PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of annrheumdAnnals of the Rheumatic DiseasesVisit this articleSubmit a manuscriptReceive email alertsContact usBMJ
 
Ann Rheum Dis. 2007 June; 66(6): 832–834.
Published online 2007 January 9. doi:  10.1136/ard.2006.068841
PMCID: PMC1954666

Autoinflammatory gene mutations in Behçet's disease

Abstract

Background

Behçet's disease (BD) shares clinical features with well‐recognised autoinflammatory disorders. In addition, mutations in genes for familial Mediterranean fever and tumour necrosis factor receptor‐associated periodic syndrome have been reported to have increased in patients with BD.

Patients and methods

DNA samples from 97 patients with BD and 51 matched healthy controls were analysed for the mevalonate kinase (MVK), cold‐induced autoinflammatory syndrome 1 (CIAS1) and proline/serine/threonine phosphatase‐interacting protein 1 (PSTPIP1) genes, responsible for mevalonate kinase deficiency (MKD), cryopyrin associated periodic syndromes (CAPS) and pyogenic sterile arthritis, pyoderma gangrenosum and acne (PAPA) syndrome, respectively. Over 90% of known mutations were screened using restriction fragment length polymorphism analysis and/or sequencing.

Results

Two patients had paired mutations in the MVK gene (genotypes V377I/V377I and V377I/S135L) and displayed typical features of BD and MKD. Another was heterozygotic for the V377I genotype. The V198M mutation in the CIAS1 gene was identified in one patient with typical BD but no symptoms of CAPS. No mutations were identified in the control group. PSTPIP1 analysis revealed a new exon 10 insertion variant (c.741+33_741+34insGT) in 2 of 97 patients and in 1 of 51 controls (p>0.05), indicating that it is a polymorphism rather than a true mutation.

Discussion

This study could not demonstrate any significant increases in MVK, CIAS1 or PSTPIP1 mutations in patients with BD as compared with controls.

Behçet's disease (BD) is a complex chronic and relapsing inflammatory disorder that has been extensively described in young adults from Eastern Asia and Mediterranean countries. Its essential manifestations are oral and genital ulcerations, folliculitis, erythema nodosum and uveitis. The presence of vasculitis worsens the prognosis, introducing the potential for life‐threatening complications such as thrombophlebitis, arterial aneurysms and occlusion. The aetiology of BD is unknown. Because BD shares clinical similarities with certain well‐recognised autoinflammatory disorders, we wondered whether the gene responsible for familial Mediterranean fever (MEFV) could be involved. We have previously demonstrated a higher frequency of MEFV mutations in patients with BD, with respect to their ethnicity.1 Other groups have confirmed these data and found an association between the presence of MEFV mutations and the severity of vasculitis.2 Recently, the R92Q mutation in the TRAPS (tumour necrosis factor receptor‐associated periodic syndrome) gene, which is responsible for another defect of innate immunity, was reported to have increased in patients with BD.3 In view of these findings, and because BD is a multifactorial disease, we decided to test additional autoinflammatory genes—namely mevalonate kinase (MVK), cold‐induced autoinflammatory syndrome 1 (CIAS1) and proline/serine/threonine phosphatase‐interacting protein 1 (PSTPIP1)—responsible for mevalonate kinase deficiency (MKD), cryopyrin associated periodic syndromes (CAPS) and pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA) syndrome, respectively, as possible susceptibility factors for BD. We did not identify any relevant association with the main mutations responsible for these disorders. Interestingly, however, two patients were found to have genetic MKD.

Patients and methods

We analysed 97 DNA samples from patients with BD for MVK, CIAS1 and PSTPIP1,responsible for MKD, CAPS and PAPA, respectively. Complete clinical information was obtained from their medical chart reviews. The DNA analysis was performed systematically in patients who fulfilled the international criteria for BD.4 None of their doctors had clinical suspicions of another disease. We also analysed DNA from 51 ethnically matched healthy controls. The mean ages of the patients and controls were comparable (35 vs 37 years). The male:female sex ratio was 0.83:1 among patients and 0.59:1 among controls. Over 90% of the known mutations were screened using restriction fragment length polymorphism analysis and/or sequencing. The MVK and CIAS1 mutational hot spots (ie, V377I, exon 2 and exon 9 for MVK and exon 3 for CIAS1) were screened as described previously by Federici et al.5 (MVK exons 2 and 9, CIAS1 exon 3 and the corresponding intronic boundaries of these genes were amplified using M13‐tagged primers. A total of 50 ng of genomic DNA, 2.5 mm MgCl2, 0.25 µm each of forward and reverse primers, 0.025 U of Taq gold polymerase and 0.2 mm dNTP were used for amplification reactions as follows: an initial denaturation at 95°C for 9 min; 30 cycles of denaturing at 94°C (30 s), annealing at 58°C and extension at 72°C (1 min); and a final 9 min extension at 72°C. PCR efficiencies were verified on a 5% acrylamide gel, and 1–4 µl of amplified product was directly submitted to sequencing in both directions with M13 universal primers using the Big Dye Terminator V.3.1 kit (Applied Biosystems, Foster City, California, USA), following the manufacturer's suggestions. Sequencing products were run on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). MVK exon 11 was amplified using 1176 and 1381 primers6 and the PCR fragments were digested with BsmA1 to examine V377I, the most frequent hyperimmunoglobulinemia D and periodic fever syndrome (HIDS) mutation.)

The two known PAPA mutations were analysed by PCR amplification using primers PST10FM13 (tgtaaaacgacggccagtactgggcttccagcagagag) and PST10RM13 (caggaaacagctatgacctgagctgctgaggcctgaga), followed by sequencing in both directions for mutation A230T, and primers PST11FM13 (tgtaaaacgacggccagtcacaatggcctgtgaggag) and PST11RM13 (caggaaacagctatgaccaagggagctgtgagctac), followed by BstN1 digestion for mutation E250Q.

Results

Mutations were identified in 4 (4%) of 97 patients (table 11).). Two of the four had paired mutations in the MVK gene (genotypes V377I/S135L and V377I/V377I) and displayed features typical of both BD and MKD (table 22).). The first was a 16‐year‐old French girl with BD who had bipolar aphtosis, erythema nodosum, severe acne, and transient knee and ankle arthritis. She also had recurrent fevers that appeared monthly, accompanied by chills, headaches, abdominal pain, diarrhoea and conjunctivitis. She experienced adverse reactions to immunisation, which induced flares of erythema nodosum. She had marked hyper‐IgA (5 g/l; IgD and mevalonic aciduria not performed) and was negative for HLAB51. The second patient was a 30‐year‐old French woman with recurrent fevers, bipolar aphtosis, erythema nodosum, skin reactions after immunisation, polyarthralgia and keratitis. A third patient was heterozygotic for V377I and displayed a typical BD phenotype without other MKD‐related symptoms. The fourth patient had the V198M mutation in the CIAS1 gene and showed typical BD but no features of CAPS. Clinical phenotypes and DNA analysis results of other family members of this last patient were not available. Considering the low penetrance of the V198M mutation, there was only a low probability of a diagnosis of CAPS in this patient.

Table thumbnail
Table 1 Mutations and sequence variants detected in our study population
Table thumbnail
Table 2 Clinical features of patients with Behçet's disease carrying autoinflammatory gene mutations

No mutations were identified in the control group. We did not find any patient or control with either of the two known mutations (A230T and E250Q) in the PSTPIP1 gene. We did, however, identify a new exon 10‐intron insertion variant (c.741+33_741+34insGT) in two non‐paediatric patients. This insGT was identified in 2 of 97 patients and in 1 of 51 controls (p>0.05), indicating that it is a polymorphism and not a true mutation. RNA from these patients was unavailable to test whether this insertion affected gene expression. These results do not support a strong role for non‐familial Mediterranean fever (FMF) hereditary periodic fever genes in BD, although we cannot rule out the possibility that rare mutations are involved.

Discussion

Autoinflammatory disorders represent a new category of heritable diseases, characterised by recurrent self‐limited inflammatory attacks occurring without evident precipitating events. They include FMF (the prototypic disease), MKD (complete and hyper‐IgD syndrome (HIDS)), TRAPS, CAPS and, more recently, PAPA syndrome.7 These diseases result from mutations in five distinct genes that are listed on the regularly updated central INFEVERS website.8 BD, by contrast, is considered a systemic inflammatory disease, most likely involving adaptive immunity and particularly T lymphocytes skewed towards the T helper 1 phenotype and producing the pro‐inflammatory cytokines interleukin (IL) 2, IL6, IL8, IL12, IL18, tumour necrosis factor ‐α and interferon γ. On the basis of certain clinical similarities, its episodic nature and the importance of granulocyte activation in its pathogenesis, BD has been suggested to be another autoinflammatory disease. The participation of MEFV and tumour necrosis factor α receptor 1 mutations in the course and pathogenesis of the disease was described previously. As autoinflammatory diseases share many clinical features, and as the proteins involved have molecular and functional similarities, we wondered whether non‐FMF gene mutations could be detected in patients with BD. We analysed DNA samples from 97 patients with BD who fulfilled the international criteria. Our results did not identify any relevant association between BD and the genes responsible for MKD, CAPS or PAPA.

Interestingly, two patients with typical features of BD were discovered to have genetic MKD (two mutations). MKD (also called, in milder forms, hyper‐IgD syndrome or HIDS) is much less frequent than BD. The main presentation is recurrent fever lasting 5–7 days, accompanied by headaches, lethargy, cervical adenitis, abdominal distress, diarrhoea, urticarial rash and transient arthritis. The first manifestations of HIDS start during the first year of life and are triggered by infections and immunisations.9 A high level of serum IgD was previously considered to be a hallmark of HIDS, but an increasing number of case reports have shown that this finding is neither constant nor specific to the disease. The detection of slight mevalonic aciduria in a febrile patient allows a diagnosis, as HIDS is caused by a partial mevalonate kinase deficiency. Genetic confirmation is performed by identifying mutations in the MVK gene on chromosome 12p13.10,11 Our two patients showed symptoms of both diseases, specifically bipolar aphtosis and headaches. In both patients, skin hypersensitivity was not strictly a pathergic phenomenon, but was rather erythema nodosum and urticarial rash triggered by antigen stimulation (especially immunisations). Although recurrent fevers and eye symptoms were present in both patients, the reported symptoms (keratitis and conjunctivitis) were distinct from typical BD uveitis. In patient 1, the fact that chronic diarrhoea was present could have shifted the diagnosis towards MKD.12 Conversely, the presence of erythema nodosum in our two genetically proven patients with MKD was initially a strong argument for a diagnosis of BD. To our knowledge, we are the first to report erythema nodosum, a key feature of BD, as part of the clinical spectrum of MKD. Another patient with only one MKD mutation presented with a typical BD phenotype, but in this case bipolar aphtosis could have been part of the two diseases. Thus, patients with BD with early‐onset recurrent fevers, bipolar aphtosis, abdominal complaints and atypical eye involvement should be investigated for MVK gene mutations.

In one patient, we identified the V198M mutation in the CIAS1 gene, which is responsible for dominant disorders called CAPS syndromes. These three disorders encompass a spectrum of clinical features increasing in severity from familial cold urticaria to Muckle and Wells syndrome, and finally to chronic infantile neurological, cutaneous and articular syndrome.13,14 None of the key features of these syndromes (urticarial rash, conjunctivitis, debilitating arthralgia or myalgia) were observed in our patient, who carried a low‐penetrance mutation of CIAS1. A familial study of clinical symptoms and DNA sequences may help rule out CAPS syndrome in this patient, who has a typical BD phenotype.

The two known mutations in the PSTPIP1 gene (A230T and E250Q) were not detected in our patients.15 We did, however, identify a new sequence variant in two patients with BD and in one control, making it a polymorphism and not a true mutation. None of these patients had features of PAPA syndrome, a rare disorder manifested by episodes of sterile pyogenic arthritis, cystic acne and pyoderma gangrenosum.16 Nevertheless, the consequences of this insertion on PSTPIP1 gene expression need to be further analysed.

In conclusion, BD was not associated with non‐FMF autoinflammatory genes (MVK, CIAS1 and PSTPIP1) in our patients. We did, however, show that BD can occasionally overlap clinically and genetically with MKD, a disease to look for in young children with recurrent fevers, abdominal complaints and bipolar aphtosis.

Abbreviations

BD - Behçet's disease

CAPS - cryopyrin‐associated periodic syndromes

CIAS1 - cold‐induced autoinflammatory syndrome 1

HIDS - hyper IgD syndrome

FMF/MEFV - familial Mediterranean fever MKD, mevalonate kinase deficiency

MVK - mevalonate kinase

PAPA - pyogenic sterile arthritis, pyoderma gangrenosum and acne

PSTPIP1 - proline/serine/threonine phosphatase interacting protein 1

Footnotes

Competing interests: None declared.

References

1. Touitou I, Magne X, Molinari N, Navarro A, Le Quellec A, Picco P. et al MEFV mutations in Behçet's disease. Hum Mutat 2000. 16271–272.272 [PubMed]
2. Atagundunz P, Ergun T, Direskeneli H. MEFV mutations are increased in Behçet's disease (BD) and are associated with vascular involvement. Clin Exp Rheumatol 2003. 21(Suppl 30)S35–S37.S37
3. Amoura Z, Dodé C, Hue S, Caillat‐Zucman S, Bahram S, Delpech M. et al Association of the R92Q TNFRSF1A mutation and extracranial deep vein thrombosis in patients with Behcet's disease. Arthritis Rheum 2005. 52608–611.611 [PubMed]
4. International Study Group for Behçet's Disease Criteria for the diagnosis of Behçet's disease. Lancet 1990. 3351078–1080.1080 [PubMed]
5. Federici L, Rittore‐domingo C, Kone‐Paut I, Jorgensen C, Rodière M, Le Quellec A. et al A decision tree for genetic diagnosis of hereditary periodic fever in unselected patients. Ann Rheum Dis 2006. 651427–1432.1432 [PMC free article] [PubMed]
6. Cuisset L, Drenth J P, Simon A, Vincent M F, van der Velde Visser S, van der Meer J W, et al; International Hyper‐IgD Study Group Molecular analysis of MVK mutations and enzymatic activity in hyper‐IgD and periodic fever syndrome. Eur J Hum Genet 2001. 9260–266.266 [PubMed]
7. Ozen S, Hoffman H M, Frenkel J, Kastner D. Familial Mediterranean fever (FMF) and beyond: a new horizon. Fourth International Congress on the Systemic Autoinflammatory Diseases held in Bethesda, USA, 6–10 November 2005. Ann Rheum Dis 2006. 65961–964.964 [PMC free article] [PubMed]
8. Touitou I, Lesage S, McDermott M, Cuisset L, Hoffman H, Dodé C. et al INFEVERS: an evolving mutation database for auto‐inflammatory syndromes. Hum Mutat 2004. 24194–198.198 [PubMed]
9. Simon A, Cuisset L, Vincent M F, van De Velde‐Wisser S D, Delpech M, van Der Meer J W. et al Molecular analysis of the mevalonate kinase gene in a cohort of patients with the hyper‐IgD and periodic fever syndrome: its application as a diagnostic tool. Ann Intern Med 2001. 135338–343.343 [PubMed]
10. Drenth J P, Cuisset L, Grateau G, Vasseur C, van De Velde‐Wisser S D, de Jong J G. et al Mutations in the gene encoding mevalonate kinase cause hyper‐IgD and periodic fever syndrome. International Hyper‐IgD Study Group. Nat Genet 1999. 22180–183.183
11. Houten S M, Kuis W, Duran M, de Koning T J, van Royen‐Kerkhof A, Romeijn G J. et al Mutations in the MVK encoding mevalonate kinase cause hyperimmunoglovulinemia D and periodic fever syndrome. Nat Genet 1999. 22175–177.177 [PubMed]
12. Oretti C, Barbi E, Marchetti F, Lepore L, Ventura A, D'Osualdo A. et al Diagnostic challenge of hyper‐IgD syndrome in four children with inflammatory gastrointestinal complaints. Scand J Gastroenterol 2006. 41430–436.436 [PubMed]
13. Feldman J, Prieur A M, Quartier P, Berquin P, Certain S, Cortis E. et al Chronic infantile neurological cutaneous and articular syndrome is caused by mutations in CIAS1, a gene highly expressed in polymorphonuclear cells and chondrocytes. Am J Hum Genet 2002. 71198–203.203 [PubMed]
14. Arostegui J L, Aldea A, Modesto C, Rua M J, Arguelles F, Gonzales‐Ensenat M A. et al Clinical and genetic heterogeneity among Spanish patients with recurrent autoinflammatory syndromes associated with the CIAS1/PYPAF1/NALP3 gene. Arthritis Rheum 2004. 504045–4050.4050 [PubMed]
15. Lindor N M, Arsenault T M, Solomon H, Seidman C E, Mc Evoy M T. A new autosomal dominant disorder of pyogenic sterile arthritis, pyoderma gangrenosum, and acne: PAPA syndrome. Mayo Clin Proc 1997. 72611–615.615 [PubMed]
16. Wise C A, Gillum J D, Seidman C E, Lindor N M, Bashiardes S, Lovett M. Mutations in CD2BP1 disrupt binding to PTP PEST and are responsible for PAPA syndrome, an autoinflammatory disorder. Hum Mol Genet 2002. 11961–969.969 [PubMed]

Articles from Annals of the Rheumatic Diseases are provided here courtesy of BMJ Group