PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Dev Biol. Author manuscript; available in PMC Jul 9, 2007.
Published in final edited form as:
PMCID: PMC1913287
NIHMSID: NIHMS20781
Transcription Reactivation Steps Stimulated by Oocyte Maturation in C. elegans
Amy K. Walker, Peter R. Boag, and T. Keith Blackwell*
Section on Developmental and Stem Cell Biology, Joslin Diabetes Center, Department of Pathology, Harvard Medical School, Harvard Stem Cell Institute, One Joslin Place, Boston, MA 02215, Phone: (617) 919-2769, Fax: (617) 730-0023
*corresponding author: keith.blackwell/at/joslin.harvard.edu
Developing oocytes produce materials that will support early embryonic development, then cease transcription before fertilization. Later, a distinct transcription program is established in the embryo. Little is understood about how these global gene regulation transitions are effected. We have investigated in C. elegans how oocyte transcription is influenced by maturation, a process that releases meiotic arrest and prepares for fertilization. By monitoring transcription-associated phosphorylation of the RNA Polymerase II (Pol II) C-terminal domain (CTD), we find that oocyte transcription shuts down independently of maturation. Surprisingly, maturation signals then induce CTD phosphorylation that is associated specifically with transcription initiation steps, and accumulates to high levels when expression of the CTD phosphatase FCP-1 is inhibited. This CTD phosphorylation is also uncovered when a ubiquitylation pathway is blocked, or when maturation is stimulated precociously. CTD phosphorylation is similarly detected during embryonic mitosis, when transcription is also largely silenced. We conclude that oocyte maturation signals induce abortive transcription events in which FCP-1 may recycle phosphorylated Pol II, and that analogous processes may occur during mitosis. Our findings suggest that maturation signals may initiate preparations for embryonic transcription, possibly as part of a broader program that begins the transition from maternal to zygotic gene expression.
Keywords: Oocyte, Germ Cell, Oocyte Maturation, Meiosis, C. elegans, Transcription, CTD, CTD Phosphatase, FCP-1, Ubiquitylation
Oocytes retain the developmental potential of totipotent stem cells, but are also specialized cells that undergo extensive preparations for fertilization and the early stages of embryogenesis. During most of their development oocytes are highly active transcriptionally, producing mRNAs for their own needs or to be stored for the embryo, but eventually they terminate mRNA production prior to fertilization (Fig. 1A)(Davidson, 1986). Embryonic development initially relies entirely upon these maternal gene products, until a different program of zygotic transcription is initiated at a species-specific stage (Baugh et al., 2003; Seydoux and Fire, 1994; Zeng and Schultz, 2005). It is not known how these events are regulated, or what processes are involved in preparing for a rapid and coordinated induction of zygotic transcription.
Fig. 1
Fig. 1
Pol II CTD phosphorylation in proximal oocytes
Phosphorylation of the RNA polymerase II (Pol II) large subunit C-terminal domain (CTD) provides an indirect indicator of mRNA transcription activity. During transcription, the CTD undergoes a cycle of phosphorylation and dephosphorylation, and acts as a scaffold that mechanistically couples transcription with downstream mRNA production steps (Fig. 1B)(Bentley, 2005; Buratowski, 2003; Meinhart et al., 2005; Orphanides and Reinberg, 2002). During the initiation phase of transcription the CTD repeat (YSPTSPS) is phosphorylated on Ser 5 by the TFIIH kinase CDK-7. Subsequently, during elongation and other post-initiation steps, the balance of CTD phosphorylation shifts to Ser 2. These phosphorylation events can be detected by staining with antibodies that recognize these respective forms of the CTD (Bregman et al., 1995; Leatherman et al., 2002; Martinho et al., 2004; Seydoux and Dunn, 1997; Walker et al., 2004). For example, in developing C. elegans oocytes phospho-CTD Ser 5 (PSer5) staining parallels transcription activity, as detected by UTP incorporation (Figs. 1A, C)(Kelly et al., 2002; Schisa et al., 2001). This staining is readily apparent through the diplotene stage of Meiosis I, then becomes undetectable as transcription shuts down.
In most species, oocytes arrest development late during the prophase of Meiosis I until an extrinsic signal stimulates maturation, a process that releases this arrest and prepares for fertilization (Greenstein, 2005; Masui and Clarke, 1979). This strategy allows organisms to maintain only a small pool of oocytes in a fertilization-competent state. In C. elegans oocyte maturation is triggered by a diffusable ligand from sperm, and occurs continuously as long as sperm are present (Fig. 1A)(McCarter et al., 1999; Miller et al., 2003). Maturation involves conserved changes in cellular architecture that include nuclear envelope breakdown and rearrangement of the cortical cytoskeleton (Greenstein, 2005). In C. elegans maturation signals also lead to marking of some maternal proteins for eventual degradation, suggesting that maturation may involve additional processes that prepare for embryogenesis (Stitzel et al., 2006).
In Xenopus oocytes fertilization stimulates a global dephosphorylation of the CTD that appears to require the conserved CTD phosphatase FCP1 (Palancade et al., 2001), raising the question of whether transcriptional silencing in C. elegans oocytes might similarly involve FCP1 or signals from sperm. FCP1 is generally important for mRNA transcription, at least in part because it recycles phosphorylated Pol II for reinitiation, but its functions are not fully understood (Cho et al., 1999; Kobor et al., 1999; Meinhart et al., 2005). In yeast Fcp1 localizes to active transcription complexes and appears to dephosphorylate Ser 2 during elongation (Cho et al., 2001; Meinhart et al., 2005). Yeast Fcp1 also robustly dephosphorylates Ser 5 in vitro (Kong et al., 2005), but its role in Ser 5 phosphorylation in vivo is still debated (Cho et al., 2001; Meinhart et al., 2005; Schroeder et al., 2000).
Here we have investigated the role of maturation and FCP-1 in the shutdown of transcription that occurs during C. elegans oogenesis. We show that oocyte transcription ceases independently of maturation signals, which specifically stimulate early steps in the transcription process. These steps are detectable as Ser 5 phosphorylation that accumulates in developing oocytes after RNA interference (RNAi) knockdown of FCP-1, and is dependent upon multiple transcription initiation factors. Transcription- and maturation- associated CTD phosphorylation is also apparent after RNAi knockdown of a ubiquitylation pathway, or when maturation is induced precociously. FCP-1 and this ubiquitylation pathway similarly prevent accumulation of Ser 5 phosphorylation in transcriptionally silent embryonic mitotic and germline cells. Our results identify a previously undescribed function for oocyte maturation, induction of incomplete transcription steps that may prepare for zygotic gene activation (ZGA). They also suggest parallels between how transcription is shut down in oocytes and during mitosis, and show that fcp-1 is required for Ser 5 dephosphorylation in these contexts.
Strains
The following strains were used: N2 (wild type); JH1288 (cdk-7(ax224)) (Wallenfang and Seydoux, 2002); CB4108 (fog-2(q71))(McCarter, et al., 1999); DG1650 (vab-1(dx31)/mIn1[dpy-10(e128) mIs14]; fog-2(q71); ceh-18(mg57))(Miller, et al., 2003); TX183 (oma-1(zu405te33)/nT1[unc-?(n754) let-?]IV; oma-2(te51)/nT1)(Detwiler, et al., 2001); SD939 (mpk-1(ga111)(Lackner and Kim, 1998)).
RNAi
Double stranded RNA was produced from expressed sequence tags (gift of Yuji Kohara) or PCR products generated from a C. elegans library (gift of Marc Vidal), except for wee-1.3, which was provided by Andy Golden. To perform wee-1.3 RNAi, L4 hermaphrodites were placed on dsRNA-producing bacteria as described (Walker et al., 2004), then gonads were dissected and examined 18 and 30 hours later. For all other immunofluorescence experiments RNAi was performed by dsRNA injection (1 μg/ml). Those RNAi gonads were dissected at 18–20 (uba-1, ubc-2, rpt-4) or 22–24 (fcp-1, rpb-2) hours after injection. At these times RNAi hermaphrodites reproducibly continued to produce embryos that uniformly failed to hatch, indicating that the RNAi penetrance was consistent. To perform RNAi in cdk-7(ax224) animals, injected worms were placed at 24°C (non-permissive) or 15°C (permissive) for 18 hours before antibody staining. In DG1650 (vab-1(dx31)/mIn1[dpy-10(e128) mIs14]; fog-2(q71); ceh-18(mg57)), GFP (+) unmated females were injected, then oocyte maturation rates were determined 18 hours later as described (McCarter et al., 1999). To determine whether regulation of Ser 5 phosphorylation was epistatic to oma-1 and oma-2, we injected uba-1 dsRNA into oma-1(zu405te33); oma-2(te51) homozygotes (non-Unc, sterile). In western blot experiments RNAi was performed by feeding.
In each combinatorial RNAi experiment, a control sample was analyzed in which total input dsRNA amounts were maintained as constant (1 mg/ml) by addition of an unrelated dsRNA. This control dsRNA (glp-1 or skn-1) did not obviously affect the late stages of oogenesis, but induced an embryonic phenotype that could be scored readily (Bowerman et al., 1992; Priess et al., 1987), making it possible to see that these dsRNAs served as valid controls that were processed by the RNAi machinery. For example, to compare effects of fcp-1 and fcp-1; ama-1 RNAi, injection samples contained either fcp-1 and control dsRNA at 0.5 mg/ml each, or fcp-1 and ama-1 dsRNA at 0.5 mg/ml each, respectively. No diminution of fcp-1 or uba-1 oocyte or embryonic RNAi phenotypes was observed in any of these individual control experiments. In striking contrast, in multiple experiments the essential transcription factor dsRNAs that we assayed consistently affected these phenotypes as described in the text.
Quantitative (q)RT-PCR
For each sample, total RNA was extracted (Tri-reagent, Sigma) from 12–14 dissected gonads, half of which was used to synthesize cDNA (SuperScript II, Invitrogen). PCR was performed using the SYBR Green PCR Master mix (Applied Biosystems) according to the manufacturer's instructions, and reactions were run on a DNA Engine Opticon® 2 system (MJ Research). fcp-1 forward (5’ ATGGACACAATTGGGAAAGC 3’) and reverse (5’ CCCATCATCATCCTCATCCT 3’) primers produced an amplicon of 108 bp. The normalization control actin (act-1): forward (5’ TACCCAATTGAGCACGGTAT 3’) and reverse (5’ TTAGCCTTTGGATTGAGTGG 3’) primers produced a 140 bp amplicon. Relative RNA levels were determined using the 2(-Delta Delta C(T)) method (Livak and Schmittgen, 2001).
Immunohistochemistry and Image Analysis
Antibodies used were αPol II (ARNA3, Research Diagnostics), αPhospho-Histone H3 (Ser10) (Upstate Biologicals), FK2 (Biomol), MAPK-YT (Sigma), αPSer2 (H5, Covance), αPSer5 (H14, Covance), and αUnP (8WG16, Covance), which recognizes the unphosphorylated CTD (Bregman et al., 1995). H5 and H14 specifically recognize the Ser 2- and Ser 5-phosphorylated forms of the Pol II CTD in vitro and in vivo (Bregman et al., 1995; Buratowski, 2003; Walker et al., 2004). Immunostaining was performed essentially as described (Walker et al., 2004). Images were captured on a Zeiss Axioplan, with an AxioCam color camera set to linear gain. Some gonad images were cut out of their background and pasted onto a black panel. Adjustments in brightness and contrast (to aid in visualization of images) were performed uniformly to all images in a panel. 4’'-6-Diamidino-2-phenylindole (DAPI) staining was converted to black and white in all images.
Immunoblots
Extracts from RNAi embryos were obtained as in Walker, 2005. Lysates were separated on 6% Tris-acetate SDS gels (Invitrogen), blotted according to manufacturers instructions and visualized with Enhanced Chemiluminesence (Amersham).
Oocyte transcription ceases independently of maturation
We have investigated how transcription is regulated during the late stages of oogenesis by examining CTD phosphorylation. In proximal oocytes PSer5 staining disappears in parallel to appearance of staining for phospho-Ser 10 of Histone 3 (H3P) (Hsu et al., 2000) (Fig. 1C). H3P staining appears on chromosomes as they condense during mitosis, and in meiotic prophase this epitope similarly marks entry into the diakinesis stage, during which chromosomes become more condensed. Evidence from C. elegans embryos and other systems indicates that CTD Ser 2 phosphorylation is essential for and indicative of occurrence of transcription steps downstream of initiation (Fig. 1B) (Meinhart et al., 2005; Seydoux and Dunn, 1997; Shim et al., 2002). Accordingly, in proximal oocytes phospho-CTD Ser 2 (PSer2) staining is detected in a similar pattern to PSer5 (Fig. 1D; data not shown), supporting the idea that transcription is silenced as C. elegans oocytes progress into diakinesis.
Because C. elegans oocytes are continuously exposed to maturation signals in the presence of sperm (McCarter et al., 1999), the above experiments leave open the question of whether maturation signals might be required for this transcription shutdown. We investigated this possibility by examining CTD phosphorylation in fog-2(q71) animals, which are either male or female. In unmated fog-2(q71) females, which lack the maturation signal from sperm, oocytes arrest meiotic progression in diakinesis. These diakinetic oocytes complete late stages of oocyte development (nucleolar disappearance, distal nuclear positioning), but undergo maturation-dependent processes (nuclear envelope breakdown, cortical rearrangements, ovulation) only at a very low frequency. In unmated fog-2(q71) females all proximal oocytes that have entered diakinesis lack PSer5 and PSer2 staining similarly to wild type (Fig. 2; data not shown), indicating that in C. elegans transcription ceases in diakinesis independently of the maturation signal from sperm.
Fig. 2
Fig. 2
Oocyte transcription shuts down independently of sperm-dependent maturation signals
Accumulation of transcription-associated CTD phosphorylation in diakinetic oocytes that lack FCP-1
To investigate whether the FCP-1 phosphatase is important for shutting down oocyte transcription, we knocked down its expression by RNAi. Hermaphrodites that were injected with fcp-1 dsRNA produced oocytes that entered diakinesis appropriately, as indicated by DAPI and H3P staining, and gave rise to near-normal numbers of embryos at the times analyzed (Fig. 1C; Materials and Methods). This indicates that most aspects of the late stages of oogenesis occurred normally in fcp-1(RNAi) animals. In striking contrast to wild type, however, in fcp-1(RNAi) animals Ser 5 phosphorylation was consistently present at high levels in all proximal oocyte nuclei (Fig. 1C). Importantly, in diakinetic fcp-1(RNAi) oocytes the levels of PSer5 staining also consistently increased distally-to-proximally, as these cells developed (Fig. 1C; Supplementary Table 1). This progressive increase in PSer5 staining indicates that the bulk of this CTD phosphorylation did not perdure from earlier stages, and suggests instead that the CTD repeat was continuously being phosphorylated on Ser 5 in these cells.
If the Ser 5 phosphorylation detected in fcp-1(RNAi) diakinetic oocytes occurred in the context of mRNA transcription events, it should depend upon factors that are required for transcription initiation. For example, this phosphorylation should require essential subunits of Pol II along with components of the transcription pre-initiation complex (PIC) (Fig. 1B)(Orphanides and Reinberg, 2002). The PIC is formed by recruitment of multiple separate protein complexes, and must be assembled at promoters before transcription can occur. This CTD phosphorylation should also be mediated by the CDK-7 kinase, which is recruited to promoters separately from Pol II and phosphorylates Ser 5 specifically in the context of the assembled PIC (Orphanides and Reinberg, 2002).
To test these possibilities, we used RNAi to inhibit expression of fcp-1 simultaneously with subunits of these essential transcription machinery components. In these experiments we maintained the total amounts of injected dsRNA as constant by addition of a control dsRNA where appropriate (glp-1 or skn-1; see Materials and Methods). Quantitative RT-PCR indicated that the fcp-1 mRNA was depleted from the gonad comparably by introduction of fcp-1 dsRNA either alone, or when mixed with a control or essential transcription factor dsRNA (Supplementary Fig. 1). The Ser 5 phosphorylation seen in fcp-1(RNAi) proximal oocytes was not diminished by co-injection of either control dsRNA that we tested (not shown). In contrast, this PSer5 staining was consistently abolished not only by knockdown of the Pol II large subunit AMA-1, which includes the CTD epitope, but also by simultaneous RNAi of either a different Pol II subunit (RPB-2) or the CDK-7 kinase (Fig. 3A). Significantly, this phosphorylation similarly required the Mediator subunit RGR-1 and the TFIID component TAF-4, each of which is recruited to the PIC separately from Pol II (Kornberg, 2005; Woychik and Hampsey, 2002), and is generally essential for transcription in C. elegans (Shim et al., 2002; Walker et al., 2001). This dependence upon CDK-7 and these various distinct PIC subunits argues strongly that the Ser5 phosphorylation accumulating in fcp-1(RNAi) diakinetic oocytes was generated in the context of bona fide transcription initiation complexes.
Fig. 3
Fig. 3
Ser 5 phosphorylation in diakinetic fcp-1(RNAi) oocytes requires transcription initiation factors and maturation signals
We next investigated whether fcp-1(RNAi) diakinetic oocytes also accumulated high levels of Ser 2-phosphorylated Pol II, a marker of transcription elongation (Fig. 1B). After fcp-1 RNAi Ser 2-phosphorylated Pol II was detectable in diakinetic oocytes, but was present at very low levels that did not increase in parallel to PSer5 staining (Figs. 1C, D). A similar discordance between PSer5 and PSer2 staining was previously seen in C. elegans embryos that lack the mRNA capping enzyme, which is thought to be required for Pol II to progress to Ser2 phosphorylation and transcription elongation (Takagi et al., 2003). This suggests that most of the Ser 5-phosphorylated Pol II produced in fcp-1(RNAi) diakinetic oocytes did not progress to the elongation phase. Interestingly, in diakinetic fcp-1(RNAi) oocytes PSer5 staining seemed to fill the entire nucleoplasm, in contrast to its association with chromosomes at earlier stages in these and wild type hermaphrodites (Fig. 1C). Analysis with confocal microscopy indicated that this PSer5 staining was not excluded from chromatin (data not shown), but was present throughout the nucleus. PSer2 staining was present in a similar distribution in diakinetic fcp-1(RNAi) oocytes (Fig. 1D). The diffuseness of these staining patterns suggests that they may reflect phosphorylated Pol II that was generated during abortive transcription steps, and is no longer associated with transcription complexes.
Sperm-dependent signals are required for CTD Ser 5 phosphorylation to accumulate in diakinetic fcp-1(RNAi) oocytes
The striking finding that Ser 5-phosphorylated Pol II continued to accumulate as diakinetic fcp-1(RNAi) oocytes developed raised the question of whether this phosphorylation might be stimulated by maturation signals. While the morphologic changes that are characteristic of maturation are seen in the -1 oocyte (Fig. 1A)(McCarter et al., 1999), induction of a mitogen-activated protein kinase (MAPK) signal that is associated with maturation is detected earlier during diakinesis (Miller et al., 2003), indicating that these more distal oocytes sense and respond to sperm-dependent maturation signals.
We investigated the effects of sperm-dependent signals by comparing PSer5 staining in mated and unmated fog-2(q71); fcp-1(RNAi) females. In fog-2(q71); fcp-1(RNAi) females that had been mated, PSer5 staining was present at high levels and consistently accumulated distally-to-proximally in diakinetic oocytes (Fig. 3B), as was seen when fcp-1 RNAi was performed in the wild type (Figs. 1C, ,3A).3A). In striking contrast, in unmated fog-2(q71); fcp-1(RNAi) females diakinetic oocytes showed low levels of Ser 5-phosphorylated Pol II (Fig. 3B) that, importantly, did not increase in intensity distally-to-proximally. Similarly low levels of PSer2 staining were seen in diakinetic oocytes in unmated fog-2(q71); fcp-1(RNAi) females and fcp-1(RNAi) hermaphrodites (Fig. 3C), suggesting that this Ser 2 phosphorylation is not globally influenced by the presence of sperm. It is possible that the PSer5 staining seen in unmated fog-2(q71); fcp-1(RNAi) diakinetic oocytes (Fig. 3B) might have perdured from the transcriptionally active diplotene stage. Significantly, however, our findings show that sperm-dependent signals are required for the bulk of PSer5 staining that is present in diakinetic fcp-1(RNAi) oocytes, as well as for the characteristic distal-to-proximal increase in that staining (Fig. 3B). We conclude that the Ser 5-phosphorylated Pol II that accumulates in diakinetic oocytes when the FCP-1 phosphatase is lacking is generated de novo in response to maturation signals.
Accumulation of transcription-associated CTD phosphorylation in diakinetic oocytes is inhibited by a ubiquitylation pathway
In a small-scale RNAi screen of other protein modification factors (data not shown), we observed that robust PSer5 staining also appeared in diakinetic oocytes after interference with a ubiquitylation pathway. Ubiquitylation requires an activating enzyme (E1), conjugating factor (E2), and target-specific ligase (E3) (Harper et al., 2002). Hermaphrodites in which the single C. elegans E1 (UBA-1) had been knocked down by RNAi laid eggs that failed to hatch, but consistently produced oocytes that appeared normal, entered diakinesis, and were fertilized appropriately (Fig. 1C; Materials and Methods). Strikingly high levels of nucleoplasmic PSer5 staining were uniformly present in these diakinetic uba-1(RNAi) oocytes, although this staining did not increase progressively in the striking fashion seen in fcp-1(RNAi) oocytes (Figs. 1C, ,4A).4A). Ser 5 phosphorylation similarly appeared in diakinetic oocytes after RNAi knockdown of the E2 UBC-2 (Ubc4/5)(Fig. 4B), suggesting that this effect derives from interference with a specific ubiquitylation pathway.
Fig. 4
Fig. 4
Regulation of transcription-associated PSer5 accumulation by a ubiquitylation pathway
UBA-1 and UBC-2 regulate meiotic divisions by functioning upstream of anaphase-promoting complex (APC) components (Frazier et al., 2004; Harper et al., 2002), but RNAi knockdown of APCCdc20 or APCCdh1 E3 subunits did not affect Ser 5 phosphorylation in oocytes (Supplementary Fig. 2). Ubiquitylation can target proteins to the proteasome for either degradation or chaperone activities (Ferdous et al., 2001), and Ser 5 phosphorylation appeared in proximal oocytes after RNAi knockdown of the proteasome component RPT-4 (Sug2) (Weeda et al., 1997)(Fig. 4B). Pol II staining did not detectably decrease in wild type proximal oocytes and was not increased by uba-1 or rpt-4 RNAi, however (Fig. 4D). The PSer5 staining seen in diakinetic oocytes after interference with this ubiquitin/proteasome pathway thus did not appear to derive from pleiotropic effects on either the cell cycle, or Pol II levels.
Significantly, as observed in fcp-1(RNAi) hermaphrodites, the PSer5 staining seen in uba-1(RNAi) diakinetic oocytes depended upon ama-1, rpb-2, cdk-7, rgr-1 and taf-4 (Figs. 4B, C), arguing that it was generated in the context of a transcription initiation complex. Ser 2 phosphorylation remained undetectable in proximal oocytes after uba-1, ubc-2, or rpt-4 RNAi however (Fig. 1D; data not shown), indicating that these transcription events were not completed, and that these proximal oocytes have shut down transcription at the appropriate stage. Consistent with this model, an early embryonic reporter transgene was not expressed earlier than normal in uba-1(RNAi) embryos (Supplementary Fig. 3).
As seen in fcp-1(RNAi) oocytes, after uba-1 RNAi robust PSer5 staining was present during diakinesis in mated but not unmated fog-2(q71) females, suggesting that this PSer5 staining depended upon oocyte maturation signals (Fig. 5A). This PSer5 staining similarly did not appear after uba-1 RNAi was performed in oma-1(zu405te33); oma-2(te51) hermaphrodites (Fig. 5B), in which diakinetic oocytes initiate but fail to complete maturation (Detwiler et al., 2001). PSer5 staining was also not detected in diakinetic oocytes in uba-1(RNAi); mpk-1(ga111) hermaphrodites (Supplementary Fig. 4)(Lackner and Kim, 1998), which fail to undergo maturation because the essential MAPK signal is blocked (M.-H. Lee, M. Ohmachi, E. Lambie, R. Francis, T. Schedl, personal communication). Oocyte maturation signals are therefore required for this PSer5 staining to appear in diakinetic oocytes after interference with ubc-2-dependent ubiquitylation.
Fig. 5
Fig. 5
Induction of CTD Ser 5 phosphorylation by oocyte maturation signals
Induction of CTD Ser 5 phosphorylation by precocious oocyte maturation
We next examined whether constitutive or precocious stimulation of oocyte maturation is sufficient to allow PSer5 to accumulate in diakinetic oocytes. Parallel mechanisms involving VAB-1 and CEH-18 are needed to prevent maturation from occurring constitutively in the absence of the sperm signal, so that maturation proceeds continuously in unmated vab-1(dx31); ceh-18(mg57); fog-2(q71) females (Miller et al., 2003). Remarkably, robust nucleoplasmic PSer5 staining was present in diakinetic vab-1(dx31); ceh-18(mg57); fog-2(q71) oocytes (Fig. 5C). Even higher PSer5 staining levels were apparent during diakinesis after RNAi knockdown of wee-1.3 (Fig. 5C), which prevents maturation from occurring precociously by inhibiting the CDK-1 (CDC2) kinase (Burrows et al., 2006). In contrast, in each case Ser 2 phosphorylation was not detectable during diakinesis (data not shown), indicating that subsequent transcription steps were largely inhibited.
Events associated with oocyte development and maturation (H3P staining appearance, nucleolus disappearance, nuclear envelope breakdown) were not detectably altered after RNAi knockdown of fcp-1, uba-1, uba-2, or rpt-4 (data not shown), suggesting that the PSer5 staining seen in diakinetic oocytes under these circumstances did not result from precocious maturation. We examined this question further in uba-1(RNAi) animals, because ubiquitylation influences many cellular processes. uba-1(RNAi) oocytes showed normal levels of maturation-associated MAPK activity, and maturation rates that were reduced, not increased (Figs. 5D, E). This indicates that maturation was not de-regulated by inhibition of fcp-1 or ubc-2-dependent ubiquitylation, suggesting that these mechanisms normally prevent PSer5 from accumulating in maturing oocytes by regulating processes associated with transcription.
Appearance of phosphorylated CTD Ser 5 in transcriptionally silent embryonic cells
To determine whether similar mechanisms affect CTD phosphorylation in the embryo before ZGA occurs at the four-cell stage (Seydoux and Dunn, 1997), we examined embryos produced by fcp-1(RNAi) hermaphrodites. In wild type one- and two- cell embryos, which are transcriptionally silent, Ser 5 phosphorylation is normally restricted to two faint nuclear foci (Seydoux and Dunn, 1997). In contrast, at these stages fcp-1(RNAi) embryos uniformly exhibited high levels of nucleoplasmic PSer5 staining (Fig. 6A; data not shown). About 30% of early fcp-1(RNAi) embryos showed abnormalities in polar body position or delayed cell division timing (data not shown) but in all fcp-1(RNAi) embryos the levels and localization of the germline-specific protein PIE-1 appeared normal (Figs. 6A, B; data not shown), suggesting that early asymmetries were intact (Tenenhaus et al., 1998). Interestingly, at the four cell stage fcp-1(RNAi) embryos showed inappropriate nucleoplasmic PSer5 staining in the transcriptionally silent germ cell precursor, even though this cell appeared to contain normal levels of PIE-1 (Fig. 6B), a repressor that maintains transcriptional silence in the early embryonic germline (Batchelder et al., 1999; Seydoux et al., 1996). In contrast to this robust PSer5 staining, in fcp-1(RNAi) embryos PSer2 staining was undetectable prior to ZGA and dramatically reduced at later stages (Fig. 6C; Supplementary Fig. 5), suggesting that without FCP-1 most transcription was stalled after the initiation step. Accordingly, fcp-1(RNAi) embryos arrested development at about the 100 cell stage, similarly to ama-1(RNAi) embryos (Powell-Coffman et al., 1996), suggesting a broad defect in zygotic gene transcription (data not shown).
Fig. 6
Fig. 6
fcp-1 and a ubiquitylation pathway prevent PSer5 accumulation in transcriptionally silent embryonic cells
uba-1(RNAi) and ubc-2(RNAi) animals produced embryos that usually arrested development during the earliest cell divisions, and uniformly exhibited high levels of PSer5 staining before the four cell stage (Fig. 6A; data not shown). Western blotting similarly demonstrated that early uba-1(RNAi) embryos were highly enriched for PSer5 when compared to apc-11(RNAi) embryos (Fig. 6D), which also arrest cell division primarily before ZGA (Frazier et al., 2004). The PSer5 staining seen in transcriptionally silent cells in fcp-1(RNAi) and uba-1(RNAi) embryos depended upon cdk-7, rgr-1, and taf-4 (data not shown), as was observed in the corresponding diakinetic oocytes (Figs. 3A, 4B, C), indicating that this CTD phosphorylation occurred in the context of a transcription initiation complex. Thus, as seen in maturing oocytes, both fcp-1 and a ubc-2-dependent ubiquitylation pathway are required to prevent Ser 5-phosphorylated Pol II from being present in pre-ZGA embryonic nuclei.
Transcription is broadly blocked during somatic cell mitosis, through an incompletely understood process that involves inhibition of initiation and subsequent steps (Akoulitchev and Reinberg, 1998; Jiang et al., 2004). Ser5 staining was markedly reduced in wild type embryonic nuclei that have entered mitosis, but was uniformly present at high-levels in H3P-positive mitotic nuclei in fcp-1, uba-1, ubc-2, and rpt-4(RNAi) embryos, as seen in diakinetic oocytes (Fig. 6E; data not shown). This suggests that some mechanisms involved in regulating transcription silencing during oogenesis and meiosis may parallel processes that act during mitosis.
Oocyte maturation is a complex process that prepares the oocyte to undergo dramatic changes rapidly upon fertilization (Greenstein, 2005; Masui and Clarke, 1979). Many hallmarks of maturation have been described for years, including nuclear envelope breakdown and cytoskeletal rearrangements, but the molecular and regulatory events associated with maturation are not well understood. Here we report that C. elegans oocytes shut down transcription independently of signals that stimulate maturation, as indicated by Ser 5 and Ser 2 phosphorylation being undetectable in diakinetic fog-2 oocytes in the absence of sperm (Fig. 2; data not shown). Surprisingly, our findings also indicate that maturation signals induce the occurrence of early transcription steps in these transcriptionally “silent” cells (Fig. 7).
Fig. 7
Fig. 7
Induction of transcription steps by oocyte maturation
Firstly, we found that diakinetic oocytes accumulate Ser 5-phosphorylated Pol II in response to maturation signals after RNAi knockdown of the CTD phosphatase FCP-1 (Fig. 3B). Importantly, the levels of this PSer5 staining characteristically increase as fcp-1(RNAi) oocytes develop and move distally-to-proximally (Fig. 1C, Supplementary Table 1), indicating that the bulk of this Ser 5 phosphorylation does not perdure from earlier stages, and is generated de novo in these diakinetic oocytes. This PSer5 staining depends upon multiple independent transcription initiation factors that associate with Pol II specifically at promoters (Fig. 3A), suggesting that this CTD phosphorylation is generated in the context of transcription initiation steps. The intensity of this PSer5 staining is comparable to or higher than that seen in transcriptionally active diplotene oocytes (Fig. 1C), indicating that a substantial level of this CTD phosphorylation occurs. Because this phosphorylation accumulates to high levels in maturing oocytes when the CTD phosphatase FCP-1 is lacking, we believe that this phosphorylation normally occurs during maturation but is rapidly turned over through dephosphorylation. In general, the transcription steps in which this PSer5 staining is generated do not appear to progress to the elongation phase, however, based upon the far lower levels of Ser 2 phosphorylation detected in these diakinetic oocytes (Fig. 1D).
We also detected Ser 5 phosphorylation that was associated with transcription and maturation when we inhibited ubc-2-dependent ubiquitylation (Figs. 4A–C, 5A, B). It will be difficult to identify the molecular target of this ubiquitylation pathway, particularly because numerous transcription factors undergo ubiquitylation (Muratani and Tansey, 2003; Somesh et al., 2005), but these results independently corroborate the occurrence of maturation-dependent transcription steps during diakinesis, as detected in fcp-1(RNAi) oocytes. It is intriguing that inhibition of this ubiquitylation mechanism did not result in a dramatic progressive increase in PSer5 levels as seen in fcp-1(RNAi) oocytes (Fig. 1C). Perhaps the ubiquitin/proteasome pathway we have identified acts at an earlier initiation step, either to limit the rate of CTD Ser 5 phosphorylation or promote Pol II recycling.
Finally, we detected robust Ser 5 but not Ser 2 phosphorylation in diakinetic oocytes in vab-1(dx31); fog-2(q71); ceh-18(mg57) and wee-1(RNAi) animals (Fig. 5C), which undergo maturation prematurely. These last experiments are significant because they allowed us to detect this CTD phosphorylation without manipulating regulatory mechanisms that directly influence transcription. Presumably, the presence of these maturation signals at inappropriate intensity or duration during late oogenesis stages resulted in accumulation of transcription-dependent PSer5 even in the presence of the FCP-1 phosphatase.
An important implication of our findings is that FCP-1 may function as a major Ser 5 phosphatase in vivo, in addition to its previously described functions in Ser 2 dephosphorylation (Cho et al., 2001; Meinhart et al., 2005). When FCP-1 was lacking, transcription-associated PSer5 that was generated in response to maturation accumulated throughout the nucleus, suggesting that this modified Pol II had dissociated from the DNA. Interestingly, after fcp-1 RNAi we also observed nucleoplasmic PSer5 staining in embryonic germ cell precursors (Fig. 6B), in which PIE-1 has been proposed to repress transcription by acting at a post-initiation step (Batchelder et al., 1999; Zhang et al., 2003). We speculate that an important function of FCP-1 may be to recycle Ser 5-phosphorylated Pol II that is produced during stalled or abortive transcription events, although we do not know whether in this context these events proceed to the point of generating incomplete mRNA transcripts. Importantly, fcp-1 does not seem to be required for Ser 5 phosphorylation levels to drop dramatically upon diakinesis entry in oocytes that do not proceed to maturation (fog-2(q71); fcp-1(RNAi) oocytes; Fig. 3A). This suggests that in C. elegans, oocyte transcription shutdown may not require fcp-1 and therefore does not seem to involve a wave of FCP-1-mediated CTD dephosphorylation, as may occur in Xenopus (Palancade et al., 2001)
The evidence that maturation signals induce high levels of transcription-associated CTD phosphorylation suggests that in these transcriptionally silent oocytes, many genes are accessible to and are bound by the transcription apparatus. We propose that beginning at diakinesis C. elegans oocytes initiate and maintain transcriptional silence largely through regulation of the transcription machinery, as opposed to rendering genes globally inaccessible through chromatin changes. Accordingly, prior to ZGA embryos display histone modification markers that are associated with active chromatin (Bean et al., 2004; Schaner et al., 2003).
As in maturing oocytes, we also observed transcription-dependent PSer5 staining in pre-ZGA and mitotic embryonic cells after RNAi knockdown of fcp-1, uba-1, or ubc-2 (Figs. 6A, B, E). While we cannot rule out that this phosphorylated Pol II simply perdured from oogenesis, it seems more likely that it was produced de novo in these cells because their PSer5 levels were comparable to those seen in transcriptionally active embryonic nuclei, as indicated by immunofluorescence and western blotting assays (Figs. 6A, D, E; data not shown). We speculate that parallels may exist between how transcription is globally blocked during mitosis and meiosis, related cellular processes that each involve chromosome condensation, nuclear division, and a subsequent rapid reactivation of transcription.
Why would oocyte maturation induce abortive transcription steps? During the transition from oocyte to zygote, the transcription machinery must shift between dramatically different gene expression programs (Baugh et al., 2003; Seydoux and Fire, 1994; Zeng and Schultz, 2005). By initiating early transcription steps at some promoters, oocyte maturation could facilitate their subsequent activation in the embryo. Recent studies suggest precedents for such a model. In mitotic mammalian cells, the hsp70i gene is “bookmarked” in a transcriptionally competent state, so that it can later be induced more rapidly by stress during G1 (Xing et al., 2005). Similarly, during stationary phase in S. cerevisiae Pol II is bound upstream of >2500 genes that are silent, but will be induced within minutes after refeeding (Radonjic et al., 2005). We speculate that oocyte maturation may similarly poise the Pol II machinery for rapid induction of transcription at some promoters, and that in some animals preparations for ZGA may begin before fertilization. Recent work has shown that maturation signals lead to “marking” of some maternally provided proteins for degradation in the early embryo (Stitzel et al., 2006). In light of those findings and our results, we believe that maturation signals not only lead to preparations for fertilization, but also may initiate processes that facilitate the transition from maternal to embryonic gene expression.
Supplementary Material
Supplementary Material
Supplementary Tables
Supplementary Figure 1
Supplementary Figure 2
Supplementary Figure 3
Supplementary Figure 4
Supplementary Figure 5
Acknowledgments
We thank Andy Golden for sharing results prior to publication and Tim Schedl for generous advice on analyzing oocyte maturation events. We also thank them, in addition to Geraldine Seydoux, Grace Gill, Mike Boxem, Yang Shi, Jeff Parvin and Monica Colaiaicovo, for helpful discussions or critically reading this manuscript. Ömur Yilmaz contributed to maturation experiments and strains were obtained from the CGC. Supported by a Myra Reinhard Family Foundation Fellowship (P. R. B.) and an NIH grant to T. K. B. (GM63826).
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
  • Akoulitchev S, Reinberg D. The molecular mechanism of mitotic inhibition of TFIIH is mediated by phosphorylation of CDK7. Genes Dev. 1998;12:3541–50. [PubMed]
  • Batchelder C, Dunn MA, Choy B, Suh Y, Cassie C, Shim EY, Shin TH, Mello C, Seydoux G, Blackwell TK. Transcriptional repression by the C. elegans germline protein PIE-1. Genes Dev. 1999;13:202–212. [PubMed]
  • Baugh LR, Hill AA, Slonim DK, Brown EL, Hunter CP. Composition and dynamics of the Caenorhabditis elegans early embryonic transcriptome. Development. 2003;130:889–900. [PubMed]
  • Bean CJ, Schaner CE, Kelly WG. Meiotic pairing and imprinted X chromatin assembly in Caenorhabditis elegans. Nat Genet. 2004;36:100–5. [PubMed]
  • Bentley DL. Rules of engagement: co-transcriptional recruitment of pre-mRNA processing factors. Curr Opin Cell Biol. 2005;17:251–6. [PubMed]
  • Bowerman B, Eaton BA, Priess JR. skn-1, a maternally expressed gene required to specify the fate of ventral blastomeres in the early C. elegans embryo. Cell. 1992;68:1061–1075. [PubMed]
  • Bregman DBX, Du L, van der Zee S, Warren SL. Transcription-dependent redistribution of the large subunit of RNA polymerase II to discrete nuclear domains. J Cell Biol. 1995;129:287–298. [PMC free article] [PubMed]
  • Buratowski S. The CTD code. Nat Struct Biol. 2003;10:679–80. [PubMed]
  • Burrows AE, Sceurman BK, Kosinski ME, Richie CT, Sadler PL, Schumacher JM, Golden A. The C. elegans Myt1 ortholog is required for the proper timing of oocyte maturation. Development. 2006;133:697–709. [PMC free article] [PubMed]
  • Cho EJ, Kobor MS, Kim M, Greenblatt J, Buratowski S. Opposing effects of Ctk1 kinase and Fcp1 phosphatase at Ser 2 of the RNA polymerase II C-terminal domain. Genes Dev. 2001;15:3319–29. [PubMed]
  • Cho H, Kim TK, Mancebo H, Lane WS, Flores O, Reinberg D. A protein phosphatase functions to recycle RNA polymerase II. Genes Dev. 1999;13:1540–52. [PubMed]
  • Davidson EH. Gene activity in early development. Academic Press; Orlando, FL: 1986.
  • Detwiler MR, Reuben M, Li X, Rogers E, Lin R. Two zinc finger proteins, OMA-1 and OMA-2, are redundantly required for oocyte maturation in C. elegans. Dev Cell. 2001;1:187–99. [PubMed]
  • Ferdous A, Gonzalez F, Sun L, Kodadek T, Johnston SA. The 19S regulatory particle of the proteasome is required for efficient transcription elongation by RNA polymerase II. Mol Cell. 2001;7:981–91. [PubMed]
  • Frazier T, Shakes D, Hota U, Boyd L. Caenorhabditis elegans UBC-2 functions with the anaphase-promoting complex but also has other activities. J Cell Sci. 2004;117:5427–35. [PubMed]
  • Greenstein D. Control of oocyte meiotic maturation and fertilization. In: Community TCeR., editor. Worm Book. 2005. pp. 1–23. [PubMed]
  • Harper JW, Burton JL, Solomon MJ. The anaphase-promoting complex: it's not just for mitosis any more. Genes Dev. 2002;16:2179–206. [PubMed]
  • Hsu JY, Sun ZW, Li X, Reuben M, Tatchell K, Bishop DK, Grushcow JM, Brame CJ, Caldwell JA, Hunt DF, Lin R, Smith MM, Allis CD. Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. Cell. 2000;102:279–91. [PubMed]
  • Jiang Y, Liu M, Spencer CA, Price DH. Involvement of transcription termination factor 2 in mitotic repression of transcription elongation. Mol Cell. 2004;14:375–85. [PubMed]
  • Kelly WG, Schaner CE, Dernburg AF, Lee MH, Kim SK, Villeneuve AM, Reinke V. X-chromosome silencing in the germline of C. elegans. Development. 2002;129:479–92. [PubMed]
  • Kobor MS, Archambault J, Lester W, Holstege FC, Gileadi O, Jansma DB, Jennings EG, Kouyoumdjian F, Davidson AR, Young RA, Greenblatt J. An unusual eukaryotic protein phosphatase required for transcription by RNA polymerase II and CTD dephosphorylation in S. cerevisiae. Mol Cell. 1999;4:55–62. [PubMed]
  • Kong SE, Kobor MS, Krogan NJ, Somesh BP, Sogaard TM, Greenblatt JF, Svejstrup JQ. Interaction of Fcp1 phosphatase with elongating RNA polymerase II holoenzyme, enzymatic mechanism of action, and genetic interaction with elongator. J Biol Chem. 2005;280:4299–306. [PubMed]
  • Kornberg RD. Mediator and the mechanism of transcriptional activation. Trends Biochem Sci. 2005;30:235–9. [PubMed]
  • Lackner MR, Kim SK. Genetic analysis of the Caenorhabditis elegans MAP kinase gene mpk-1. Genetics. 1998;150:103–17. [PubMed]
  • Leatherman JL, Levin L, Boero J, Jongens TA. germ cell-less acts to repress transcription during the establishment of the Drosophila germ cell lineage. Curr Biol. 2002;12:1681–5. [PubMed]
  • Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–8. [PubMed]
  • Martinho RG, Kunwar PS, Casanova J, Lehmann R. A non-coding RNA is required for the repression of RNApolII-dependent transcription in primordial germ cells. Curr Biol. 2004;14:159–165. [PubMed]
  • Masui Y, Clarke HJ. Oocyte maturation. Int Rev Cytol. 1979;57:185–282. [PubMed]
  • McCarter J, Bartlett B, Dang T, Schedl T. On the control of oocyte meiotic maturation and ovulation in Caenorhabditis elegans. Dev Biol. 1999;205:111–28. [PubMed]
  • Meinhart A, Kamenski T, Hoeppner S, Baumli S, Cramer P. A structural perspective of CTD function. Genes Dev. 2005;19:1401–15. [PubMed]
  • Miller MA, Ruest PJ, Kosinski M, Hanks SK, Greenstein D. An Eph receptor sperm-sensing control mechanism for oocyte meiotic maturation in Caenorhabditis elegans. Genes Dev. 2003;17:187–200. [PubMed]
  • Muratani M, Tansey WP. How the ubiquitin-proteasome system controls transcription. Nat Rev Mol Cell Biol. 2003;4:192–201. [PubMed]
  • Orphanides G, Reinberg D. A unified theory of gene expression. Cell. 2002;108:439–51. [PubMed]
  • Palancade B, Dubois MF, Dahmus ME, Bensaude O. Transcription-independent RNA polymerase II dephosphorylation by the FCP1 carboxy-terminal domain phosphatase in Xenopus laevis early embryos. Mol Cell Biol. 2001;21:6359–68. [PMC free article] [PubMed]
  • Powell-Coffman JA, Knight J, Wood WB. Onset of C. elegans gastrulation is blocked by inhibition of embryonic transcription with an RNA polymerase antisense RNA. Dev Biol. 1996;178:472–83. [PubMed]
  • Priess JR, Schnabel H, Schnabel R. The glp-1 locus and cellular interactions in the early C. elegans embryo. Cell. 1987;51:601–611. [PubMed]
  • Radonjic M, Andrau JC, Lijnzaad P, Kemmeren P, Kockelkorn TT, van Leenen D, van Berkum NL, Holstege FC. Genome-wide analyses reveal RNA polymerase II located upstream of genes poised for rapid response upon S. cerevisiae stationary phase exit. Mol Cell. 2005;18:171–83. [PubMed]
  • Reese KJ, Dunn MA, Waddle JA, Seydoux G. Asymmetric segregation of PIE-1 in C. elegans is mediated by two complementary mechanisms that act through separate PIE-1 protein domains. Mol Cell. 2000;6:445–455. [PubMed]
  • Schaner CE, Deshpande G, Schedl PD, Kelly WG. A conserved chromatin architecture marks and maintains the restricted germ cell lineage in worms and flies. Dev Cell. 2003;5:747–57. [PubMed]
  • Schedl T. Developmental genetics of the germ line. In: Riddle DL, Blumenthal T, Meyer BJ, Priess JR, editors. C. elegans II. Cold Spring Harbor Press; Cold Spring Harbor, NY: 1997. pp. 241–170.
  • Schisa JA, Pitt JN, Priess JR. Analysis of RNA associated with P granules in germ cells of C. elegans adults. Development. 2001;128:1287–1298. [PubMed]
  • Schroeder SC, Schwer B, Shuman S, Bentley D. Dynamic association of capping enzymes with transcribing RNA polymerase II. Genes Dev. 2000;14:2435–40. [PubMed]
  • Seydoux G, Dunn MA. Transcriptionally repressed germ cells lack a subpopulation of phosphorylated RNA polymerase II in early embryos of Caenorhabditis elegans and Drosophila melanogaster. Development. 1997;124:2191–2201. [PubMed]
  • Seydoux G, Fire A. Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. Development. 1994;120:2823–2834. [PubMed]
  • Seydoux G, Mello CC, Pettitt J, Wood WB, Priess JR, Fire A. Repression of gene expression in the embryonic germ lineage of C. elegans. Nature. 1996;382:713–716. [PubMed]
  • Shim EY, Walker AK, Blackwell TK. Broad requirement for the Mediator subunit RGR-1 for transcription in the C. elegans embryo. J Biol Chem. 2002;277:30413–30416. [PubMed]
  • Somesh BP, Reid J, Liu WF, Sogaard TM, Erdjument-Bromage H, Tempst P, Svejstrup JQ. Multiple mechanisms confining RNA polymerase II ubiquitylation to polymerases undergoing transcriptional arrest. Cell. 2005;121:913–23. [PubMed]
  • Stitzel ML, Pellettieri J, Seydoux G. The C. elegans DYRK Kinase MBK-2 Marks Oocyte Proteins for Degradation in Response to Meiotic Maturation. Curr Biol. 2006;16:56–62. [PubMed]
  • Takagi T, Walker AK, Sawa C, Diehn F, Takase Y, Blackwell TK, Buratowski S. The Caenorhabditis elegans mRNA 5'-Capping Enzyme. IN VITRO AND IN VIVO CHARACTERIZATION. J Biol Chem. 2003;278:14174–14184. [PubMed]
  • Tenenhaus C, Schubert C, Seydoux G. Genetic requirements for inhibition of gene expression and PIE-1 localization in the embryonic germ lineage of caenorhabditis elegans. Dev Biol. 1998;200:212–224. [PubMed]
  • Walker AK, Rothman JH, Shi Y, Blackwell TK. Distinct requirements for C.elegans TAF(II)s in early embryonic transcription. Embo J. 2001;20:5269–79. [PubMed]
  • Walker AK, Shi Y, Blackwell TK. An extensive requirement for TFIID-specific TAF-1 in C. elegans embryonic transcription. J Biol Chem. 2004;279:29270–29277. [PubMed]
  • Wallenfang MR, Seydoux G. cdk-7 is required for mRNA transcription and cell cycle progression in C. elegans embryos. Proc Natl Acad Sci U S A. 2002;99:5527–5532. [PubMed]
  • Weeda G, Rossignol M, Fraser RA, Winkler GS, Vermeulen W, van 't Veer LJ, Ma L, Hoeijmakers JH, Egly JM. The XPB subunit of repair/transcription factor TFIIH directly interacts with SUG1, a subunit of the 26S proteasome and putative transcription factor. Nucleic Acids Res. 1997;25:2274–83. [PMC free article] [PubMed]
  • Woychik NA, Hampsey M. The RNA polymerase II machinery: structure illuminates function. Cell. 2002;108:453–63. [PubMed]
  • Xing H, Wilkerson DC, Mayhew CN, Lubert EJ, Skaggs HS, Goodson ML, Hong Y, Park-Sarge OK, Sarge KD. Mechanism of hsp70i gene bookmarking. Science. 2005;307:421–3. [PubMed]
  • Zeng F, Schultz RM. RNA transcript profiling during zygotic gene activation in the preimplantation mouse embryo. Dev Biol. 2005;283:40–57. [PubMed]
  • Zhang F, Barboric M, Blackwell TK, Peterlin BM. A model of repression: CTD analogs and PIE-1 inhibit transcriptional elongation by P-TEFb. Genes Dev. 2003;17:748–58. [PubMed]