PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of wtpaEurope PMCEurope PMC Funders GroupSubmit a Manuscript
 
J Cell Sci. Author manuscript; available in PMC 2007 November 15.
Published in final edited form as:
PMCID: PMC1906847
EMSID: UKMS680

Phosphoinositide 3-Kinase Signalling Regulates Early Development and Developmental Haemopoiesis

Summary

Phosphoinositide 3-kinase (PI3K)-dependent signalling regulates a wide variety of cellular functions including proliferation and differentiation. Disruption of class IA PI3K isoforms has implicated PI3K-mediated signalling in development of the early embryo and lymphohaemopoietic system. We have used embryonic stem (ES) cells as an in vitro model to study the involvement of PI3K-dependent signalling during early development and haemopoiesis. Both pharmacological inhibition and genetic manipulation of PI3K-dependent signalling demonstrate that PI3K-mediated signals, most likely via PDK1, are required for proliferation of cells within developing embryoid bodies (EB). Surprisingly, the haemopoietic potential of EB-derived cells was not blocked upon PI3K inhibition, but rather enhanced, correlating with modest increases in expression of haemopoietic marker genes. In contrast, PDK1-deficient EB-derived progeny failed to generate terminally differentiated haemopoietic lineages. This deficiency appeared to be due to a requirement for PI3K signalling during the proliferative phase of blast-colony forming cell (BL-CFC) expansion, rather than as a result of effects on differentiation per se. We also demonstrate that PI3K-dependent signalling is required for optimal generation of erythroid and myeloid progenitors and their differentiation into mature haemopoietic colony types. These data demonstrate that PI3K-dependent signals play important roles at different stages of haemopoietic development.

Keywords: PI3K, embryoid bodies, differentiation

Introduction

PI3Ks are a family of lipid kinases, whose products, phosphoinositide 3,4-bisphosphate (PI(3,4)P2) and phosphoinositide 3,4,5-trisphosphate (PI(3,4,5)P3), act as intracellular second messengers (Cantley, 2002; Vanhaesebroeck et al., 2001; Vanhaesebroeck and Waterfield, 1999). Three classes of PI3K have been described based on their structure and in vitro substrate specificity (Vanhaesebroeck and Waterfield, 1999). Members of the class IA family of PI3Ks are composed of a regulatory subunit (p85 or p55) and a p110 catalytic subunit (α, β or δ) and are activated by numerous growth factors and cytokines (Cantley, 2002; Vanhaesebroeck et al., 2001; Vanhaesebroeck and Waterfield, 1999). 3-phosphoinositide-dependent protein kinase-1 (PDK1) is a direct downstream effector of PI3Ks (Vanhaesebroeck and Alessi, 2000) and plays a central role in activating other downstream AGC-family kinases, ultimately leading to the regulation of a wide array of physiological processes, including proliferation, survival and differentiation (Mora et al., 2004).

Mouse gene targeting studies, in which one or more of the class IA PI3K sub-units has been functionally disrupted, have revealed a requirement for this family of enzymes in regulating developmental events. For example, disruption of both p85α and p85β gene products results in lethality at embryonic day 12.5 (E12.5) (Brachmann et al., 2005), while embryos deficient in p110α die between E9.5 and E10.5 due to a proliferative defect (Bi et al., 1999). Importantly, deletion of p110β leads to a very early developmental defect, resulting in embryonic lethality at the pre-implantation blastocyst stage (Bi et al., 2002). Interestingly, class IA catalytic and regulatory subunits are expressed from the single cell stage of development (Lu et al., 2004; Riley et al., 2005b) and PI3K signalling appears to be required for correct development of pre-implantation mouse embryos (Lu et al., 2004; Riley et al., 2005a; Riley et al., 2005b). The phenotypes of several PI3K knock-out mice have highlighted a requirement for PI3K-mediated signalling in development of the haemopoietic system. Disruption of p85α alone has demonstrated a role for PI3Ks in erythropoiesis (Huddleston et al., 2003), while p85α-/- / p85β-/+ fetal liver-derived haemopoietic stem cells have recently been reported to have reduced repopulating ability (Haneline et al., 2006). Both p85α and the p110δ subunits have been shown to be involved in B and T cell development (Clayton et al., 2002; Fruman et al., 1999; Okkenhaug et al., 2002; Suzuki et al., 1999). These reports suggest that PI3Ks play an important role during early embryonic development and that PI3Ks may be specifically required during developmental haemopoiesis.

The inaccessibility of early embryonic material and the embryonic lethality of several PI3K gene knock-outs have made it difficult to further characterise the requirement for PI3K-mediated signals during early development. Embryonic stem (ES) cells provide a unique in vitro model system in which the contribution of specific signals to early developmental stages can be examined (Doetschman et al., 1985; Keller et al., 1993; Keller, 1995). Extensive genetic analyses have demonstrated that in vitro differentiation of ES cells into embryoid bodies (EBs) recapitulates the events leading to the onset of primitive haemopoiesis in the yolk sac of the normal mouse embryo (Keller, 2005; Keller et al., 1993; Palis et al., 1999). Using ES cell differentiation, a progenitor representing the earliest stage of haemopoietic commitment has been identified (Choi et al., 1998; Nishikawa et al., 1998). This EB-derived progenitor, known as the blast colony-forming cell (BL-CFC), has both haemopoietic and endothelial potential and can be characterised by co-expression of Flk-1 and the mesodermal gene Brachyury (Choi et al., 1998; Faloon et al., 2000; Fehling et al., 2003; Kennedy et al., 1997). The BL-CFC represents the in vitro equivalent of the yolk sac haemangioblast, recently identified in the early mouse embryo (Huber et al., 2004).

To further examine the role of PI3K-dependent signalling pathways during early development and more specifically developmental haemopoiesis, we have used ES cells as an in vitro model and employed both pharmacological and genetic approaches to manipulate PI3K activity at different stages of differentiation. LY294002 is a reversible inhibitor (in vitro IC50 1.4 μM) of all classes of PI3Ks (class IA, IB, II and III), although the activity of PI3K-C2α is refractory to concentrations of LY294002 that inhibit the activity of the other PI3K family members (Knight et al., 2006; Vlahos et al., 1994). LY294002 is stable in solution and can be added or removed from assays at various points, making it a useful tool for deciphering the biological requirement of PI3K signalling at a cellular level. To complement the inhibitor studies and to investigate the role of class IA PI3Ks specifically, we employed ES cells in which a critical downstream effector of class IA PI3Ks, PDK1, has been disrupted. Using these complementary approaches, we demonstrate that the major role of PI3Ks during the very earliest stages of ES cell differentiation is to regulate proliferation. At later stages of differentiation we demonstrate that PI3K-dependent signalling is required for expansion of BL-CFC and haemopoietic precursors. Thus, PI3Ks play multiple roles at defined times during early development and differentiation of the primitive haemopoietic system.

Results

PI3K-dependent signalling is required for optimal EB development

Initially we examined whether inhibition of PI3K signalling affected the ability of ES cells to develop into embryoid bodies. ES cells were differentiated into EBs in the absence or presence of 5 or 10 μM of the PI3K inhibitor LY294002 (Vlahos et al., 1994). As seen in Fig. 1A, the size of EBs decreased upon inhibition of PI3K signalling, correlating with a reduction in cellularity of 2-3 fold in the presence of 5 μM LY294002 (see Fig. 1B), whereas 10 μM LY294002 almost completely inhibited EB development. Importantly, despite the size reduction, inhibition of PI3Ks with 5 μM LY294002 did not affect the plating efficiency of the ES cells, the same number of EBs being generated irrespective of the presence of the PI3K inhibitor (Fig. 1C). In addition, the decrease in cellularity did not appear to be as a result of increased apoptosis, which was not significantly altered upon inhibition of PI3Ks (data not shown). As an indicator of PI3K activity we measured the status of S6 phosphorylation at Serines 235 and 236 by immunoblotting (Fig. 1D). S6 phosphorylation was significantly reduced in EBs treated with 5 μM LY294002 and almost completely inhibited with 10 μM LY294002.

Fig. 1
Inhibition of PI3Ks impairs EB formation. EBs were generated in the presence of 0, 5 and 10 μM LY294002 (LY) as described in Materials and Methods. (A) Examples of day 5 EBs, original magnification 100X (10X/0.4 objective lens was used). Bars, ...

LY294002 inhibits all classes of PI3Ks, with the exception of PI3K-C2α (Knight et al., 2006; Vlahos et al., 1994) and we wanted to investigate more specifically the role of class IA PI3Ks. However, the complexity of this family (see Introduction) precluded a genetic knock-out approach of all isoforms within the same ES cell. Therefore, we reasoned that ES cells in which PDK1, a critical downstream effector of class I PI3Ks, had been disrupted would provide a robust genetic tool enabling us to determine if the effects we observe with LY294002 are attributable to class I PI3K-dependent signals. ES cells in which both copies of the PDK1 gene were disrupted (PDK1-/- ES cells (Williams et al., 2000)) formed EBs that were reduced in size, with a 2-3 fold decrease in cellularity compared to wild type parental ES cells (Fig. 2A and B), similar to the effects observed with 5 μM LY294002 (Fig. 1). The plating efficiency of the PDK1-/- ES cells was not significantly different from wild type ES cells (Fig. 2C). S6 phosphorylation could not be detected by immunoblotting extracts from PDK1-/- EBs (Fig. 2D), indicating that PDK1 is required in the pathway leading to phosphorylation of S6, as previously reported (Williams et al., 2000). These data indicate that PI3K signalling pathways, mediated at least in part via PDK1, are required for optimal formation and development of embryoid bodies and are consistent with class IA PI3Ks playing a role in early developmental processes.

Fig. 2
EBs formed from PDK1-/- ES cells are reduced in size and cellularity. EBs were generated from wild type parental (WT) and PDK1-/- ES cells. (A) Examples of day 5 EBs, original magnification 100X (10X/0.4 objective lens was used). Bars, 200 μm. ...

Inhibition of PI3K-dependent signalling does not block early developmental haemopoiesis but rather enhances the haemopoietic potential of embryoid body-derived cells

Our results demonstrate that PI3K-dependent signalling events are required for optimal development of embryoid bodies. We were interested in determining whether haemopoietic differentiation had been affected when PI3K signalling was perturbed during EB formation. To detect the emergence of haemopoietic precursors within the developing EB, EBs were formed in the presence or absence of LY294002 and we examined the ability of day 6 EB-derived cells to generate colonies in haemopoietic colony forming assays (HCAs), in the absence of LY294002, using a cocktail of cytokines designed to facilitate maturation of a range of haemopoietic cell types. Somewhat surprisingly, inhibition of PI3Ks during EB development led to an increase in the proportion of EB progeny with haemopoietic potential, evidenced by increases in the number of erythroid, myeloid and mixed colonies present in the HCAs compared to untreated EBs (Fig. 3A). Few secondary EBs developed, indicating efficient differentiation of cells within the EBs. In contrast, when we performed similar experiments with day 6 PDK1-deficient EB-derived cells, only very small erythroid colonies formed (Fig. 3B), whereas by day 12 no colonies were visible. Contrary to inhibition of PI3Ks with LY294002 only during EB formation (Fig. 3A), which measures the effects of PI3K inhibition on progenitor formation within the EB, in this experiment using PDK1-/- ES cells, the class I PI3K pathway would be inhibited throughout the entire experiment, including during formation of colonies in the HCAs. These results suggest that PDK1-dependent signals are required during developmental haemopoiesis, following haemopoietic progenitor formation within the EB. We were interested in further defining the stage at which PI3K signalling was required.

Fig. 3
Inhibition of PI3K-dependent signalling does not block early developmental haemopoiesis, but rather enhances it. (A) The number of haemopoietic colonies formed by day 6 EB-derived cells differentiated in the absence (EB 0LY/HCA 0LY) or presence of 5 μM ...

The emergence of different ES cell-derived haemopoietic populations within the developing EB can be tracked by expression of specific cell surface markers (Kabrun et al., 1997; Mikkola et al., 2003; Nishikawa et al., 1998). Flk-1 is initially expressed on blast colony forming cells (BL-CFCs) and represents the onset of embryonic haemopoiesis (Faloon et al., 2000; Fehling et al., 2003; Kabrun et al., 1997), whereas c-kit marks cells committed to the haemopoietic lineage which arise during the early stages of EB development (Fehling et al., 2003; Ling and Neben, 1997; Ogawa et al., 1991). In addition, it has been suggested that Flk-1+/c-kit+ double-positive cells represent a population with haemopoietic potential that mark the establishment of haemopoiesis (Lacaud et al., 2004; Willey et al., 2006). The pattern of Flk-1 and c-kit surface expression on cells from developing EBs formed in the presence or absence of 5 μM LY294002 or formed from PDK1-/- ES cells was analysed by flow cytometry. In untreated wild-type EBs, little Flk-1 or c-kit was expressed on day 3 (results not shown). As shown in Figure 3C, expression of Flk-1 dramatically increased over the next 24 hours followed by the expression of c-kit, which was maximal on day 5 and day 6. Importantly, a Flk-1+/c-kit+ double-positive population was observed on day 4 which increased over the next 48 hours. These profiles are similar to those previously described (Kabrun et al., 1997; Lacaud et al., 2004). Inhibition of PI3Ks with 5 μM LY294002 led to no change in overall c-kit expression, although a small enhancement in overall Flk-1 expression was observed, particularly on days 5 and 6 (Fig 3C). Interestingly, the proportion of Flk-1+/c-kit+ double-positive cells increased on days 5 and 6 compared with untreated EBs, correlating with the enhanced formation of haemopoietic colonies observed (Fig. 3B). Despite not being able to generate mature haemopoietic colonies, cells from PDK1-/- EBs showed an increase in overall Flk-1 expression culminating in an enhanced Flk-1+/c-kit+ double-positive cell population (Fig 3C). These findings suggest that inhibition of PI3K signalling does not block formation of early haemopoietic progenitors and may result in an enhanced proportion of EB cells with haemopoietic potential.

We also examined expression of marker genes to track progression from the mesoderm (Brachyury) to the BL-CFC (Flk-1) and on to committed haemopoietic progenitors (Scl and Gata-1) (Chung et al., 2002; D′Souza et al., 2005; Fehling et al., 2003; Fujimoto et al., 2001; Robertson et al., 2000), as well as the globin genes βH1 (primitive erythroid) and βmajor (definitive erythroid). Using semi-quantitative RT-PCR (Fig. 4A and B) inhibition of PI3K-dependent signalling by LY294002 treatment or disruption of PDK1 did not appear to significantly affect either the timing or apparent magnitude of expression of this set of marker genes. However, such semi-quantitative approaches cannot adequately distinguish relatively modest changes in gene expression and in light of the results of our HCAs, we decided to measure expression of these genes by quantitative PCR. Expression of Brachyury was reduced in day 3 EBs formed in the presence of LY294002 (Fig. 4C) or derived from PDK1-/- ES cells (Fig. 4D). Despite the increased surface expression of Flk-1 in EBs formed in the presence of LY294002 or from PDK1-/- ES cells, Flk-1 gene expression was reduced in day 4 EBs with a slight enhancement by day 6 in EBs formed in the presence of LY294002 (Fig. 4C and D). In light of the enhanced haemopoietic potential of EB cells derived in the presence of LY294002 observed in our HCAs, we were particularly interested in examining the expression of Scl, Gata-1, β-H1 and β-major. All were up-regulated by 2-3-fold in day 6 and 7 EBs formed in the presence of LY294002, correlating with the enhanced haemopoietic potential of these day 6 EB-derived cells. Taken together, these data indicate that inhibition of PI3K-dependent signalling does not block early stages of haemopoietic differentiation within developing EBs.

Fig. 4
Inhibition of PI3K-dependent signalling enhances expression of haemopoietic marker genes. (A) RT-PCR analysis of wild-type EBs formed in the absence (0 LY) or presence of 5 μM LY294002 (LY) or (B) formed from PDK1-/- ES cells. ES represents undifferentiated ...

PI3K-dependent signalling is required for expansion of BL-CFC progeny

Having observed that inhibition of PI3K-dependent signalling within developing EBs does not cause gross changes in expression of differentiation markers, but that the absence of PDK1 appears to preclude development of terminally differentiated haemopoietic cells, we decided to examine whether PI3K-mediated signalling was involved in the formation or expansion of the earliest haemopoietic progenitor, the BL-CFC. BL-CFCs are transient progenitors that arise in EBs between day 2.5 and day 4 of differentiation and are able to generate blast colonies with haemopoietic and endothelial potential (Choi et al., 1998; Faloon et al., 2000; Kennedy et al., 1997). BL-CFCs have been characterised by co-expression of Flk-1 and Brachyrury (Faloon et al., 2000; Fehling et al., 2003; Kabrun et al., 1997). We first determined whether inhibiting PI3Ks affected differentiation towards the BL-CFC within the EBs by assessing the ability of EB-derived cells to form blast colonies. EBs generated in the presence or absence of LY294002 were harvested following 3, 3.75 and 4 days of differentiation and identical cell numbers plated under blast colony forming conditions with no further inhibitor added. As indicated in Figs 5A and B, cells from day 3 EBs were unable to form blast colonies but blast colonies were formed by cells from EBs differentiated for 3.75 and 4 days, indicating the emergence of the BL-CFC and correlating with expression of Flk-1 (Fig 3C) and Brachyury (Fig 4A). Culturing EBs with 5 μM LY294002 had little or no affect on the number of blast colonies formed (Fig. 5B) or their cellularity. These data demonstrate that inhibition of PI3Ks does not block differentiation towards the BL-CFC within EBs. However, when we performed similar experiments with PDK1-/- ES cells no blast colonies formed (Fig. 5C). This was not simply due to a temporal change in developmental potential, because PDK1-/- cells from EBs differentiated for between 3-5 days had no blast colony forming potential (data not shown). Two possibilities could account for these observations. First, PDK1-/- ES cells cannot differentiate into BL-CFCs within the EB, although we feel this unlikely since these cells express Flk-1 and Brachyury in a similar pattern to wild type parental ES cells (Figs (Figs3C3C & 4B). The second possibility is that PI3K signals, mediated at least in part by PDK1, are required for the expansion and/or differentiation of the BL-CFC to form a blast colony. We tested this possibility by assessing whether inhibiting PI3Ks only during blast culture affected blast colony formation. Cells from EBs formed in the absence of inhibitor for 3.75 days, to allow for formation of the BL-CFC, were plated under blast colony forming conditions in the presence or absence of 5 μM LY294002. Inhibition of PI3K signalling with 5 μM LY294002 significantly inhibited the ability of BL-CFCs to form archetypal blast colonies, with only small clumps of cells being observed (Fig. 5C), corresponding to a 10-fold decrease in cellularity (Fig. 5D). These data indicate that PI3K-dependent signalling is required for BL-CFCs to undergo expansion to form blast colonies.

Fig. 5
PI3K-dependent signalling is required for formation of blast colonies. (A) EBs were formed in the presence of 0 or 5 μM LY294002 (LY). The EB cells were harvested on day 3, 3.75 and 4 as indicated and identical cell numbers (5×104/ml) ...

Blast colony formation has been described as a sequential process involving both proliferation and differentiation events (D′Souza et al., 2005). Within 1-2 days in culture the BL-CFC first proliferates to form a tight core of cells. Haemopoietic cells then develop from the core and after 3-4 days these cells cover the core. Haemopoietic, endothelial and vascular smooth muscle lineages comprise the mature blast colony. Our results could be due either to effects on proliferation, directly affecting growth of the blast colony, or due to effects on differentiation. To distinguish between these two possibilities, we examined the temporal expression of marker genes to track blast colony differentiation. As shown in Fig. 5E, patterns of gene expression were very similar in blast colonies generated in the absence or presence of PI3K inhibition, with flow cytometry demonstrating similar Flk-1, c-kit and CD41 cell surface expression profiles (data not shown). Intriguingly, despite no outward appearance of PDK1-deficient EB-derived cells being able to form blast colonies, cells recovered from these cultures showed a characteristic down-regulation of Brachyury as well as expression of Scl, Gata-1, β-H1 and β-major (Fig. 5F). These data indicate that there are no dramatic alterations in the blast colony differentiation profiles in the absence of PI3K-dependent signalling so in light of the decline in size of blast colonies, the most likely explanation of our results is that PI3K-dependent signals are required for proliferation of progenitor cells within the developing blast colony.

PI3K-dependent signalling is required for optimal development of haemopoietic precursors and mature haemopoietic lineages

Our results indicate that PI3K-mediated signals are required for expansion of the BL-CFC to form a blast colony. However, analyses of marker gene expression indicated that haemopoietic differentiation can still occur within the cells which do develop, so we decided to investigate whether these cells could generate mature haemopoietic lineages. Equivalent numbers of blast colony-derived cells, generated in the presence or absence of LY294002, were plated into HCAs, in the absence of inhibitor. Erythroid and myeloid (granulocytic and macrophage) colonies did form from cells of blast-like colonies formed in the presence of LY294002 (Fig. 6A; EB 0LY/blast 5LY), confirming that differentiation had occurred within the blast colony as suggested by the gene expression analyses. However, there was a 2-3 fold reduction in the number of colonies generated, indicating a reduction in the number of progenitors capable of differentiation in the blast colonies formed in the presence of LY294002. In contrast, inhibition of PI3Ks during the first 3.75 days of EB development, prior to re-plating in blast culture conditions (EB 5LY/blast 0LY), had no effect on the potential of blast-derived cells to generate haemopoietic colonies, confirming that PI3K inhibition during early EB development does not affect formation of the BL-CFC or its subsequent haemopoietic potential. Similar experiments could not be performed with PDK-1 deficient cells as too few progeny developed from the blast cultures (see Fig. 5C and D).

Fig. 6
PI3K-dependent signalling is required for optimal development of erythroid and myeloid lineages. (A) Day 3.75 EB-derived cells generated in the absence of inhibitor were plated into blast colony culture conditions in the absence (EB 0LY/blast 0LY) or ...

We also investigated if PI3K signalling was required for the generation of terminally differentiated haemopoietic cells from haemopoietic progenitors present within day 6 EBs. Inhibition of PI3Ks only during the HCA cultures (see Fig. 6B) dramatically reduced the number of myeloid colonies formed and to a lesser extent the number of mixed colonies. Interestingly, in this condition the number of small primitive erythroid colonies did not alter; however, there appeared to be a decrease in the number of larger definitive erythroid colonies formed in the presence of LY294002. These definitive erythroid colonies were reduced in size (see inset, Fig. 6B) which may have contributed to the decreased number of colonies counted.

To further explore the effects of PI3K inhibition on the generation of terminally differentiated haemopoietic cells, we plated primary mouse bone marrow progenitors into HCA cultures in the presence or absence of LY294002. The majority of colonies that formed under our conditions were myeloid, with few erythroid and mixed colony types. Inhibition of PI3Ks reduced the total number of myeloid colonies by 2-3 fold, confirming the requirement for PI3K signalling on myeloid progenitor expansion. Interestingly, we noticed that LY29004 treatment led to a preferential reduction in GM colonies, while macrophage colony numbers were largely not affected, implying a specific role for PI3K signalling during formation of mature granulocytes. These data are consistent with PI3K-mediated signals playing an important role in the differentiation and / or expansion of committed haemopoietic progenitors into mature myeloid lineage cells.

Discussion

In this study we have used murine ES cells as an in vitro model of early embryonic differentiation and developmental haemopoiesis. Our investigations have revealed that PI3K-dependent signalling plays a major role in regulation of proliferation during embryoid body formation. Surprisingly, inhibition of PI3Ks during this earliest stage of development did not block the generation of progeny with haemopoietic potential, indicating that PI3K-signalling is not absolutely essential for their differentiation. Instead, when PI3K signalling was inhibited with LY294002, we observed an enhancement in the proportion of EB-derived cells capable of generating haemopoietic colonies, contrasting starkly with PDK1-deficient cells, which were unable to form mature erythroid or myeloid cells. These data indicate that PI3K-dependent signals, possibly mediated via PDK1, are required at a stage following haemopoietic progenitor formation within the EB for development of mature haemopoietic lineages. Investigation of the underlying mechanisms revealed an essential requirement for PI3K-mediated signals during expansion of BL-CFCs. Furthermore, we define a role for PI3K-dependent signalling during expansion of haemopoietic progenitors and generation of mature erythroid and myeloid lineages. These results, summarised in Fig. 7, support a role for PI3K-dependent signalling at multiple stages of developmental haemopoiesis.

Fig. 7
PI3K-dependent signalling is required at multiple stages of developmental haemopoiesis. Our studies have demonstrated that PI3K signalling is required for proliferation of cells within the developing EB at the early stages of development. However, inhibition ...

Our data demonstrate a clear decrease in cellularity of EBs generated either in the presence of LY294002 or from PDK1-deficient ES cells. In our hands, this does not appear to be due to increased apoptosis (data not shown), which contrasts to the report that inhibition of PI3Ks leads to apoptosis in murine blastocysts and of trophoblast stem cells (Riley et al., 2005a). However, it is worth noting that we used LY294002 at only 5 μM, compared to the 250 μM used by Riley et al., (Riley et al., 2005a). It has been reported that LY294002 can also inhibit mTORC1 in vitro (Knight et al., 2006), although this occurs at higher doses of LY294002 than those required to inhibit class IA PI3Ks. While we cannot formally discount the possibility that the more dramatic effects on EB cellularity we observe using 10 μM LY294002 are related to effects on mTORC1, we believe that the remarkably similar results obtained with ES cells treated with 5 μM LY294002 and PDK1 null ES cells are consistent with a role for class I PI3Ks during EB development. Our analyses of mesodermal and haemopoietic differentiation (cell surface marker and target gene expression) indicate that despite the decrease in EB size, the overall proportion of mesodermal cells is not drastically altered and temporal patterns of gene expression are similar. Therefore, we believe our data are most consistent with PI3Ks being required for optimal proliferation of EB cells. The regulation of undifferentiated ES cell proliferation by PI3K-dependent signalling has been reported (Hallmann et al., 2003; Jirmanova et al., 2002; Paling et al., 2004; Sun et al., 1999; Takahashi et al., 2003) but very little is known about the involvement of PI3K signalling pathways during early stages of ES cell differentiation. Interestingly, S6 phosphorylation is increased in EB cells compared to undifferentiated ES cells (Fig. 1D), consistent with the increased PI3K activity seen following RA-induced differentiation of ES cells (Jirmanova et al., 2002) which could indicate increased dependence on this pathway as cells differentiate. The decrease in proliferation we propose to account for our observations is consistent with the consequences of PDK1 deficiency on embryonic mouse development, where PDK1 has been shown to be important for regulating growth (Lawlor et al., 2002). Similarly, deficiency of the p110β catalytic isoform of class IA PI3Ks leads to a very early embryonic lethality, with very poor growth of p110β-deficient blastocysts reported (Bi et al., 2002). Despite the fact that embryos as early as the 1 cell stage express multiple class IA isoforms (Lu et al., 2004; Riley et al., 2005b), this evidence suggests a non-redundant role for class IA PI3Ks. ES cells are derived from the inner cell masses of day 3.5 mouse blastocysts and development of embryoid bodies models the earliest stages of embryonic development. Thus, the effects we observe on EB development are consistent with a requirement for PI3K signalling during these early stages.

What we found surprising was that despite the decrease in EB cellularity, the timing of early haemopoietic differentiation events, as evidenced by cell surface expression, gene expression analyses and formation of BL-CFCs, did not appear to be inhibited under conditions of PI3K inhibition or PDK1-deficiency, suggesting that PI3K signalling is dispensable for commitment towards the haemopoietic lineage during EB development. In fact, we observed an increase in the proportion of Flk-1+/c-kit+ double positive cells in day 6 EBs formed in the presence of LY294002. This Flk-1+/c-kit+ double positive population has been proposed to represent early haemopoietic progenitors (Lacaud et al., 2004; Willey et al., 2006) which correlates with our observed increase in haemopoietic colony forming potential of EB-derived cells generated in the presence of PI3K inhibition. Intriguingly, we appear to be detecting a distinct Flk-1high/c-kit+ population in cells from day 6 EBs formed in the presence of LY294002 and more prominently in cells from EBs generated from PDK1-/- ES cells. It will be interesting to determine whether it is this distinct population that has haemopoietic potential. How can we explain the enhanced presence of cells with haemopoietic potential in EBs derived in the presence of PI3K inhibition? One possible explanation is that other cell types within the developing embryoid body are differentially more sensitive to the growth inhibitory effects arising from PI3K inhibition, leading to a small increase in the total proportion of cells that have haemopoietic potential within the EB. This is certainly supported by our finding that PDK1 deficient ES cells also exhibit enhanced levels of a c-kit+/Flk-1+ double positive cell population. However, we cannot formally exclude the possibility that our results reflect either the inability of LY294002 to penetrate to the core of the developing EB, where the haemopoietic progenitors are likely to arise, or that an increase in the subset of cells capable of haemopoietic differentiation arises as a direct effect of PI3K inhibition during early development of these lineages.

The inability of PDK1-deficient EB-derived progeny to form terminally differentiated haemopoietic cells indicates a likely requirement for PDK1-mediated signals during developmental haemopoiesis and our studies reveal a critical requirement for PI3K signals during the expansion of the earliest haemopoietic progenitor, the BL-CFC, to form blast colonies. Quite remarkably, temporal expression of marker genes was not significantly altered indicating that differentiation still occurs when PI3Ks are inhibited or PDK1 is absent. One caveat to these studies is that we have examined the behaviour of only a single PDK1 null ES cell line, since an independently derived line was not available. However, the data generated with the PDK1 deficient line supports data generated with the PI3K inhibitor LY294002 and together are consistent with PI3K-mediated signals being required for proliferation of haemopoietic progenitors during blast colony expansion. This begins to shed light on the signals required for expansion and differentiation of the BL-CFC, about which little is known. VEGF, the ligand for Flk-1, plays a role in blast colony formation, although it is not known whether this involves PI3K signalling. However, PI3K signalling has been implicated in VEGF-mediated survival of murine bone marrow progenitors (Larrivee et al., 2003) and PI3Ks are activated by VEGF in adult human endothelial cells (Dayanir et al., 2001), so it will be interesting to examine this in the future. Consistent with a requirement for class IA PI3K-mediated signals in the expansion of haemopoietic progenitors, c-kit+ haemopoietic progenitors derived from p85α-/- (Haneline et al., 2006; Huddleston et al., 2003) or p85α-/- p85β-/+ (Haneline et al., 2006; Huddleston et al., 2003) fetal liver show decreased proliferation in response to SCF.

We have also demonstrated a role for PI3K-dependent signalling in the generation of committed haemopoietic precursors. Several studies have suggested a role for PI3K signalling during fetal liver erythropoiesis, (Huddleston et al., 2003; Zhao et al., 2006) and recent work has demonstrated a requirement for PI3K/AKT signalling pathway in the maturation of fetal liver erythroid progenitors (Ghaffari et al., 2006). Our data are consistent with a requirement for PI3K signalling for expansion of haemopoietic progenitors into the mature erythroid lineage. In addition, we demonstrate that inhibition of PI3Ks only during expansion of committed progenitors dramatically reduced the number of myeloid colonies formed from haemopoietic progenitors derived from both EBs and mouse bone marrow. Although there have been reports of many cytokines activating PI3Ks (Gold et al., 1994) and of PI3Ks being involved in regulation of proliferation of mature myeloid lineages (Ali et al., 2004; Fox et al., 2005; Mungalavadla et al., 2005), there is little data available on the role of PI3Ks in development of the myeloid lineage. During the preparation of this manuscript, a requirement for class IA PI3Ks in the function of fetal liver-derived haemopoietic stem cells was reported (Haneline et al., 2006) which demonstrated significantly reduced myeloid repopulating activity of p85α-/- / p85β-/+ adult HSCs. These studies, together with our data, are consistent with PI3Ks contributing to differentiation of the myeloid lineage.

We have shown that PI3K-dependent signalling events, mediated at least in part via PDK1, are required for proliferation during early differentiation within EBs and therefore may be required for overall proliferation events during early development. Importantly, PI3K signalling pathways are required for efficient expansion of BL-CFC progeny, as well as for optimal differentiation of erythroid and myeloid progenitors, indicating important roles for these signals at multiple stages of haemopoietic development.

Materials and Methods

Embryonic stem cell growth and differentiation

The E14tg2a wild type and PDK1 deficient murine ES cell lines (Williams et al., 2000) (a kind gift of Dario Alessi, University of Dundee) were routinely cultured in Knock-Out Dulbecco’s modified Eagle’s medium (Invitrogen, Scotland) supplemented with 103 units/ml murine LIF (ESGRO; Chemicon) as described previously (Paling and Welham, 2005; Paling et al., 2004). Formation of embryoid bodies (EBs) was adapted from Kennedy et al., 1997 (Kennedy et al., 1997). ES cells were trypsinized into a single-cell suspension and plated at 1×104 cells/ml in 40% (v/v) ES-Cult (StemCell Technologies, Vancouver, Canada) containing 15% (v/v) FBS (Invitrogen), 0.2 mg/ml transferrin (SIGMA, Poole, Dorset), 4.5 × 10-4 M monothioglycerol (MTG, SIGMA), 50 μg/ml L-ascorbic acid, and 100 μg/ml insulin in Iscove modified Dulbecco medium (IMDM, Invitrogen) supplemented with 10 ng/ml basic fibroblast growth factor (bFGF) (PeproTech, London) and 2 ng/ml activin A (recombinant human, R&D Systems, Abingdon) and plated into bacterial Petri dishes (Sterilin) in the presence or absence of 5 or 10 μM LY294002 (Calbiochem).

Colony assays

Embryoid bodies were harvested, washed in PBS (Invitrogen) and trypsinized for 3 minutes at 37°C. Blast colonies were formed by plating day 3-4 EB-derived cells at 3-5 × 104 cells/ml in 40% (v/v) ES-Cult (StemCell Technologies) containing 10% (v/v) FBS (Invitrogen), 0.2 mg/ml transferrin, 4.5 × 10-4 M MTG, 25 μg/ml L-ascorbic acid in IMDM supplemented with 5ng/ml vascular endothelial growth factor (VEGF; PeproTech), 5 ng/ml IL-6 (Peprotech) and 25% D4T endothelial cell conditioned medium (Kennedy et al., 1997). Colonies were counted following 4 days in culture. For the growth of haemopoietic precursors, day 6 EB-derived cells were plated at 5-10 × 104 cells/ml in Metho-cult (StemCell Technologies) containing 1% (w/v) methylcellulose 15% (v/v) FBS, 1% (w/v) bovine serum albumin (BSA), 10 μg/ml insulin 0.2 mg/ml transferrin, 1×10-4 M 2-mercaptoethanol and 2 mM glutamine, supplemented with 25ng/ml GM-CSF, 25 ng/ml G-CSF, 10 ng/ml IL-3, 10 ng/ml SCF (all from Peprotech) and 2 U/ml erythropoietin (EPO: R&D Systems) in IMDM and plated into 35 mm Petri dishes. Alternatively, bone marrow (BM) was harvested from the femurs of 12 week CD1 mice, red blood cells cleared by hypotonic lysis, and plated at 2.5 × 104 cells/ml in above culture conditions. Primitive erythroid colonies were counted following 4-5 days in culture and appeared as very small red clusters of 10-20 erythroblasts. All other colonies were counted following 8-10 days in culture. Colony images were visualised using an Olympus (Tokyo, Japan) XI51 inverted microscope and objective lenses (apertures and magnifications are specified in each Fig. legend) and captured using an Olympus Camedia C4040 digital camera. Data were analysed for statistical significance using two-tailed paired Student’s t-tests.

Cell lysates and immunoblotting

EBs were washed 3 times in PBS and lysed directly in ice cold solubilization buffer, as described previously (Welham et al., 1994). Insoluble material was removed by centrifugation at full speed for 2 min in an Eppendorf microcentrifuge at 4°C. Protein concentrations were determined using the Bio-Rad (Hercules, CA) protein assay kit according to the manufacturer’s instructions and 10 μg of each cell lysate separated by SDS-PAGE an transferred onto nitrocellulose (Welham et al., 1994). Immunobloting was performed using primary antibodies at 1:1000 dilution: rabbit polyclonal antibodies recognising dual phosphorylated ribosomal protein S6 at Ser235/236 (anti-P-S6, Cell Signal Technologies, 2211) or SHP-2 (Santa Cruz Biotechnology, CA) or goat polyclonal antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz, sc-20357). Anti-rabbit and anti-goat secondary antibodies conjugated to horseradish peroxidase (Dako, Cambridgeshire, UK), were used at 1:10 000 dilution and blots were developed using ECL (Amersham Biosciences, Bucks, UK). Blots were stripped and reprobed as described previously (Welham et al., 1994).

Flow Cytometry

EBs were trypsinised and the cells resuspended in ice cold wash buffer (PBS containing 2% (v/v) FBS and 0.1% (w/v) sodium azide). Non-specific binding to Fc receptors was blocked by incubation with mouse anti-CD16/CD32 (FcγIII/II receptors; 1:2500; BD PharMingen) for 30 minutes on ice. Cells were then stained on ice for a further 30 minutes with phycoerythrin (PE)-conjugated anti-c-kit monoclonal antibodies (clone ACK45;1:200; BD PharMingen) and/or biotin-conjugated anti- Flk-1 monoclonal antibodies (clone Avas12a1; 1:100; eBioscience) in ice-cold wash buffer. Flk-1-labeled cells were then washed twice in wash buffer and incubated with (PE-Cy5)-conjugated streptavidin (1:100; DAKO) for a further 30 minutes. Flow cytometry was performed using a FACSCanto cytometer (Becton Dickenson) and the data were analysed with FACSDiva software. Dead cells were excluded from analyses based on forward and side scatter parameters.

Gene expression analyses

EBs were collected, washed in PBS and RNA was purified using TRIzol Reagent (Invitrogen), following the manufacturer’s instructions. All RNA samples were treated with DNase I (Promega, Madison, WI, USA) before cDNA synthesis to eliminate any contaminating genomic DNA. RNA (1μg) was reverse transcribed into cDNA with Oligo(dT)15 (Promega) using SuperScript II (Invitrogen). Gene-specific PCR was carried out using the following primers (Faloon et al., 2000; Keller et al., 1993; Ogawa et al., 1999):

  • brachyury sense, CATGTACTCTTCTTGCTGG; brachyury antisense,
  • GGTCTCGGGAAAGCAGTGGC; c-kit sense, TGTCTCTCCAGTTTCCCTGC; c-kit antisense,
  • TTCAGGGACTCATGGGCTCA; flk1 sense, CACCTGGCACTCTCCACCTTC; flk1 antisense,
  • GATTTCATCCCACTACCGAAAG; scl sense, ATTGCACACACGGGATTCTG; scl antisense,
  • GAATTCAGGGTCTTCCTTAG; gata1 sense, ACTCGTCATACCACTAAG; gata1 antisense,
  • AGTGTCTGTAGGCCTCAG; β-major sense, CGATGAAGTTGGTGGTGAGG; β-major antisense,
  • CACAATCACGATCATATTGCC; β-H1 sense, AGTCCCCATGGAGTCAAAGA; β-H1 antisense,
  • CTCAAGGAGACCTTTGCTCA; gapdh sense, TGGAGCCAAACGGGTCATC; gapdh antisense,
  • GCTCTGGGATGACCTTGCC; β-actin sense, TAGGCACCAGGGTGTGATGG; β-actin antisense, CATGGCTGGGGTGTTGAAGG.

Quantitative PCR was performed using a two-step RT-PCR method and LightCycler FastStart DNA Master SYBR Green I (Roche Applied Science, East Sussex, UK) according to the manufacturer’s instructions using the above primers. Briefly, the reaction was carried out in a total volume of 20 μl, comprising 0.5 μM of each primer, 2.5 mM MgCl2, 2 μl SYBR Green, and 2 μl of appropriately diluted cDNA (prepared as described above). Subsequent amplification and online monitoring was performed using the LightCycler™ system (Roche Applied Science). After 40 cycles of amplification, melting curve analysis was performed to check that only the desired PCR product had been amplified. All target genes were normalised to β-actin for each sample. The PCR efficiency of both the target and reference genes was calculated from the derived slopes of standard curves by the LightCycler software (Roche Molecular Biochemicals LightCycler Software, Version 3.5.3). These PCR efficiency values were used to calculate the relative quantification values for calibrator-normalised target gene expression by the LightCycler Relative quantification software (Version 1.0). Data were analysed for statistical significance using two-tailed paired Student’s t-tests.

Acknowledgements

We thank Drs Helen Wheadon and Nick Paling for initial assistance with ES differentiation; Prof Dario Alessi for PDK1-/- ES cells and Dr George Lacaud and Prof Gordon Keller for D4T cell line. This work was funded by the Wellcome Trust.

References

  • Ali K, Bilancio A, Thomas M, Pearce W, Gilfillan AM, Tkaczyk, Kuehn N, Gray A, Giddings J, Peskett E, et al. Essential role for the p110δ phosphoinositide 3-kinase in the allergic response. Nature. 2004;431:1007–1011. [PubMed]
  • Bi L, Okabe I, Bernard DJ, Nussbaum RL. Early embryonic lethality in mice deficient in the p110beta catalytic subunit of PI 3-kinase. Mamm Genome. 2002;13:169–172. [PubMed]
  • Bi L, Okabe I, Bernard DJ, Wynshaw-Boris A, Nussbaum RL. Proliferative defect and embryonic lethality in mice homozygous for a deletion in the p110alpha subunit of phosphoinositide 3-kinase. J Biol Chem. 1999;274:10963–10968. [PubMed]
  • Brachmann SM, Yballe CM, Innocenti M, Deane JA, Fruman DA, Thomas SM, Cantley LC. Role of phosphoinositide 3-kinase regulatory isoforms in development and actin rearrangement. Mol Cell Biol. 2005;25:2593–2606. [PMC free article] [PubMed]
  • Cantley LC. The phosphoinositide 3-kinase pathway. Science. 2002;296:1655–1657. [PubMed]
  • Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G. A common precursor for hematopoietic and endothelial cells. Development. 1998;125:725–732. [PubMed]
  • Chung YS, Zhang WJ, Arentson E, Kingsley PD, Palis J, Choi K. Lineage analysis of the hemangioblast as defined by FLK1 and SCL expression. Development. 2002;129:5511–5520. [PubMed]
  • Clayton E, Bardi G, Bell SE, Chantry D, Downes CP, Gray A, Humphries LA, Rawlings D, Reynolds H, Vigorito E, et al. A crucial role for the p110delta subunit of phosphatidylinositol 3-kinase in B cell development and activation. J Exp Med. 2002;196:753–763. [PMC free article] [PubMed]
  • D′Souza SL, Elefanty AG, Keller G. SCL/Tal-1 is essential for hematopoietic commitment of the hemangioblast but not for its development. Blood. 2005;105:3862–3870. [PubMed]
  • Dayanir V, Meyer RD, Lashkari K, Rahimi N. Identification of tyrosine residues in vascular endothelial growth factor receptor-2/FLK-1 involved in activation of phosphatidylinositol 3-kinase and cell proliferation. J. Biol Chem. 2001;276:17686–17692. [PubMed]
  • Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol. 1985;87:27–45. [PubMed]
  • Faloon P, Arentson E, Kazarov A, Deng CX, Porcher C, Orkin S, Choi K. Basic fibroblast growth factor positively regulates hematopoietic development. Development. 2000;127:1931–1941. [PubMed]
  • Fehling HJ, Lacaud G, Kubo A, Kennedy M, Robertson S, Keller G, Kouskoff V. Tracking mesoderm induction and its specification to the hemangioblast during embryonic stem cell differentiation. Development. 2003;130:4217–4227. [PubMed]
  • Fox BC, Crew TE, Welham MJ. Phosphoinositide 3-kinases can act independently of p27Kip1 to regulate optimal IL-3-dependent cell cycle progression and proliferation. Cell Signal. 2005;17:473–487. [PubMed]
  • Fruman DA, Snapper SB, Yballe CM, Davidson L, Yu JY, Alt FW, Cantley LC. Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85alpha. Science. 1999;283:393–397. [PubMed]
  • Fujimoto T, Ogawa M, Minegishi N, Yoshida H, Yokomizo T, Yamamoto M, Nishikawa S. Step-wise divergence of primitive and definitive haematopoietic and endothelial cell lineages during embryonic stem cell differentiation. Genes to Cells. 2001;6:1113–1127. [PubMed]
  • Ghaffari S, Kitidis C, Zhao W, Marinkovic D, Fleming MD, Luo B, Marszalek, Lodish HF. AKT induces erythroid cell maturation of JAK2-deficient fetal liver progenitor cells and is required for EPO regulation of erythroid-cell differentiation. Blood. 2006;107:1888–1891. [PubMed]
  • Gold MR, Duronio V, Saxena SP, Schrader JW, Aebersold R. Multiple cytokines activate phosphatidylinositol 3-kinase in hematopoietic-cells - association of the enzyme with various tyrosine-phosphorylated proteins. J Biol Chem. 1994;269:5403–5412. [PubMed]
  • Hallmann D, Trumper K, Trusheim H, Ueki K, Kahn CR, Cantley LC, Fruman DA, Horsch D. Altered signaling and cell cycle regulation in embryonal stem cells with a disruption of the gene for phosphoinositide 3-kinase regulatory subunit p85alpha. J Biol Chem. 2003;278:5099–5108. [PMC free article] [PubMed]
  • Haneline LS, White H, Yang F-C, Chen S, Orschell C, Kapur R, Ingram DA. Genetic reduction of class IA PI-3 kinase activity alters fetal hematopoiesis and competitive repopulating ability of hemopoietic stem cells in vivo. Blood. 2006;107:1375–1382. [PubMed]
  • Huber TL, Kouskoff V, Fehling HJ, Palis J, Keller G. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature. 2004;432:625–630. [PubMed]
  • Huddleston H, Tan B, Yang FC, White H, Wenning MJ, Orazi A, Yoder MC, Kapur R, Ingram DA. Functional p85alpha gene is required for normal murine fetal erythropoiesis. Blood. 2003;102:142–145. [PubMed]
  • Jirmanova L, Afanassieff M, Gobert-Gosse S, Markossian S, Savatier P. Differential contributions of ERK and PI3-kinase to the regulation of cyclin D1 expression and to the control of the G1/S transition in mouse embryonic stem cells. Oncogene. 2002;21:5515–5528. [PubMed]
  • Kabrun N, Buhring HJ, Choi K, Ullrich A, Risau W, Keller G. Flk-1 expression defines a population of early embryonic hematopoietic precursors. Development. 1997;124:2039–2048. [PubMed]
  • Keller G. Embryonic stem cell differentiation: emergence of a new era in biology and medicine. Genes Dev. 2005;19:1129–1155. [PubMed]
  • Keller G, Kennedy M, Papayannopoulou T, Wiles MV. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol. 1993;13:473–486. [PMC free article] [PubMed]
  • Keller GM. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol. 1995;7:862–869. [PubMed]
  • Kennedy M, Firpo M, Choi K, Wall C, Robertson S, Kabrun N, Keller G. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature. 1997;386:488–493. [PubMed]
  • Knight ZA, Gonzalez B, Feldman ME, Zunder ER, Goldenberg DD, Williams O, Loewith R, Stokoe D, Balla A, Toth B, et al. A pharmacological map of the PI3-K family defines a role for p110 alpha in insulin signaling. Cell. 2006;125:733–747. [PMC free article] [PubMed]
  • Lacaud G, Kouskoff V, Trumble A, Schwantz S, Keller G. Haploinsufficiency of Runx1 results in the acceleration of mesodermal development and hemangioblast specification upon in vitro differentiation of ES cells. Blood. 2004;103:886–889. [PubMed]
  • Larrivee B, Lane DR, Pollet I, Olive PL, Humphries RK, Karsen A. Vascular endothelial growth factor receptor-2 induced survival of hematopoietic progenitor cells. J. Biol. Chem. 2003;278:22006–22013. [PubMed]
  • Lawlor MA, Morea A, SAhsby PR, Williams AR, Murray-Tait V, Malone L, Prescott AR, Lucocq JM, Alessi DR. Essential role of PDK1 in regulating cell size and development in mice. EMBO J. 2002;21:3728–3738. [PubMed]
  • Ling V, Neben S. In vitro differentiation of embryonic stem cells: immunophenotypic analysis of cultured embryoid bodies. J Cell Physiol. 1997;171:104–115. [PubMed]
  • Lu DP, Chandrakanthan V, Cahana A, Ishii S, O′Neill C. Trophic signals acting via phosphatidylinositol-3 kinase are required for normal pre-implantation mouse embryo development. J Cell Sci. 2004;117:1567–1576. [PubMed]
  • Mikkola HK, Fujiwara Y, Schlaeger TM, Traver D, Orkin SH. Expression of CD41 marks the initiation of definitive hematopoiesis in the mouse embryo. Blood. 2003;101:508–516. [PubMed]
  • Mora A, Komander D, van Aalten DM, Alessi DR. PDK1, the master regulator of AGC kinase signal transduction. Semin Cell Dev Biol. 2004;15:161–170. [PubMed]
  • Mungalavadla V, Borneo J, Ingram DA, Kapur R. p85alpha subunit of calliA PI-3 kinase is crucial for macrophage growth and migration. Blood. 2005;106:103–109. [PubMed]
  • Nishikawa SI, Nishikawa S, Hirashima M, Matsuyoshi N, Kodama H. Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development. 1998;125:1747–1757. [PubMed]
  • Ogawa M, Kizumoto M, Nishikawa S, Fujimoto T, Kodama H, Nishikawa SI. Expression of alpha4-integrin defines the earliest precursor of hematopoietic cell lineage diverged from endothelial cells. Blood. 1999;93:1168–1177. [PubMed]
  • Ogawa M, Matsuzaki Y, Nishikawa S, Hayashi S, Kunisada T, Sudo T, Kina T, Nakauchi H. Expression and function of c-kit in hemopoietic progenitor cells. J Exp Med. 1991;174:63–71. [PMC free article] [PubMed]
  • Okkenhaug K, Bilancio A, Farjot G, Priddle H, Sancho S, Peskett E, Pearce W, Meek SE, Salpekar A, Waterfield MD, et al. Impaired B and T cell antigen receptor signaling in p110 delta PI 3-kinase mutant mice. Science. 2002;297:1031–1034. [PubMed]
  • Paling NR, Welham MJ. Tyrosine phosphatase SHP-1 acts at different stages of development to regulate hematopoiesis. Blood. 2005;105:4290–4297. [PubMed]
  • Paling NR, Wheadon H, Bone HK, Welham MJ. Regulation of embryonic stem cell self-renewal by phosphoinositide 3-kinase-dependent signaling. J Biol Chem. 2004;279:48063–48070. [PubMed]
  • Palis J, Robertson S, Kennedy M, Wall C, Keller G. Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development. 1999;126:5073–5084. [PubMed]
  • Riley JK, Carayannopoulos MO, Wyman AH, Chi M, Moley KH. PI3-kinase activity is critical for glucose metabolism and embryo survival in murine blastocysts. J Biol Chem. 2006;281:6010–6019. [PubMed]
  • Riley JK, Carayannopoulos MO, Wyman AH, Chi M, Ratajczak CK, Moley KH. The PI3K/Akt pathway is present and functional in the preimplantation mouse embryo. Dev Biol. 2005;284:377–386. [PubMed]
  • Robertson SM, Kennedy M, Shannon JM, Keller G. A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development. 2000;127:2447–2459. [PubMed]
  • Sun H, Lesche R, Li DM, Liliental J, Zhang H, Gao J, Gavrilova N, Mueller B, Liu X, Wu H. PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt protein kinase B signaling pathway. Proc. Natl. Acad. Sci. USA. 1999;96:6199–6204. [PubMed]
  • Suzuki H, Terauchi Y, Fujiwara M, Aizawa S, Yazaki Y, Kadowaki T, Koyasu S. Xid-like immunodeficiency in mice with disruption of the p85alpha subunit of phosphoinositide 3-kinase. Science. 1999;283:390–2. [PubMed]
  • Takahashi K, Mitsui K, Yamanaka S. Role of ERas in promoting tumour-like properties in mouse embryonic stem cells. Nature. 2003;423:541–545. [PubMed]
  • Vanhaesebroeck B, Alessi DR. The PI3K-PDK1 connection: more than just a road to PKB. Biochem J. 2000;346(Pt 3):561–756. [PubMed]
  • Vanhaesebroeck B, Leevers SJ, Ahmadi K, Timms J, Katso R, Driscoll PC, Woscholski R, Parker PJ, Waterfield MD. Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem. 2001;70:535–602. [PubMed]
  • Vanhaesebroeck B, Waterfield MD. Signaling by distinct classes of phosphoinositide 3-kinases. Exp Cell Res. 1999;253:239–254. [PubMed]
  • Vlahos CJ, Matter WF, Hui KY, Brown RF. A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002) J Biol Chem. 1994;269:5241–5248. [PubMed]
  • Welham MJ, Dechert U, Leslie KB, Jirik F, Schrader JW. Interleukin (IL)-3 and granulocyte/macrophage colony-stimulating factor, but not IL-4, induce tyrosine phosphorylation, activation, and association of SHPTP2 with Grb2 and phosphatidylinositol 3′-kinase. J Biol Chem. 1994;269:23764–23768. [PubMed]
  • Willey S, Ayuso-Sacido A, Zhang H, Fraser ST, Sahr KE, Adlam MJ, Kyba M, Daley GQ, Keller G, Baron MH. Acceleration of mesoderm development and expansion of hematopoietic progenitors in differentiating ES cells by the mouse Mix-like homeodomain transcription factor. Blood. 2006;107:3122–3130. [PubMed]
  • Williams MR, Arthur JS, Balendran A, van der Kaay J, Poli V, Cohen P, Alessi DR. The role of 3-phosphoinositide-dependent protein kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr Biol. 2000;10:439–348. [PubMed]
  • Zhao W, Kitidis C, Fleming MD, Lodish HF, Ghaffari S. Erythropoietin stimulated phosphorylation and activation of GATA-1 via the PI3-kinase/AKT signalling pathway. Blood. 2006;107:907–915. [PubMed]