PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Curr Biol. Author manuscript; available in PMC 2008 April 3.
Published in final edited form as:
PMCID: PMC1913718
NIHMSID: NIHMS21308
Generalization of courtship learning in Drosophila is mediated by cis-vaccenyl acetate
Aki Ejima,* Benjamin P.C. Smith,§ Christophe Lucas,§ Wynand Van der Goes van Naters, Carson J. Miller, John R. Carlson, Joel D. Levine,§ and Leslie C. Griffith*
* Dept. of Biology and Volen Center for Complex Systems, Brandeis University MS008, 415 South St., Waltham, MA 02454-9110, USA
§ Dept. of Biology, University of Toronto at Mississauga, 3359 Mississauga Rd. North, Mississauga ON L5L 1C6, Canada
Dept. of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT 06520, USA
Corresponding Author: Leslie C. Griffith, Dept. of Biology MS008, Brandeis University, 415 South St.,Waltham, MA 02454-9110, Phone: 781 736 3125, FAX: 781 736 3107, Email: griffith/at/brandeis.edu
Reproductive behavior in Drosophila has both stereotyped and plastic components that are driven by age- and sex-specific chemical cues. Males who unsuccessfully court virgin females subsequently avoid females that are of the same age as the trainer. In contrast, males trained with mature mated females associate volatile appetitive and aversive pheromonal cues and learn to suppress courtship of all females. Here we show that the volatile aversive pheromone that leads to generalized learning with mated females is (Z)-11-octadecenyl acetate (cis-vaccenyl acetate, cVA). cVA is a major component of the male cuticular hydrocarbon profile, but it is not found on virgin females. During copulation, cVA is transferred to the female in ejaculate along with sperm and peptides that decrease her sexual receptivity. When males sense cVA (either synthetic or from mated female or male extracts) in the context of female pheromone, they develop a generalized suppression of courtship. The effects of cVA on initial courtship of virgin females can be blocked by expression of tetanus toxin in Or65a, but not Or67d neurons, demonstrating that the aversive effects of this pheromone are mediated by a specific class of olfactory neuron. These findings suggest that transfer of cVA to females during mating may be part of the male’s strategy to suppress reproduction by competing males.
Keywords: Learning and memory, olfaction, Drosophila, pheromones, cis-vaccenyl acetate
In Drosophila, unsuccessful courtship decreases subsequent courtship [1, 2]. When the initial courtship object (trainer) is a virgin female, suppression has been shown to be the result of formation of an associative memory linking the failure to copulate with volatile stimulatory courtship cues specific to the age of the female trainer [1]. Exposure to a mated female, on the other hand, results in a suppression of courtship toward all types of females [1, 2] and is believed to require an aversive pheromone [3]. The cuticular hydrocarbon profiles of mature and immature females differ significantly [1, 4, 5], but these types of females also differ behaviorally. Mature virgins are receptive to courtship, while immature virgins and mated females show characteristic rejection behaviors. Immature females kick, fend and run away, while mated females extrude their ovipositors [6, 7]. To determine if female behavior or appearance had any role in the development of age-specific or general courtship suppression, we trained and tested males with decapitated females in dim red light (Figure 1). Memory index was expressed as a ratio of the courtship index (CI) during the 10 min test period to the mean CI of a sham-trained males tested with the same type of female. The use of a ratio allows direct comparison of the strength of memory between conditions, with a value of CItest/mCIsham = 1 indicating no memory.
Figure 1
Figure 1
Courtship suppression learned with a mated female trainer is generalized to all types of females
We find that, consistent with results with mobile trainer females [1], decapitated virgins provoke an age-specific suppression, while decapitated mated female trainers cause general suppression of courtship. These data indicate that the specificity of learning with different trainer types does not stem from behavioral differences in the trainer female’s response to courtship or from visual cues specific to the trainer type. Generalization of learning with a mated female trainer is therefore the result of chemosensory cues. In all subsequent experiments, decapitated trainers and testers were used, except where noted.
In the previous experiment, males were placed in the same chamber as the trainer female and therefore could obtain both olfactory and gustatory information about that female. To investigate the nature of the generalization cue, we attempted to reconstitute generalized learning with virgin trainers and mated female extracts. Placing a filter containing a hexane extract of mated female in the chamber with either a mature or immature trainer female caused a generalization of learning, as demonstrated by the ability of mature trainers to generate memory against immature testers and vice versa (Supplemental Table 1). To determine if the active component of the mated female bouquet was volatile, we used a two compartment courtship chamber (Figure 2A) and placed a pheromone source (fly corpse or filter with extract) across a mesh from the side of the chamber containing the male and the trainer female. For both mature and immature trainers, the presence of volatile compounds from either a mated female or a male was sufficient to cause generalization of courtship suppression, although the effects of these pheromones appeared more potent with mature trainers (Figure 2B and C). In the absence of a courtship object, the presence of a filter with extract (Supplemental Table 1) or a corpse (Figure 2B and C) did not generate suppression of courtship toward tester females.
Figure 2
Figure 2
The generalizing cue is a volatile pheromone
We next addressed the identity of the generalization cue. The mated female and mature virgin trainers we use are of the same age (4–5 days old), and might be expected to have similar cuticular hydrocarbon profiles, so any compound that differed between these two classes of females might have a role in generalization. We compared hexane washes of 4–5 day old virgins and 4–5 day old mated females that had been mated 24 h before extraction, using gas chromatography-flame ionization detection and mass spectrometry (Figure 3A, top two traces). Qualitatively, the two types of females appear identical with the exception of one peak, cis-vaccenyl acetate (cVA), which is undetectable in virgins but present at significant levels in mated females. cVA is a major component of mature male cuticular hydrocarbon (Figure 3A, lower trace) and is not synthesized by females [8, 9]. Its presence in both males and mated females makes it a good candidate for being the generalization cue for courtship learning.
Figure 3
Figure 3
Cuticular hydrocarbons of mature virgins and mated females differ in levels of cis-vaccenyl acetate
Quantitation of mature virgin and mated female hydrocarbon levels shows a significant difference in cVA levels (Figure 3B). There is also a small, but statistically insignificant (P > 0.05) increase in 7-tricosene (7-C23:1). 7-tricosene is a major component of the male cuticular hydrocarbon and believed to have inhibitory effects on male-male courtship [10]. Transfer of 7-tricosene to females has been shown to occur via cuticular contact during copulation, but it is largely gone by 8 h after mating [11]. Consistent with this, we see larger amounts of 7-tricosene on virgins that have been courted, but not copulated, when they are extracted immediately after the courtship (Figure 3C, left panel). Mature virgins and mated females that have been aged 24 h after copulation have lower and statistically indistinguishable levels of 7-tricosene. The loss over time (presumably through passive transfer and grooming) of 7-tricosene and the non-volatile nature of this compound make it an unlikely candidate for the generalizing cue. It is also significant to note that we do not see any decreases in mated females of hydrocarbons such as 7,11-heptacosadiene (7,11-nC27:2), 7,11-nonacosadiene (7,11-nC29:2) and 9-pentacosene (9-C25:1) that are believed to be stimulatory pheromones for courtship conditioning [12, 13]. Thus the only consistent mated female-specific difference in hydrocarbon content we find is in cVA.
How does cVA, a male lipid, become part of the mated female pheromonal profile? Like 7-tricosene, cVA could be transferred directly by contact during courtship and/or copulation. Alternatively, the presence of cVA in the male ejaculatory bulb suggests that it can be transferred with sperm during copulation [8]. To determine the major mode of cVA transmission, we measured cVA levels on virgin females, virgin females that were courted in a small chamber and extracted immediately, and females that were extracted 24 h after complete (>14 min) copulation or disrupted (≤2 min) copulation. We find that only females that copulated long enough to receive ejaculate [14] have significant levels of cVA (Figure 3C, right panel). Females that did not copulate and were merely courted by the male had virtually no cVA, even though they had significant amounts of passively acquired 7-tricosene (Figure 3C, left panel). This suggests that transfer of cVA occurs via ejaculate and that mated females store cVA.
These data support a role for cVA as a generalizing cue, but the presence of other volatile compounds in mated female and male extracts might still be required. To test the sufficiency of cVA, we applied varying amounts of purified cVA to filters across the mesh in a two compartment courtship chamber, trained males with either mature or immature virgins, then tested with a virgin of the other age. In both cases, cVA was sufficient to generalize memory (Figures 2B and C). With mature virgin testers, 0.2 ng of cVA was enough to generalize memory (Supplemental Table 2). The average amount of cVA present on a mated female 24 h after mating is 9.3 ± 3.5 ng, so the effects of synthetic cVA are occurring in the biologically relevant dose range. In contrast to results with mature virgins, pairing cVA with immature trainers is less effective. Only large amounts of cVA (200 μg) produce generalized learning. cVA alone (with no trainer female) is ineffective, as is cis-vaccenol (cVOH), a putative metabolite of cVA [15] with either trainer type (Supplemental Table 2).
The circuitry underlying generalization is of great interest for understanding this behavior. As a first step, we sought to identify the olfactory receptor neurons that carry the aversive cVA signal. cVA has been shown to be sensed by a subset of trichoid sensilla [16, 17] in the Drosophila antenna, which includes the T1 type sensillum [18] which expresses Or67d [19]. Using the ‘empty neuron’ preparation [20, 21], which allows the decoding of odor specificity for Drosophila olfactory receptors (ORs), we found that there is an additional cVA-responsive receptor, Or65a, and that Or65a and Or67d differ in their response to cVOH, with Or67d responding strongly and Or65a not responding (van der Goes van Naters and Carlson, submitted). Or65a is one of the several ORs expressed in neurons of the T3 sensilla [19].
Using this information, we investigated the role of the olfactory receptor neurons that express these two receptors in sensing the aversiveness of cVA. Initial courtship levels provide a simple assay for this property of cVA. Naive males show lower levels of courtship toward mated females than toward virgins of the same age [11, 2224]. This effect can be reproduced by addition of a cVA-laced filter across the mesh in the two compartment courtship chamber with a mature virgin courtship object in the upper chamber with the male (Figure 4A). Expression of tetanus toxin (TNT), which blocks synaptic release, under control of Or65a-GAL4, but not Or67d-GAL4 abolished the ability of cVA to inhibit initial courtship (Figure 4A and B). Males heterozygous for Or65a-GAL4 or the UAS-TNT transgene showed cVA-dependent courtship suppression as did males expressing inactive toxin (TNT-VA) under control of Or65a-GAL4. These results indicated that ORNs expressing Or65a-GAL4, but not Or67d-GAL4, are required for sensing cVA as an aversive cue.
Figure 4
Figure 4
Modulation of courtship by cVA requires Or65a-GAL4, but not Or67d-GAL4 olfactory sensory neurons
Or65a has been reported to be expressed solely in ORNs that innervated the DL3 glomerulus of the antennal lobe using anti-GFP immunohistochemistry in animals expressing GFP under control of Or65a-GAL4 promoter fusions. [19, 25]. Our Or65a-GAL4, while it has strong expression in DL3, shows a somewhat broader pattern, with significant expression in VA1, DC1 and DA4m (Supplemental Figure 1). Using confocal microscopy to directly visualize GFP from a UAS-mCD8-GFP transgene in unfixed brains, we compared our GAL4 line to the published Or65a-GAL4 lines. We found that our line was many times stronger than that published by Fishilevich et al. [25], which has predominant expression in DL3 (Supplemental Figure 2). GFP fluorescence in the Couto et al. [19] GAL4 line was barely detectable (data not shown). To determine if the weak, but more DL3-specific Fishilevich et al. driver (which we designate as V-Or65a-GAL4 in Figure 4B) would also block cVA effects, we used it to express active and inactive tetanus toxin. Consistent with the results using our Or65a-GAL4, active tetanus toxin significantly abrogated the ability of cVA to suppress initial courtship (Figure 4B), although the effect appeared weaker than with our line. Inactive tetanus toxin had no effect on cVA-mediated suppression. We conclude that the aversive effects of cVA on initial courtship are most likely mediated by ORNs expressing Or65a.
Since its identification as a male-specific lipid in the Drosophila ejaculatory bulb [8], there has been interest in cVA as a potential modifier of reproductive behavior. In this study we show that pairing of cVA and a virgin female trainer is sufficient to reproduce the unique effects of exposure to a mated female: generalized suppression of male-female courtship. We identify neurons expressing Or65a-GAL4 as responsible for the aversive effects of cVA. These results provided the first molecular/genetic insights into the pheromones responsible for courtship learning.
Our results also provide some insight into the controversial nature of cVA’s role in Drosophila behavior. The literature on cVA has posited roles for this lipid as both as an attractant [17, 26] and as an antiaphrodisiac [15, 27, 28], although this last function has been disputed [29, 30]. The social attractant role of cVA makes sense since it is deposited on eggs at feeding sites by females, and congregation at such sites is advantageous in terms of finding food and mates. The aversive role is equally plausible in light of cVA’s transfer to females during mating which would make it a marker of previous copulation. Understanding the molecular basis of cVA function and the circuitry subserving its behavioral effects will be necessary to completely unravel its multiple roles, but several important findings have emerged.
First, there are multiple cVA receptors, and they appear to have different behavioral roles. Or67d, which is expressed in T1, singly innervated sensilla, has a role in sensing the attractive properties of cVA [17, 18]. This receptor is not required for the courtship inhibitory role of cVA; this function appears to be served by Or65a, which is expressed in one of the three neurons of the T3 trichoid sensilla [19]. These data suggest that Or67d is an ‘appetitive’ cVA receptor while Or65a is an ‘aversive’ receptor. Segregating the hedonic effects of this lipid by activating two independent receptors is an interesting way of establishing, at an early step, independent behavioral circuits for attraction and repulsion. The lack of behavioral redundancy between Or65a and Or67d neurons is also interesting in light of findings with the non-pheromonal olfactory receptor Or43b, where elimination of the receptor does not change the behavioral response to its preferred odorant [31]. The interpretation of this study was that other olfactory receptors that recognized the odorant, but projected to different antennal glomeruli, could signal the same behavioral response. Our results suggest that for some pheromone odorants the antennal lobe circuitry they connect to is critical to the behavioral output they engender.
Second, responses to cVA appear to be context-dependent. Having multiple sensory channels for cVA does not itself help the animal decide how to respond to this chemical- there must be some mechanism by which the environment or other cues can tell the animals which sensory channel is relevant for a particular situation. One way to achieve this would be to have the cVA channels be linked to other, situation-relevant, odor cues. In the case of both attraction and aversion, this appears to be the case. The first report of cVA as an attractant, by Bartelt et al. in 1985, found that cVA was not attractive unless presented with food or food-associated odors [26]. This group’s assay set-up was designed to measure fast (minutes) attractive responses in an open arena, as opposed to the long-term (days) maze/trap assays used by Smith’s group [17] who did not uncover a role for food odor. The two paradigms may differ in sensitivity and relevance to particular behaviors, but the issue remains to be fully explored.
Context also appears to be important for the aversive effects of cVA. Synthetic cVA is a very effective, and completely sufficient, generalizing cue when applied in small doses to mature virgin trainers, but is not very effective, requiring 104 times more, when used with immature virgin trainers (Supplemental Table 1). The potency of mated female extracts with immature trainers is also less than with mature trainers, but the difference is not as exaggerated. This strongly suggests that some component of the mature female hydrocarbon profile that is not shared with immature virgins acts in concert with cVA to generalize learning. With the immature trainer, the mated female extract is supplying a low dose of cVA, but it also may supply a mature female compound that enhances the cVA effect. The identity of the compound(s) is unknown, but given that mature male extract is also able to allow generalization with immature trainers, it may be a hydrocarbon that is shared between mature males and females.
The requirement for concurrent mature fly chemical signals for cVA to be an effective aversive cue and generalizer of learning is not unreasonable from an evolutionary point of view. Under normal circumstances, cVA is only found on males or mated females. The meaning of cVA in the presence of male hydrocarbons is clear- males should suppress courtship of other males since it is wasted reproductive energy. If a male in the wild sees cVA in the context of an immature female pheromone profile, however, it is likely that he has encountered a virgin at a feeding site where cVA-laced eggs have been deposited, and he should not suppress courtship.
The underlying logic of suppressing courtship when presented with cVA in the context of a mature (and theoretically receptive) female is less obvious from a male’s point of view. Copulation with a previously mated female is not ideal since she is already storing sperm from her previous mate, but there is still marginal gain- the second male’s sperm can displace the first male’s sperm [32]. From the female’s reproductive point of view remating might also be advantageous since she will have more genetically diverse offspring, but it comes at a cost since it is correlated with reduced life span [33]. The only player for whom remating does not have some advantage is the first male. It has been well documented that components of seminal fluid in Drosophila alter female behavior and reproduction to decrease remating [34]. Transfer of cVA may be another facet of the successful male’s strategy to decrease reproduction by competitor males. The effect of cVA on initial courtship decreases a second male’s chances of success with that particular mated female, but the aftereffect, generalized suppression of his courtship drive, eliminates him as a competitor for other virgin females. The ability of cVA to engage the intrinsic plasticity machinery that allows animals to adapt to and learn from change to bring about a long lasting change in another male’s behavior could provide selective advantage to successfully copulating males.
Fly strains
Flies were raised on autoclaved cornmeal-yeast-sucrose-agar food in a 12 h light/dark cycle at 25°C. Males and females were anesthetized with CO2 on the day of eclosion then used immediately as immature flies or separated by sex and aged for four or five days. Experimental males were housed in individual tubes. Mated females were prepared by putting three day old females with males. Only females which copulated for ≥14 min were used the next day. Decapitated flies were prepared by cutting their head off with fine scissors just before use. Canton-S was used as the wild-type strain. Descriptions of the generation and characterization of promoter-GAL4 fusions for Or65a and Or67d are provided inSupplemental Materials. V-Or65a-GAL4 was a gift of Leslie Vosshall (Rockefeller University, New York, NY). Or-GFP transgenic lines used for identification of specific glomeruli were a gift of Barry Dickson (IMP, Vienna). UAS-TNT flies (active TNT-E and inactive IMPTNT-VA, obtained from the Bloomington Stock Center) were crossed to each GAL4 line for targeted expression of tetanus toxin [37].
Behavioral assays
All behavior experiment was done under dim red lights in a Harris environmental room (25° C, 70% humidity). A four or five-day-old male was placed with a decapitated female “trainer” in a single-pair-mating chamber (8 mm in diameter, 3 mm deep) for 1 h. In the experiments presented in Figure 2C, an intact immature virgin was used as a trainer for convenience, but this should not affect training outcome (compare Figure 1 and Figure 1 in Ejima et al., 2005). Wet filter paper (Whatman, 42 ashless) was put in each chamber to maintain humidity. To block direct contact with pheromone filters or odor-source flies, a fine nylon mesh (Tetko, 3-180/43) was introduced into a two-part chamber (8 mm in diameter, 6 mm deep). The first 10 min of the training period were videotaped with a digital camcorder (Sony, DSR-PD150). Pairs that copulated during training or that showed courtship lower than CI < 0.1 (see below) were eliminated from further analysis. Immediately after training, males were transferred into a clean chamber and paired with a decapitated female “tester” and videotaped for 10 min. Sham trained males were are kept alone in the mating chamber for the first hour and paired with a tester for 10 min.
For each of the 10 min periods, a courtship index (CI) was calculated. CI is the fraction of time a male spent in courtship activity in the 10 min observation period (CI = courtship [sec]/observation [sec]). Initial courtship is CI of the first 10 min when a naive male was put together with a female. Memory index is calculated by dividing CI at test (CItest) by the mean of sham CIs (CIsham): CItest/mCIsham. If CItest/mCIsham= 1, it indicates that there has been no learning since the courtship level of trained males is equivalent to that of sham trained males. ≥ 20 males were tested for each condition.
Statistical analysis
Each CI was subjected to arcsine square root transformation to effect an approximation of normal distribution, using JMP software version 5.0.1.2 for the Macintosh. ANOVA with each indicated condition as the main effect was performed on the transformed data. Posthoc analysis was done using Fisher’s PLSD test. Bars in figure represent means ± SEM with levels of significance indicated by *P significant = α < 0.05.
Pheromone extraction
Hexane extracts were prepared by washing the bodies of 20 flies with 80 μl of hexane (Aldrich). In order to collect male pheromones, a mature male was put on a wet filter paper in a mating chamber for 1 h to transfer odors to the filter. For training, 5 μl of extract, containing pheromones of about one donor fly, was applied to the filter paper in a mating chamber and evaporated for 2 min, after which 7 μl of water was added to the filter to add humidity. For chemistry, the extract was evaporated (passive evaporation at room temperature in a dust free environment) and stored at − 80 °C until analyzed. Synthetic cVA was purchased from Pherobank. Detailed methods for hydrocarbon analysis are provided inSupplemental Materials.
01
Supplemental Table 1. Pheromone extracts enhance courtship suppression. Males were trained in a courtship arena with two chambers separated by a mesh. The male was placed in the top chamber with or without a courtship object, as indicated (mVd, decapitated mature virgin or iVd, decapitated immature virgin). Hexane extracts of mated females on filters (M-extract) or filters that had been exposed to a mature male for 1 h (male-filter) were placed either in the top chamber with the male (no cross hatching between trainer and odor) or in the bottom chamber (cross hatch symbol placed between trainer and odor). In some cases a fly corpse, iVd, mVd, or decapitated male (male-d) was presented in the bottom chamber as an odor source. Odors presented in the top chamber could be sampled using both gustatory and olfactory sensory systems. Odors presented in the bottom chamber provided only olfactory cues. A memory index with either an immature or mature decapitated virgin tester was calculated. A value of 1 indicates no memory was formed. * or + means significantly different from training condition control (P < 0.05). N.S. means not significant. These data suggest that the generalization of learning requires some volatile substance(s) found on mated female and male cuticle; the experimental male does not have to touch the compound to respond to it. This compound does not by itself cause suppression of courtship since it requires the presence of a trainer female in the top chamber with the experimental male.
Supplemental Table 2. Synthetic cVA can act as a generalizing cue. Males were trained in a courtship arena with two chambers separated by a mesh, as indicated by the cross hatching between the courtship object and the chemical cue. The male was placed in the top chamber with or without a courtship object, as indicated (mVd, decapitated mature virgin or iVd, decapitated immature virgin). The bottom chamber contained filter paper with the indicated chemical. A memory index with either an immature or mature decapitated virgin tester was calculated. * or + means significantly different from training condition control (P < 0.05). N.S. means not significant. These data demonstrate that cVA acts in a dose-dependent manner to generalize learning with virgin trainers. cVA alone does not cause courtship in the absence of a courtship object. cVA is more effective in this role when it is presented with a mature virgin trainer, suggesting that its actions are dependent on the particular stimulatory pheromone context. cVOH, a closely related compound that is sensed by Or67d but not Or65a, is not capable of generalizing learning.
Supplemental Figure 1. Antennal lobe expression of Or65a-GAL4. Adult brains from UAS-mCD8-GFP;Or65a-GAL4 animals were fixed for 45 min in 8% formaldehyde in PBS, rinsed with PBT, and incubated in 1:200 rabbit anti-GFP TP401 (Torrey Pines Biolabs) and 1:200 mouse anti-Hiw 6H4 antibody (Developmental Studies Hybridoma Bank) at 4°C over night. After washing 3 times with PBT, brains were incubated with 1:200 goat anti-rabbit FITC (Jackson ImmunoResearch Laboratories) and 1:200 donkey anti-mouse Cy5 (Jackson ImmunoResearch Laboratories). After incubation with secondary detection reagents, brains were washed for 20 min in PBT and mounted in Vectashield for analysis. Confocal fluorescence microscopy was performed on a Leica TCS SP2 mounted on a Leica DMIRE2 inverted microscope. Anti-Hiw 6H4, which stains an unknown panneuropil antigen [45], is shown in magenta and GFP in green. Where the two overlap is represented in white. Identification of the Or65a-GAL4 glomeruli was done by crossing Or65a-GAL4;UAS-RFP animals to lines carrying Or-GFP promoter fusion transgenes [19].
Supplemental Figure 2. Comparison of Or65a-GAL4 and V-Or65a-GAL4. Brains from animals expressing UAS-mCD8-GFP under control of the indicated driver were dissected and imaged on a Leica TCS SP2 mounted on a Leica DMIRE2 inverted microscope without fixation. Images shown were taken at different laser intensities, contrasts and gains in order to optimize visualization. Background in the V-Or65a-GAL4 image may be due to these factors as opposed to ectopic GFP expression. As an indirect comparison of the strength of the two lines, we found that the contrast ratio of DL3 in Or65a-GAL4 (the ratio of mean DL3 intensity to total signal) was 5.9, while for V-Or65a-GAL4 it was 2.9.
Supplemental Material:
Generation of Or65a- and Or67d-promoter GAL4 fusion lines. The Or65a-GAL4 line was generated by inserting a 4665 bp fragment upstream of the predicted translational start of Or65a into the pG4PN vector [21]. The promoter fragment, with added Kpn1 and Not1 ends, was obtained from genomic DNA extracted from a male Canton S wild type fly using the Expand High Fidelity PCR system (Roche) with primers 5′ATAGGTACCGGCACCATCACTTCGAAC3′ and 5′CGTAACCTAGCCTAACTTTCGCCGGCGATA3′. 19 independent lines were generated. Multiple lines crossed to UAS-GFP showed a similar expression pattern; neurons expressing GFP were found to innervate trichoid sensilla in a broad region of the distal-lateral side of the antenna (the T3 region by the Shanbhag et al. designation [35]). In the adult brain, expression was limited to the DL3, DC1, VA1 and DA4m glomeruli in the antennal lobe, with DL3 showing the strongest expression (see Supplemental Figure 1). Or67d120.1-GAL4 and Or67d127.1-GAL4 were generated similarly, using 6139 bp of DNA immediately upstream of the predicted Or67d translational start site to drive expression of GAL4. The Or67d promoter fragment was amplified from Canton S genomic DNA using the PCR primers 5′TACCTAGGCTTTATTGCTCTTAAATATTTGAACAATCCA3′ and 5′TAGCGGCCGCTTGTTTGTTAGCTATGCAACTTAAAGGAG3′. These oligonucleotides carry AvrII and NotI restriction sites, respectively, which were used subsequently to clone the resulting promoter fragment into pG4PN+. pG4PN+ is identical to pG4PN, except that it has a slightly modified cloning site upstream of GAL4 to allow cloning of AvrII/NotI fragments. The lines Or67d120.1-GAL4 and Or67d127.1-GAL4 carry independent insertions of the Or67d promoter GAL4 construct, and both lines show similar patterns of expression in trichoid sensilla in the central region of the antenna when crossed to UAS-GFP reporter lines. This pattern is consistent with expression in singly-innervated T1 sensilla [36], as reported by Couto, et al. [19], but also includes a small number of basiconic sensilla. In the adult brain, this line expressed in at least 5 glomeruli, most prominently in DA1 and VA6. None of the glomeruli appeared to overlap those found in the Or65a-GAL4 pattern (data not shown).
Hydrocarbon analysis. Hexane extracts, prepared as described, were reconstituted in 60 μl of hexane containing 10 ng/μl hexacosane (nC26) as an injection standard. A 1 μl sample of the extract was then injected on a Varian CP3800 gas chromatograph with a flame ionization detector and PTV injector (cool-on-column mode), fitted with 0.25 mm x 15 m Varian CP8510 fused silica capillary column with a 0.25 μm film thickness and a 2.5m deactivated silica retention gap (Varian Inc, Mississauga, Canada). Carrier gas was Helium at a flow rate of 1 ml/min.
Analysis of the extract was carried out using a column temperature profile which began at 50°C (held for 1 min), ramped at 15°C/min to 150°C and then 3°C/min to 280°C where it was held for 5 min. The injector oven was programmed at 50°C for 0.1 min and then ramped to 280°C at 200°C/min. Varian Star Integrator software was used to calculate the retention time and total area of each peak for subsequent analysis.
Compound identification was conducted on a Shimadzu GC-17A gas chromatograph fitted with a HP-5MS fused silica capillary column (0.25 mm x 30 m, 0.25 μm film thickness) linked to a mass analyzer (Shimadzu QP5050A mass spectrometer). The injector was used in splitless mode with a splitless time of 0.5 min and the carrier gas was helium at 1 ml/min. Injector temperature was held constant at 280°C. An oven program which began at 60°C (1 min) and was ramped at 6°C/min to 225°C and then 3°C/min to 310°C (10 min) and pressure program of 57 kPa (1 min) to 185 kPa (1.83 min) at 2 kPa/min was employed. Electron impact positive ions at 70 eV were recorded in the scanning mode (mass range scanned 45-550 amu). The mass spectra were interpreted by fragmentation analysis and comparison to published criteria [38, 44]. Retention indices, based on a series of n-alkane standards (C10 – C32; extrapolation to C36), were used to match GC-FID and GC-MS data and to obtain approximate comparisons to published data.
Acknowledgments
This work was supported by NIH grant P01 NS44232 to L.C.G., DC04729 and DC02174 to J.C., University of Toronto Connaught Funds and CIHR to J.D.L. and a Fyssen Foundation Fellowship to C.L. We thank Reza Azanchi and Amanda Formosa for help with samples and analysis of GC data. We thank the Vosshall and Dickson labs for generously sharing fly lines.
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1. Ejima A, Smith BP, Lucas C, Levine JD, Griffith LC. Sequential learning of pheromonal cues modulates memory consolidation in trainer-specific associative courtship conditioning. Curr Biol. 2005;15:194–206. [PMC free article] [PubMed]
2. Siegel RW, Hall JC. Conditioned responses in courtship behavior of normal and mutant Drosophila. Proc Natl Acad Sci USA. 1979;76:565–578. [PubMed]
3. Tompkins L, Siegel RW, Gailey DA, Hall JC. Conditioned courtship in Drosophila and its mediation by association of chemical cues. Behav Genet. 1983;13:565–578. [PubMed]
4. Wicker C, Jallon JM. Hormonal control of sex pheromone biosynthesis in Drosophila melanogaster. J Insect Physiol. 1995;41:65–70.
5. Savarit F, Ferveur JF. Temperature affects the ontogeny of sexually dimorphic cuticular hydrocarbons in Drosophila melanogaster. J Exp Biol. 2002;205:3241–3249. [PubMed]
6. Connolly K, Cook R. Rejection responses by female Drosophila melanogaster: Their ontogeny, causality and effects upon the behavior of the courting male. Behavior. 1973;44:142–167.
7. Speith HT, Ringo JM. Mating behavior and sexual isolation in Drosophila. In: Ashburner M, Carson H, Thompson J, editors. The Genetics and Biology of Drosophila. 3c. New York, NY: Academic Press; 1983. pp. 223–284.
8. Butterworth FM. Lipids of Drosophila: a newly detected lipid in the male. Science. 1969;163:1356–1357. [PubMed]
9. Brieger G, Butterworth FM. Drosophila melanogaster: identity of male lipid in reproductive system. Science. 1970;167:1262. [PubMed]
10. Sureau G, Ferveur JF. Co-adaptation of pheromone production and behavioural responses in Drosophila melanogaster males. Genet Res. 1999;74:129–137. [PubMed]
11. Tram U, Wolfner MF. Seminal fluid regulation of female sexual attractiveness in Drosophila melanogaster. Proc Natl Acad Sci U S A. 1998;95:4051–4054. [PubMed]
12. Siwicki KK, Riccio P, Ladewski L, Marcillac F, Dartevelle L, Cross SA, Ferveur JF. The role of cuticular pheromones in courtship conditioning of Drosophila males. Learn Mem. 2005;12:636–645. [PubMed]
13. Ferveur JF, Sureau G. Simultaneous influence on male courtship of stimulatory and inhibitory pheromones produced by live sex-mosaic Drosophila melanogaster. Proc R Soc Lond B Biol Sci. 1996;263:967–973.
14. Lung O, Wolfner MF. Drosophila seminal fluid proteins enter the circulatory system of the mated female fly by crossing the posterior vaginal wall. Insect Biochem Mol Biol. 1999;29:1043–1052. [PubMed]
15. Mane SD, Tepper CS, Richmond RC. Studies of esterase 6 in Drosophila melanogaster. XIII. Purification and characterization of the two major isozymes. Biochem Genet. 1983;21:1019–1040. [PubMed]
16. Clyne P, Grant A, O'Connell R, Carlson JR. Odorant response of individual sensilla on the Drosophila antenna. Invert Neurosci. 1997;3:127–135. [PubMed]
17. Xu P, Atkinson R, Jones DN, Smith DP. Drosophila OBP LUSH is required for activity of pheromone-sensitive neurons. Neuron. 2005;45:193–200. [PubMed]
18. Ha TS, Smith DP. A pheromone receptor mediates 11-cis-vaccenyl acetate-induced responses in Drosophila. J Neurosci. 2006;26:8727–8733. [PubMed]
19. Couto A, Alenius M, Dickson BJ. Molecular, anatomical, and functional organization of the Drosophila olfactory system. Curr Biol. 2005;15:1535–1547. [PubMed]
20. Hallem EA, Ho MG, Carlson JR. The molecular basis of odor coding in the Drosophila antenna. Cell. 2004;117:965–979. [PubMed]
21. Dobritsa AA, van der Goes van Naters W, Warr CG, Steinbrecht RA, Carlson JR. Integrating the molecular and cellular basis of odor coding in the Drosophila antenna. Neuron. 2003;37:827–841. [PubMed]
22. Bubis JA, Degreen HP, Unsell JL, Tompkins L. Temporal manipulation of ejaculate components by newly fertilized Drosophila melanogaster females. Anim Behav. 1998;55:1637–1645. [PubMed]
23. Tompkins L, Hall JC. The different effects on courtship of volatile compounds from mated and virgin Drosophila females. J Insect Physiol. 1981;27:17–21.
24. Joiner MA, Griffith LC. Mapping of the anatomical circuit of CaM kinase-dependent courtship conditioning in Drosophila. Learn Mem. 1999;6:177–192. [PubMed]
25. Fishilevich E, Vosshall LB. Genetic and functional subdivision of the Drosophila antennal lobe. Curr Biol. 2005;15:1548–1553. [PubMed]
26. Bartelt RJ, Schaner AM, Jackson LL. cis-vaccenyl acetate as an aggregation pheromone in Drosophila melanogaster. J Chem Ecol. 1985;11:1747–1756.
27. Jallon JM, Antony C, Benamar O. Un anti-aphrodisiaque produit par lex males de Drosophila melanogaster et transfere aux femelles lors de la copulation. CR Acad Sc Paris. 1981;292:1147–1149.
28. Zawistowski S, Richmond RC. Inhibition of courtship and mating of Drosophila melanogaster by the male-produced lipid, cis-vaccenyl acetate. J Insect Physiol. 1986;32:189–192.
29. Vander Meer RK, Obin MS, Zawistowski S, Sheehan KB, Richmond RC. A reevaluation of the role of cis-vaccenyl acetate, cis-vaccenol and esterase 6 in the regulation of mated female secual attractiveness in Drosophila melanogaster. J Insect Physiol. 1986;32:681–686.
30. Scott D, Richmond RC. Evidence against an antiaphrodisiac role for cis-vaccenyl acetate in Drosophila melanogaster. J Insect Physiol. 1987;33:363–369.
31. Elmore T, Ignell R, Carlson JR, Smith DP. Targeted mutation of a Drosophila odor receptor defines receptor requirement in a novel class of sensillum. J Neurosci. 2003;23:9906–9912. [PubMed]
32. Fiumera AC, Dumont BL, Clark AG. Sperm competitive ability in Drosophila melanogaster associated with variation in male reproductive proteins. Genetics. 2005;169:243–257. [PubMed]
33. Wigby S, Chapman T. Sex peptide causes mating costs in female Drosophila melanogaster. Curr Biol. 2005;15:316–321. [PubMed]
34. Wolfner MF. The gifts that keep on giving: physiological functions and evolutionary dynamics of male seminal proteins in Drosophila. Heredity. 2002;88:85–93. [PubMed]
35. Shanbhag SR, Muller B, Steinbrecht RA. Atlas of olfactory organs of Drosophila melanogaster 1. Types, external organization, innervation and distribution of olfactory sensilla. Int J Insect Morphol Embryol. 1999;28:377–397.
36. Shanbhag SR, Hekmat-Scafe D, Kim MS, Park SK, Carlson JR, Pikielny C, Smith DP, Steinbrecht RA. Expression mosaic of odorant-binding proteins in Drosophila olfactory organs. Microsc Res Tech. 2001;55:297–306. [PubMed]
37. Sweeney ST, Broadie K, Keane J, Niemann H, O'Kane CJ. Targeted expression of tetanus toxin light chain in Drosophila specifically eliminates synaptic transmission and causes behavioral defects. Neuron. 1995;14:341–351. [PubMed]
38. McCarthy ED, Han J, Calvin M. Hydrogen atom transfer in mass spectrometric fragmentation patterns of saturated aliphatic hydrocarbons. Anal Chem. 1968;40:1475–1480.
39. Nelson DR. Long-chain methyl-branched hydrocarbons: occurrence, biosynthesis and function. Advances Insect Physiol. 1978;13:1–33.
40. Nelson DR, Sukkestad DR, Zaylskie RG. Mass spectra of methyl-branched hydrocarbons from eggs of the tobacco hornworm. J Lipid Res. 1972;13:413–421. [PubMed]
41. Pomonis JG, Fatland CL, Nelson DR, Zaylskie RG. Insect hydrocarbons. Corroboration of structure by synthesis and mass spectrometry of mono-and dimethylyalkanes. J Chem Ecol. 1978;4
42. Antony C, Jallon JM. The chemical basis for sex recognition in Drosophila melanogaster. J Insect Physiol. 1982;28:873–880.
43. Pechine JM, Jallon JM. Precise characterization of cuticular compounds in young Drosophila by mass spectrometry. J chem Ecol. 1988;14:1071–1085.
44. Pechine JM, Perez F, Antony C, Jallon JM. A further characterization of Drosophila cuticular monoenes using a mass spectrometry method to localize double bonds in complex mixtures. Anal Biochem. 1985;145:177–182. [PubMed]
45. Wu C, Wairkar YP, Collins CA, DiAntonio A. Highwire function at the Drosophila neuromuscular junction: spatial, structural, and temporal requirements. J Neurosci. 2005;25:9557–9566. [PubMed]