial cells with a panel of expression plasmids containing individual bZip family members with the CD13 1kb/luc reporter plasmid and assayed for luciferase activity. Exogenous expression of c-Jun, c-Fos, MafB, or MafK produced negligible effects on CD13-driven luciferase activity as did cotransfection of c-Fos and c-Jun. However, exogenous expression of c-Maf activated 1kb/luc reporter gene transcription in a dose-dependent manner five to fifteen fold over values obtained in cells transfected with the expression vector alone (Fig. 2A). Furthermore transactivation by c-Maf expression plasmids was specifically abrogated by treatment of cells with siRNAs that effectively knock down newly transcribed c-Maf protein (Fig. 2B), confirming that transactivation depends on c-Maf (Fig. 2C).
Figure 2
Figure 2
c-Maf transactivates the CD13 promoter in endothelial cells via a response element between −153 and −70
3.3. c-Maf directly binds the −153 bp promoter region
Transcription factors are composed of discrete functional domains performing specific tasks that contribute to the overall activity of the molecule (Fig. 3A). To determine the functional domains of the c-Maf protein that are essential for maximal activation of the CD13 promoter, we tested the ability of a panel of mutant c-Maf expression plasmids to transactivate the full length 1kb/luc in endothelial cells (Fig. 3B). Deletion of the N terminal three-fourths of the c-Maf cDNA results in a protein lacking a transactivation domain but retaining the domains essential for both protein dimerization and DNA binding [C-term plasmid, aa 257–340 (Kurschner and Morgan, 1995)]. Co-transfection of this plasmid with the 1kb/luc reporter impaired but did not completely abrogate c-Maf-directed transcription (Fig. 3B), suggesting that the transactivation domain is essential for maximal activity. However, the failure to completely arrest transcription may reflect the fact that this truncated protein retains its ability to heterodimerize with endogenous partners via its intact leucine zipper and thus may recruit transcriptional coactivators to the promoter. In contrast, disruption of bZip domain-dependent protein-protein interactions by substitution of two of the six leucine residues in the zipper region with proline resulted in complete abrogation of the ability of c-Maf to induce CD13 promoter activity in agreement with the requirement for bZip domain-dependent protein-protein interactions [L2P4P mutant (Kataoka et al., 1993), Fig 3B]. Finally, co-transfection of expression plasmids containing mutations disturbing c-Maf binding to DNA again showed impaired transactivation when compared to the intact protein [PLER (Kurschner and Morgan, 1995) and R22E (Kataoka et al., 1993), Fig 3B] with the more extensive alterations of PLER resulting in a more profound effect on c-Maf’s transactivation potential, suggesting that c-Maf may directly bind the promoter through this domain.
Figure 3
Figure 3
c-Maf directly binds the first 153bp of the the proximal promoter
To determine if c-Maf transactivates through one of the transcriptionally relevant regions identified by our deletion analysis, we co-transfected the c-Maf expression plasmid with the −153/luc, −115/luc, and −70/luc reporter constructs. While deletion of the region between −153 and −115 did not have a significant effect on the ability of c-Maf to transactivate the reporter constructs, elimination of the second region between −115 and −70 significantly reduced transactivation (Figure 3C), implying that c-Maf acts via a motif contained within this promoter region. To confirm a direct interaction between c-Maf and the promoter, we used the recombinant bZip domain of the c-Maf protein (Hegde et al., 1998) in an electrophoretic mobility shift assay (EMSA, Fig. 3D). We determined that c-Maf is able to bind the 153bp promoter region which is inhibited by addition of excess unlabeled oligonucleotide containing the Maf recognition element (Fig. 3D, lane 3). In contrast, competition with an oligonucleotide spanning the region between −153 to −115 containing the Ets-2 motif (Petrovic et al., 2003) was not observed (Fig. 3D, lane 4).
3.4. c-Maf acts through an atypical response element
Because c-Maf can directly bind the CD13 promoter and the relevant region of the CD13 promoter does not contain a canonical palindromic Maf response element, we initiated an unbiased assessment of the putative Maf binding site. Competition analysis using a series of overlapping unlabelled oligonucleotides spanning the relevant promoter region showed that only the oligomer analogous to the −120 to −87 region was able to abrogate binding of the recombinant c-Maf to the −153 to −1 promoter fragment probe (Fig. 4A). Partial inhibition shown with sequences overlapping and immediately upstream of this region (−132 to −107) suggests that the c-Maf recognition site may extend to these sequences as well. In agreement with this notion, EMSA using the −120 to −87 oligomer as a probe indicated that purified c-Maf binds to these sequences, albeit with lower efficiency than the 153bp probe (data not shown).
Figure 4
Figure 4
c-Maf acts through an atypical response element within the proximal promoter of CD13
While consensus Maf recognition elements have been identified (Kataoka et al., 1994), further investigation has shown that the binding of Maf proteins to DNA is quite complex. Analysis of many other c-Maf responsive promoters indicates that the TGC nucleotides that flank the classical AP-1 response element (TGCn6–7GCA) actually specify Maf binding [Fig. 4B, (Dlakic et al., 2001)]. Inspection of the c-Maf binding sequence in CD13 showed that it contains two TGC motifs between −120 and −87 bp. To assess the functional importance of these sequences to CD13 promoter activity, each of the TGC motifs were altered via site-directed mutagenesis within the context of the 153/luc plasmid (Fig. 4C). Mutation of the −113TGC−110 motif significantly abrogated transcription from the CD13 promoter in endothelial cells (Fig. 4D) while the other two mutations had a negligible effect on activity. Interestingly, sequences immediately upstream of this functional TGC motif are extremely AT-rich, comparable to previously characterized Maf response elements [Table 1, (Yoshida et al., 2005)] and possibly indicating an extended c-Maf recognition site. Indeed, deletion of the −120 to −87 region in the context of the 153 bp promoter completely abrogated CD13 promoter activity, supporting this concept (Fig. 4D).
Table 1
Table 1
Alignment of multiple AT-rich Maf response elements in endogenous promoters [modified from(Yoshida et al., 2005)].
3.5. Putative phosphorylation sites of c-Maf are differentially utilized
bZip transcription factor activity is controlled via phosphorylation of serine and/or threonine residues (Civil et al., 2002, Kawauchi et al., 1999). Sequence alignment of the large Maf proteins showed that numerous putative phosphorylation sites in the amino terminal transactivation domain are highly conserved (Civil et al., 2002) a region we find critical for maximal activation of the CD13 promoter in endothelial cells. We chose to focus on two ERK phosphorylation sites which are strictly conserved in all of the large Maf proteins (serines 15 and 70 in the c-Maf sequence, Fig. 5A) and functionally regulate the related protein L-Maf, yet are uncharacterized in c-Maf (Civil et al., 2002, Kawauchi et al., 1999). We introduced mutations into the c-Maf expression plasmid to alter these serine residues (Ser15 and Ser70, analogous to Ser14 and Ser65 in LMaf/MafA) to alanine residues, either individually or in combination and confirmed the expected expression profile by western blot analysis (Fig. 5B). The observed mobilities are comparable to those described for the analogous L-Maf mutants where proteins harboring the S65A mutation showed faster mobility than either wild type or those containing the S14A alteration (Benkhelifa et al., 2001) and are independent of the phosphorylation status of the protein.
Figure 5
Figure 5
c-Maf activity is dependent on two highly conserved c-Maf serine residues that are regulated differently in endothelial and liver cells
Maf family members have been reported to act as both transcriptional activators or repressors and their characterized phosphorylation sites can serve to either stimulate or inhibit function (Nishizawa et al., 2003, Ochi et al., 2003). To determine if the c-Maf point mutants (S15A, S70A, and S15A/S70A) display cell type-dependent functional variability, we assessed their transactivation capacity in endothelial and liver epithelial cell lines (153/luc, Fig. 5C). We also assessed their activity in both cell lines using the IL-4 c-Maf responsive promoter (−302/+5m1) to establish whether these mutants also display promoter-dependent functional variability (IL-4/luc, Figure 5D). While the c-Maf S70A mutation did not significantly alter c-Maf induced CD13 transcription in either cell line, it markedly increased liver specific transactivation of the IL-4 promoter. The negative effect of the c-Maf S15A mutation on the CD13 promoter is only apparent in endothelial cells (Fig 5C left). These results demonstrate the context dependence of c-Maf transcriptional regulatory activity.
3.6. c-Maf is expressed in endothelial cells
To confirm that c-Maf is endogenously expressed in endothelial cells we amplified c-Maf RNA from human primary endothelial cells and human and murine endothelial cell lines by RT-PCR and confirmed the identity of amplified products by southern blot analysis using a c-Maf specific internal oligonucleotide probe. Primary human umbilical vein cells (HUVEC), the human Kaposi’s sarcoma endothelial cell line KS1767 and the murine EOMA cell line all expressed detectable levels of c-Maf mRNA (Fig. 6A). The c-Maf overexpressing human multiple myeloma line OPM2 served as a positive control (Hurt et al., 2004).
Figure 6
Figure 6
c-Maf is expressed in endothelial cells and directly binds the first 153bp of the endogenous proximal promoter of the CD13 gene
To assay whether endogenous c-Maf interacts with the relevant CD13 promoter region, nuclear extracts of KS1767 cells were incubated with the 153bp probe. Since KS1767 cells express high levels of endogenous CD13, they presumably contain CD13 regulatory factors and thus are a useful model for assaying nuclear factors in activated endothelial cells (Bhagwat et al., 2003, Petrovic et al., 2003). Multiple complexes were found to bind the promoter region from the endothelial nuclear proteins in an electrophoretic mobility shift assay (EMSA, Fig. 6B). The binding of the slowest migrating complex to the probe behaved similarly to recombinant c-Maf: inhibition of complex formation by excess unlabeled oligonucleotide containing the Maf recognition element (Fig. 6B, lanes 2,4,7), which was unaffected by the oligonucleotide containing the Ets-2 motif (−153 to −115, Fig. 6B, lane 8), suggesting that this complex contains proteins in the Maf family. While the low level of endogenous c-Maf protein in endothelial cells was not demonstrable in nuclear lysates, it was evident upon immunoprecipitation followed by Western blot analysis (KS1767 cells, Fig. 6C). Therefore, c-Maf mRNA and protein are expressed in CD13 positive endothelial cells. To assess if endogenous c-Maf proteins bind to the CD13 promoter within the nucleus, a chromatin immunoprecipitation assay was performed. DNA immunoprecipitated with antibodies directed against the c-Maf protein amplified with either PCR primer pairs specific for sequences −153 to −1 of the proximal promoter or the positive control IL-4 promoter were both enriched for their respective target chromatin, while the negative control primer pairs designed to detect a region of similar size in the distal promoter of CD13 did not (8 kb upstream, Figure 6D). This data supports that endogenous c-Maf interacts with the CD13 proximal promoter in endothelial cells, consistent with our hypothesis that c-Maf contributes to CD13 expression in endothelial cells.
In the present study, we demonstrate that c-Maf activates transcription through an atypical motif in the CD13 proximal promoter. The bZip transcription factors classically bind palindromic response elements as dimers. However the Maf transcription factors frequently activate endogenous promoters through response elements that consist of only one half of the canonical palindromic Maf response element (Yoshida et al., 2005). c-Maf induces CD13 transcription by directly binding the minimal half site through its basic DNA/leucine zipper domain. This has been attributed to the presence of a unique extended homology region in the Maf bZIP subfamily that encodes a helical ancillary binding domain. This helical domain is thought to alter the conformation of the DNA binding region resulting in interactions distinct from those of c-Jun and other bZip dimers (Dlakic et al., 2001). In the present study, we show that the AT-rich region adjacent to the TGC motif in the CD13 proximal promoter is required for c-Maf binding. Since it is becoming clear that Maf proteins can recognize and transactivate through motifs bearing minimal homology to the established consensus site, it is reasonable to suspect that the pool of Maf targets is considerably larger than that predicted by simple consensus site searches.
Aberrant expression of c-Maf activates multiple pathways that mediate tumorigenesis either by the direct induction of cell cycle proteins or indirectly by promoting tumor-stroma interactions (Hurt et al., 2004, Suzuki et al., 2005). While ectopic expression of c-Maf transforms chicken embryonic fibroblasts (Kataoka et al., 1993), overexpression of c-Maf, MafB, or L-Maf in primary embryonic neuroretinal cells does not result in their transformation. This finding highlights the significance of proper regulation of c-Maf expression. While the precise mechanisms regulating the functional activity of many of the Maf proteins are unclear, modification of the transactivation domain further regulates c-Maf activity, as evident by functional assay of deletion and site-directed mutations of c-Maf. Our finding that the c-Maf S15A and c-Maf S70A mutants behave in a distinct cell type specific fashion is interesting in comparison with L-Maf activation of the crystallin gene. We find that alteration of the Ser15 and Ser70 residues increases c-Maf activity on the CD13 promoter in the HepG2 liver cell line and thus are inhibitory. However others have found that the S14A/S65A double mutant of L-Maf significantly reduced L-Maf activity (Ochi et al., 2003, Benkhelifa et al., 2001). The mechanisms regulating activation of Maf family proteins have been investigated (Gardner and Montminy, 2005) and include a model invoking bFGF/MEK/ERK-induced phosphorylation that triggers proteosome-dependent degradation (Ochi et al., 2003) to explain L-Maf’s decreased stability in neural retinal cells. In contrast, inhibition of the MAPK, MEK, increased c-Maf transactivation of the gammaD crystallin gene (Civil et al., 2002), while we observe that a similar MEK inhibition decreases c-Maf transactivation of the CD13 promoter in endothelial cells to a similar extent as mutation of Ser15 (unpublished observations, Mahoney and Shapiro). Therefore, in endothelial cells the Ras/MAPK signal transduction pathway appears to activate c-Maf and CD13 transcription (Bhagwat et al., 2003) but inhibits L-Maf (and c-Maf) activity in primary neural retinal cells (Ochi et al., 2003). Thus its effects on Maf family members are particularly cell- and promoter-dependent.
Maf family members also frequently cooperate with members of other transcription factor families (Ho et al., 1996, Huang et al., 2002, Rajaram and Kerppola, 2004, Sevinsky et al., 2004, Aramata et al., 2005) and can also interact with transcriptional coactivators, such as CREB-binding protein and p300 to activate gene transcription (Chen et al., 2002). In our hands co-transfection of c-Maf with either Ets-2 or c-Jun expression plasmids did not show synergistic effects between these transcription factors on the CD13 proximal promoter (data not shown). Investigations to identify additional proteins that cooperate with c-Maf in endothelial cells are ongoing on our laboratory. Since CD13 is transcriptionally induced in tumor endothelium, further investigation into the role of c-Maf as an activator of angiogenesis is clinically relevant. We were unable to alter endogenous levels of CD13 in our endothelial models, through either overexpression or knockdown of c-Maf. While we found effective and specific siRNAs for knocking down transfected c-Maf protein levels, experiments using these siRNAs to reduce endogenous levels of c-Maf were much less effective and produced only a 40–50% inhibition of c-Maf mRNA levels by RT-PCR after five days in culture. Not only does c-Maf likely function at low concentrations but the c-Maf protein may be quite stable and relatively refractory to siRNA effects.
c-Maf null mice have been produced and found to die in utero between embryonic day 15.5 and 18.5 (Kim et al., 1999), precluding the analysis of CD13 expression in pathologic angiogenesis models. The cause of the premature death in the c-Maf null mouse has not been determined, but the relatively late stage mortality indicates that c-Maf is either compensated for by another large Maf or not involved in embryonic vasculogenesis. However, pathologic angiogenesis in the adult is believed to occur via processes distinct from those of normal developmental angiogenesis(Marchio et al., 2004, Marler et al., 2002, Becker et al., 2005) and thus formation of functional embryonic vasculature in the absence of c-Maf does not preclude its critical role in angiogenesis in the adult. An endothelial-specific c-Maf null animal model will be useful for addressing this question. Considering its function as an oncogene, c-Maf provides a particularly interesting transcriptional regulator in endothelial cells. The aberrant and specific upregulation of the expression of cyclin D2, integrin β7, and the chemokine receptor CCR1 genes has been reported in c-Maf overexpressing multiple myeloma cell lines which contributes to tumorigenicity (Hurt et al., 2004). Since endothelial cells normally express these genes (Strasly et al., 2004) they may also be angiogenically relevant targets of c-Maf in endothelial cells. Transcriptional control of regulators of pathologic angiogenesis on activated endothelium is an important aspect of our understanding of those signals and proteins that contribute to the establishment of an actively angiogenic state. Further investigation of c-Maf regulated genes is essential for a greater understanding of its relevance to human disease.
Acknowledgments
We would like to thank Kevin Claffey, Ann Cowan, Bruce White, Andrew Arnold, Beth Conway, Catherine O’Conor, and Xiufang Liu for technical assistance and for helpful discussions. This study was supported by NIH grants R01 CA 85714 and R01 HL 69442 and BCTR0402745 from the Susan G. Komen Foundation to LHS.
Abbreviations
CD13/APNalanyl aminopeptidase, aminopeptidase N, microsomal aminopeptidase, gp150, Myeloid plasma membrane glycoprotein CD13
c-Mafhomolog of avian musculoaponeurotic fibrosarcoma AS42 viral oncogene
bZipbasic DNA/leucine zipper domain family of transcription factors
EMSAelectrophoretic mobility shift assay
HUVEChuman umbilical vein endothelial cells
PCRpolymerase chain reaction
GSTglutathione S-transferase
μgmicrogram

Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
  • Ahmad M, Theofanidis P, Medford RM. Role of activating protein-1 in the regulation of the vascular cell adhesion molecule-1 gene expression by tumor necrosis factor-alpha. J Biol Chem. 1998;273:4616–4621. [PubMed]
  • Amaral MC, Miles S, Kumar G, Nel AE. Oncostatin-M stimulates tyrosine protein phosphorylation in parallel with the activation of p42MAPK/ERK-2 in Kaposi’s cells. Evidence that this pathway is important in Kaposi cell growth. J Clin Invest. 1993;92:848–857. [PMC free article] [PubMed]
  • Andrews NC, Kotkow KJ, Ney PA, Erdjument-Bromage H, Tempst P, Orkin SH. The ubiquitous subunit of erythroid transcription factor Nf-E2 is a small basic-leucine zipper protein related to the v-maf oncogene. PNAS. 1993;90:11488–11492. [PubMed]
  • Aramata S, Han SI, Yasuda K, Kataoka K. Synergistic activation of the insulin gene promoter by the beta-cell enriched transcription factors MafA, Beta2, and Pdx1. Biochim Biophys Acta. 2005;1730:41–6. [PubMed]
  • Becker CM, et al. Endostatin inhibits the growth of endometriotic lesions but does not affect fertility. Fertil Steril. 2005;84(Suppl 2):1144–55. [PubMed]
  • Benkhelifa S, Provot S, Nabais E, Eychene A, Calothy G, Felder-Schmittbuhl MP. Phosphorylation of MafA is essential for its transcriptional and biological properties. Mol Cell Biol. 2001;21:4441–52. [PMC free article] [PubMed]
  • Bhagwat SV, Lahdenranta J, Giordano R, Arap W, Pasqualini R, Shapiro LH. CD13/APN is activated by angiogenic signals and is essential for capillary tube formation. Blood. 2001;97:652–659. [PubMed]
  • Bhagwat SV, Petrovic N, Okamoto Y, Shapiro LH. The angiogenic regulator CD13/APN is a transcriptional target of Ras signaling pathways in endothelial morphogenesis. Blood. 2003;101:1818–1826. [PubMed]
  • Blank V, Andrews NC. The Maf transcription factors: regulators of differentiation. Trends Biochem Sci. 1997;22:437–41. [PubMed]
  • Cao S, Liu J, Song L, Ma X. The protooncogene c-Maf is an essential transcription factor for IL-10 gene expression in macrophages. J Immunol. 2005;174:3484–92. [PMC free article] [PubMed]
  • Chen Q, Dowhan DH, Liang D, Moore DD, Overbeek PA. CREB-binding protein/p300 co-activation of crystallin gene expression. J Biol Chem. 2002;277:24081–9. [PubMed]
  • Civil A, van Genesen ST, Lubsen NH. c-Maf, the gammaD-crystallin Maf-responsive element and growth factor regulation. Nucleic Acids Res. 2002;30:975–82. [PMC free article] [PubMed]
  • Dlakic M, Grinberg AV, Leonard DA, Kerppola TK. DNA sequence-dependent folding determines the divergence in binding specificities between Maf and other bZIP proteins. Embo J. 2001;20:828–40. [PubMed]
  • Eferl R, Wagner EF. AP-1: a double-edged sword in tumorigenesis. Nat Rev Cancer. 2003;3:859–68. [PubMed]
  • Funahashi J, Kamachi Y, Goto K, Kondoh H. Identification of nuclear factor delta EF1 and its binding site essential for lens-specific activity of the delta 1-crystallin enhancer. Nucleic Acids Res. 1991;19:3543–7. [PMC free article] [PubMed]
  • Gardner KH, Montminy M. Can you hear me now? Regulating transcriptional activators by phosphorylation. Sci STKE 2005. 2005:pe44.
  • Hegde SP, Kumar A, Kurschner C, Shapiro LH. c-Maf interacts with c-Myb to regulate transcription of an early myeloid gene during differentiation. Mol Cell Biol. 1998;18:2729–2737. [PMC free article] [PubMed]
  • Herndier BG, et al. Characterization of a human Kaposi’s sarcoma cell line that induces angiogenic tumors in animals. Aids. 1994;8:575–81. [PubMed]
  • Ho IC, Hodge MR, Rooney JW, Glimcher LH. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell. 1996;85:973–983. [PubMed]
  • Huang W, Lu N, Eberspaecher H, De Crombrugghe B. A new long form of c-Maf cooperates with Sox9 to activate the type II collagen gene. J Biol Chem. 2002;277:50668–75. [PubMed]
  • Hurt EM, et al. Overexpression of c-maf is a frequent oncogenic event in multiple myeloma that promotes proliferation and pathological interactions with bone marrow stroma. Cancer Cell. 2004;5:191–199. [PubMed]
  • Kataoka K, Nishizawa M, Kawai S. Structure-function analysis of the maf oncogene product, a member of the b-Zip protein family. J Virol. 1993;67:2133–2141. [PMC free article] [PubMed]
  • Kataoka K, Noda M, Nishizawa M. Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun. Mol Cell Biol. 1994;14:700–712. [PMC free article] [PubMed]
  • Kawauchi S, et al. Regulation of lens fiber cell differentiation by transcription factor c- Maf. J Biol Chem. 1999;274:19254–19260. [PubMed]
  • Kerppola TK, Curran T. Maf and Nrl can bind to AP-1 sites and form heterodimers with Fos and Jun. Oncogene. 1994;9:675–84. [PubMed]
  • Kim JI, Li T, Ho IC, Grusby MJ, Glimcher LH. Requirement for the c-Maf transcription factor in crystallin gene regulation and lens development. Proc Natl Acad Sci USA. 1999;96:3781–3785. [PubMed]
  • Kurschner C, Morgan JI. The maf proto-oncogene stimulates transcription from multiple sites in a promoter that directs Purkinje Neuron-specific gene expression. Mol Cell Biol. 1995;15:246–254. [PMC free article] [PubMed]
  • Lelievre E, Lionneton F, Soncin F, Vandenbunder B. The Ets family contains transcriptional activators and repressors involved in angiogenesis. Int J Biochem Cell Biol. 2001;33:391–407. [PubMed]
  • Liu QR, Tini M, Tsui LC, Breitman ML. Interaction of a lens cell transcription factor with the proximal domain of the mouse gamma F-crystallin promoter. Mol Cell Biol. 1991;11:1531–7. [PMC free article] [PubMed]
  • Manzanares M, et al. Conserved and distinct roles of kreisler in regulation of the paralogous Hoxa3 and Hoxb3 genes. Development. 1999;126:759–69. [PubMed]
  • Manzanares M, Cordes S, Kwan CT, Sham MH, Barsh GS, Krumlauf R. Segmental regulation of Hoxb-3 by kreisler. Nature. 1997;387:191–5. [PubMed]
  • Marchio S, et al. Aminopeptidase A is a functional target in angiogenic blood vessels. Cancer Cell. 2004;5:151–62. [PubMed]
  • Marler JJ, et al. Successful antiangiogenic therapy of giant cell angioblastoma with interferon alfa 2b: report of 2 cases. Pediatrics. 2002;109:E37. [PubMed]
  • Matsuo I, Yasuda K. The cooperative interaction between two motifs of an enhancer element of the chicken alpha A-crystallin gene, alpha CE1 and alpha CE2, confers lens-specific expression. Nucleic Acids Res. 1992;20:3701–12. [PMC free article] [PubMed]
  • Nakamura T, et al. Regulation of the mouse alpha A-crystallin gene: isolation of a cDNA encoding a protein that binds to a cis sequence motif shared with the major histocompatibility complex class I gene and other genes. Mol Cell Biol. 1990;10:3700–8. [PMC free article] [PubMed]
  • Nishizawa M, Kataoka K, Vogt PK. MafA has strong cell transforming ability but is a weak transactivator. Oncogene. 2003;22:7882–90. [PubMed]
  • Obeso J, Weber J, Auerbach R. A hemangioendothelioma-derived cell line: its use as a model for the study of endothelial cell biology. Lab Invest. 1990;63:259–269. [PubMed]
  • Ochi H, Ogino H, Kageyama Y, Yasuda K. The stability of the lens-specific Maf protein is regulated by fibroblast growth factor (FGF)/ERK signaling in lens fiber differentiation. J Biol Chem. 2003;278:537–44. [PubMed]
  • Ogawa K, Pasqualini R, Lindberg RA, Kain R, Freeman AL, Pasquale EB. The ephrin-A1 ligand and its receptor, EphA2, are expressed during tumor neovascularization. Oncogene. 2000;19:6043–52. [PubMed]
  • Olsen J, Laustsen L, Karnstrom U, Sjostrom H, Noren O. Tissue-specific interactions between nuclear proteins and the aminopeptidase N promoter. J Biol Chem. 1991;266:18089–18096. [PubMed]
  • Pasqualini R, et al. Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis. Cancer Res. 2000;60:722–727. [PubMed]
  • Petrovic N, Bhagwat SV, Ratzan WJ, Ostrowski MC, Shapiro LH. CD13/APN transcription is induced by RAS/MAPK-mediated phosphorylation of Ets-2 in activated endothelial cells. J Biol Chem. 2003;278:49358–49368. [PubMed]
  • Rajaram N, Kerppola TK. Synergistic transcription activation by Maf and Sox and their subnuclear localization are disrupted by a mutation in Maf that causes cataract. Mol Cell Biol. 2004;24:5694–5709. [PMC free article] [PubMed]
  • Roth HJ, Das GC, Piatigorsky J. Chicken beta B1-crystallin gene expression: presence of conserved functional polyomavirus enhancer-like and octamer binding-like promoter elements found in non-lens genes. Mol Cell Biol. 1991;11:1488–99. [PMC free article] [PubMed]
  • Schreiber E, Matthias P, Muller MM, Schaffner W. Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res. 1989;17:6419. [PMC free article] [PubMed]
  • Sevinsky JR, Whalen AM, Ahn NG. Extracellular signal-regulated kinase induces the megakaryocyte GPIIb/CD41 gene through MafB/Kreisler. Mol Cell Biol. 2004;24:4534–45. [PMC free article] [PubMed]
  • Shapiro LH, Ashmun RA, Roberts WM, Look AT. Separate Promoters control transcription of the human aminopeptidase N gene in myeloid and intestinal epithelial cells. J Biol Chem. 1991;266:11999–12007. [PubMed]
  • Strasly M, et al. CCL16 activates an angiogenic program in vascular endothelial cells. Blood. 2004;103:40–9. [PubMed]
  • Suzuki A, et al. ARK5 is transcriptionally regulated by the Large-MAF family and mediates IGF-1-induced cell invasion in multiple myeloma: ARK5 as a new molecular determinant of malignant multiple myeloma. Oncogene 2005
  • Tara D, Weiss DL, Brown MA. An activation-responsive element in the murine IL-4 gene is the site of an inducible DNA-protein interaction. J Immunol. 1993;151:3617–26. [PubMed]
  • Weinmann AS, Bartley SM, Zhang T, Zhang MQ, Farnham PJ. Use of chromatin immunoprecipitation to clone novel E2F target promoters. Mol Cell Biol. 2001;21:6820–32. [PMC free article] [PubMed]
  • Yoshida T, Ohkumo T, Ishibashi S, Yasuda K. The 5′-AT-rich half-site of Maf recognition element: a functional target for bZIP transcription factor Maf. Nucleic Acids Res. 2005;33:3465–78. [PMC free article] [PubMed]