Search tips
Search criteria 


Logo of annrheumdAnnals of the Rheumatic DiseasesVisit this articleSubmit a manuscriptReceive email alertsContact usBMJ
Ann Rheum Dis. 2007 May; 66(5): 706–707.
PMCID: PMC1954624

Extrapituitary prolactin promoter polymorphism in Czech patients with systemic lupus erythematosus and rheumatoid arthritis

Prolactin (PRL) and its production by lymphocytes have been suggested to play a distinct role in the pathogenesis of systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA).1,2 PRL acts as a cytokine and influences the maturation and differentiation of immune cells.3,4 Extrapituitary PRL synthesis is regulated by an alternative promoter,5 which contains a single‐nucleotide polymorphism (SNP) at the region −1149 G/T. Higher PRL mRNA expression is associated with the G allele in lymphocytes.6 High frequency of the G allele was described in patients with SLE,7 but was not confirmed in other work.8

We investigated −1149 G/T SNP in 156 patients with SLE and 173 patients with RA, and in 123 healthy individuals (control group). Patients with SLE consisted of 134 (85.9%) women and 22 (14.1%) men, with a mean age of 43.4 years. SLE diagnosis was determined using the American College of Rheumatology classification criteria.9 Patients with RA consisted of: 132 (76.3%) women and 41 (23.7%) men, with a mean age of 57.4 years; all fulfilled the RA diagnostic criteria.10 The control group consisted of 40 (32.5%) women and 83 (67.5%) men, with a mean age of 38.7 years. The study was approved by the ethics committee of The Third Medical Faculty, Charles University, Prague, Czech Republic.

The PCR—RFLP (restriction fragment length polymorphism) method was used for −1149 G/T SNP detection. During PCR, the 137 base pairs (bp) region of the PRL extrapituitary promoter was amplified by using the following primers: forward 5′‐GCAGGTCAAGATAACCTGGA and reverse 5′‐CATCTCAGAGTTGAATTTATTTCCTT. For RFLP, ApoI restriction endonucleasis was used. The genotypes identified were TT homozygote characterised by 120 and 17 bp, GG homozygote characterised by 85, 35 and 17 bp, and GT heterozygote characterised by 120, 85 and 35 bp + 17 bp DNA fragments. Results were evaluated by χ2 test with Bonferroni correction.

There was no difference in genotype and allele frequencies in the SLE group compared with healthy Czech individuals (table 11).). Our results support previous Italian findings,8 but differ from the UK report.7 However, with respect to the specific organ manifestation of SLE (table 11),), we detected an association between the G allele and articular involvement (Pc = 0.0086, OR 2.56, 95% CI 1.51 to 4.33). Based on age when SLE was diagnosed, we observed a GG genotype frequency of 44.8% in the 21–40 years subgroup compared with 15.8% and 24.0% in the <20 years and >40 years subgroup, respectively (Pc = 0.023, OR 2.94, 95% CI 1.43 to 5.96). Additionally, we correlated the presence of alleles and genotypes of −1149 G/T SNP with antibodies against antinuclear antibody, double‐stranded DNA, Sm, RNP, Ro and La, but no connection was found (data not shown).

Table thumbnail
Table 1 Occurrence of genotype and allele frequencies of −1149 G/T single‐nucleotide polymorphism of the extrapituitary prolactin promoter in Czech patients with systemic lupus erythematosus (SLE) and rheumatoid arthritis and controls, ...

Significantly higher heterozygote GT genotype was detected in the RA group compared with the controls (Pc = 0.039, OR 1.82, 95% CI 1.14 to 2.94). We observed no differences in homozygote genotypes or in allele frequencies between patients with RA and controls (table 11).). Across the groups, no gender differences in genotype distribution or allele frequencies were identified (data not shown).

In conclusion, the presence of the G allele and GG genotype of the PRL extrapituitary promoter −1149 G/T SNP is associated with certain clinical features of SLE. The GT genotype is a predisposing genetic factor for RA. Further investigation on this is required.


This study was financially supported by the research programme of the Ministry of Health of the Czech Republic—IGA MZ CR: NR/8191‐3/2004.


PRL - prolactin

RA - rheumatoid arthritis

SLE - systemic lupus erythematosus

SNP - single‐nucleotide polymorphism


Competing interests: None declared.


1. Leańos‐Miranda A, Cárdenas‐Mondragon G. Serum free prolactin concentrations in patients with systemic lupus erythematosus are associated with lupus activity. Rheumatology 2006. 4597–101.101 [PubMed]
2. Neidhart M, Gay R E, Gay S. Prolactin and prolactin‐like polypeptides in rheumatoid arthritis. Biomed Pharmacother 1999. 53218–222.222 [PubMed]
3. Matera L. Endocrine, paracrine and autocrine actions of prolactin on immune cells. Life Sci 1996. 59599–614.614 [PubMed]
4. Grimaldi C M. Sex and systemic lupus erythematosus: the role of the sex hormones estrogen and prolactin on the regulation of autoreactive B cells. Curr Opin Rheumatol 2006. 18456–461.461 [PubMed]
5. Gellersen B, Kempf R, Telgmann R, DiMattia G E. Nonpituitary human prolactin gene transcription is independent of Pit‐1 and differentially controlled in lymphocytes and in endometrial stroma. Mol Endocrinol 1994. 8356–373.373 [PubMed]
6. Stevens A, Ray D, Alansari A, Hajeer A, Thomson W, Donn R. et al Characterization of a prolactin gene polymorphism and its associations with systemic lupus erythematosus. Arthritis Rheum 2001. 442358–2366.2366 [PubMed]
7. Stevens A, Ray D W, Worthington J, Davis J R. Polymorphisms of the human prolactin gene—implications for production of lymphocyte prolactin and systemic lupus erythematosus. Lupus 2001. 10676–683.683 [PubMed]
8. Mellai M, Giordano M, D'Alfonso S, Marchini M, Scorza R, Giovanna Danieli M. et al Prolactin and prolactin receptor gene polymorphisms in multiple sclerosis and systemic lupus erythematosus. Hum Immunol 2003. 64274–284.284 [PubMed]
9. Hochberg M C. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1997. 401725
10. Arnett F C. Revised criteria for the classification of rheumatoid‐arthritis. Bull Rheum Dis 1989. 381–6.6 [PubMed]

Articles from Annals of the Rheumatic Diseases are provided here courtesy of BMJ Group