PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Heart Rhythm. Author manuscript; available in PMC 2008 March 1.
Published in final edited form as:
PMCID: PMC1868697
NIHMSID: NIHMS21012
KCNJ2 mutations in arrhythmia patients referred for LQT testing: a mutation T305A with novel effect on rectification properties
Lee L. Eckhardt, M.D.,1 Amanda L. Farley, M.S.,1 Esther Rodriguez, M.D.,2 Karen Ruwaldt, B.S.,1 Daniel Hammill,2 David J. Tester, B.S.,2 Michael J. Ackerman, M.D., Ph.D.,2 and Jonathan C. Makielski, M.D.1
1 Department of Medicine (Cardiovascular Medicine), University of Wisconsin, Madison, WI
2 Departments of Medicine, Pediatrics, and Molecular Pharmacology, Divisions of Cardiovascular Diseases and Pediatric Cardiology, Mayo Clinic College of Medicine, Rochester, MN
Reprints and correspondence: Jonathan C. Makielski, MD, University of Wisconsin Hospital and Clinics, Division of Cardiovascular Medicine, H6/362 MC 3248, 600 Highland Avenue, Madison, WI 53792, (608) 263-4856 phone, (608) 263-0405 FAX, jcm/at/medicine.wisc.edu
BACKGROUND
Loss-of-function mutations in the KCNJ2 cause ~50% of Andersen-Tawil Syndrome (ATS) characterized by a classic triad of periodic paralysis, ventricular arrhythmia, and dysmorphic features. Do KCNJ2 mutations occur in patients lacking this triad and lacking a family history of ATS?
OBJECTIVES
The purpose of this study was to identify and characterize mutations in the KCNJ2-encoded inward rectifier potassium channel Kir2.1 from patients referred for genetic arrhythmia testing.
METHODS
Mutational analysis of KCNJ2 was performed for 541 unrelated patients. The mutations were made in wild type (WT) and expressed in COS-1 cells and voltage clamped for ion currents.
RESULTS
Three novel missense mutations (R67Q, R85W, and T305A) and one known mutation (T75M) were identified in 4/249 (1.6%) patients genotype-negative for other known arrhythmia genes with overall incidence 4/541 (0.74%). They had prominent U-waves, marked ventricular ectopy, and polymorphic ventricular tachycardia but no facial/skeletal abnormalities. Periodic paralysis was present in only one case. Outward current was decreased to less than 5% of WT for all mutants expressed alone. Co-expression with WT (simulating heterozygosity) caused a marked dominant negative effect for T75M and R82W, no dominant negative effect for R67Q, and a novel selective enhancement of inward rectification for T305A.
CONCLUSIONS
KCNJ2 loss of function mutations were found in ~1% of patients referred for genetic arrhythmia testing that lacked criteria for ATS. Characterization of three new mutations identified a novel dominant negative effect selectively reducing outward current for T305A. These results extend the range of clinical phenotype and molecular phenotype associated with KCNJ2 mutations.
Keywords: K-channel, Long QT syndrome, Ion channels, Ventricular Arrhythmia, Gene expression, Gene testing, inward rectification, KIR2.1
Mutations in the KCNJ2-encoded inwardly rectifying potassium channel, Kir2.1, that cause loss of function have been linked to the uncommon clinical phenotype called Andersen Tawil syndrome 1. In 1971, Andersen described an 8-year old with short stature, hypertelorism, broad nasal root, and defect of soft and hard palate 2. The term Andersen Syndrome was first used by Tawil in 1994 in reference to a rare, autosomal dominant disorder consisting of three major features: dysmorphic features (similar to those described by Andersen in 1971), periodic paralysis, and abnormal repolarization3. The repolarization/arrhythmia phenotype included frequent ventricular ectopy, polymorphic ventricular tachycardia (VT), bidirectional VT, and recurrent torsades and also the presence of asymptomatic QT prolongation, perhaps more specifically QU prolongation 4.
KCNJ2 mutations were first reported in patients selected for the classic ATS clinical phenotype1,5,6,7,8. Most studies required 2 out of the 3 features of the classic triad. Early on, however, it was noted that the mutation presented in a very heterogeneous way, with related family members carrying the KCNJ2 mutation displaying only one or none of the classic triad5,7. Do such patients present with a cardiac phenotype alone? To answer this question, a cohort of 541 unrelated patients referred for genetic arrhythmia testing was genotyped for KCNJ2. A second aim of this study was to characterize the molecular function of the mutations found by expressing them in a heterologous cell culture system. Of the four distinct mutations found, three were novel, and one of these (T305A) showed a novel selective dominant negative effect on outward currents, in effect, an enhancement of the inward rectification only when co-expressed with wild type (WT) channels.
Study Cohort
Informed written consent was obtained in accordance with study protocols approved by the Mayo Foundation Institutional Review Board. Between August 1997 and July 2004, 541 consecutive, unrelated patients with a suspected clinical diagnosis of congenital long QT syndrome (LQTS) were referred to Mayo Clinic’s Sudden Death Genomics Laboratory for molecular genetic testing9. See Table 1 for characteristics of the total cohort. Comprehensive mutational analysis of all 60 translated exons of the 5 cardiac channel LQTS-associated genes (LQT1-3, 5–6) and targeted analysis of ANKB-associated LQT4 and RyR2-associated catecholaminergic polymorphic ventricular tachycardia (CPVT) was performed previously9,10,11. The investigation conforms with the principles obtained in the Declaration of Helsinki 12.
Table 1
Table 1
Phenotypic comparison of LQTS gene-positive, LQTS gene-negative, RyR2-positive, and KCNJ2-positive cohorts
KCNJ2 Mutational Analysis
Comprehensive mutational analysis of KCNJ2 was performed using polymerase chain reaction (PCR), denaturing high performance liquid chromatography (DHPLC), and DNA sequencing. DNA amplification of the entire single exon coding region of the KCNJ2 gene was conducted using five overlapping fragments with PCR primers designed using Oligo Primer Analysis Software version 6.63 (Molecular Biology Insights, Inc., Cascade, Colorado) (primers, PCR and DHPLC conditions are available upon request). Control genomic DNA, comprised of 100 healthy white and 100 healthy black subjects, was obtained from the Human Genetic Cell Repository sponsored by the National Institute of General Medical Sciences and the Coriell Institute for Medical Research (Camden, New Jersey).
The investigators constructing KCNJ2 mutations, performing and analyzing cell trafficking and electrophysiological experiments, were blinded to the clinical data until after the experiments were completed and analyzed.
KCNJ2 construction and mutagenesis
Wild-type (WT) human Kir2.1 was isolated from human cardiac cDNA using PCR, forward primer atgggcagtgtgcgaaccaac and reverse primer tcatatctccgactctcgccgtaagg. Sequence integrity was verified with sequence analysis. KCNJ2 mutations were constructed using the Stratagene ExSite site directed mutagenesis kit using the following primers: for R67Q forward agtacctcgcagacatcttca and reverse gttgccccttctcacccac, T75M forward ccatgtgtgtggacattcgct and reverse tgaagatgtctgcgaggtacc, R82W forward gtggtggatgctggttatcttct and reverse cagcgaatgtccacacacgt, T305A forward gctgccatgacgacacagtg and reverse ggcttccaccatttgccttc. WT and mutant DNA was sub-cloned into mammalian expression vector pcDNA3.1 (Invitrogen). The WT and mutant DNA were also sub-cloned into pcDNA3.1-NT-GFP-TOPO vector for sub-cellular localization. All constructs were verified by sequence analysis.
Transfection and cell culture
COS-1 cells were cultured in DMEM (Invitrogen) with 10% FBS. For electrophysiological experiments, cells were transiently transfected using SuperFect method (Qiagen) using 2.5μg of WT and/or mutant KCNJ2 both with green fluorescent protein cDNA in a pRK5 vector (GFP-pRK5, Clonetech, Palo Alto, CA). For fluorescence studies, WT or mutant KCNJ2 DNA in pcDNA3.1-NT-GFP-TOPO were transfected using the SuperFect into COS-1 cells using 2.5μg DNA. After 48 hours, the cells were washed with PBS and fixed with 4% paraformaldehyde at room temperature for 10 min.
Electrophysiological experiments
Patch clamp experiments were carried out 24 hours after transfection using the ruptured patch whole cell technique at room temperature and recorded with an Axopatch 200B amplifier. Borcillica glass pipettes were pulled to resistances of 2–4 MΩ. Cells were identified by GFP fluorescence under fluorescent microscopy (Olympus Optical Corp). Bath solution contained (mM): NaCl 140, KCl 5.4, CaCl2 1.8, MgCl2 0.5, HEPES 5, NaH2PO4 0.33, D-glucose 5.5 and pH adjusted to 7.4. Pipette solution contained (mM): KCl 30, K Aspartate 85, MgCl2 5, KH2PO4 10, K2EGTA 2, K2ATP 2, and HEPES 5 and pH adjusted to 7.2. Control experiments in WT were done contemporaneously with the mutations. From a holding potential of −70mV, voltages were applied from −140 to 40mV in 20mV increments for 100ms. Data were filtered at 10kHz and digitized using a Digidata 1200 (Axon Instruments). Analysis of data was done using pClamp 8 and Origin 6.1.
Imaging
Cells obtained 24 hours after transfection were fixed to coverslips with 4% paraformaldehyde and washed with PBS. The fixed cells were washed again with PBS and the coverslips containing the cells were mounted on slides using a 50% glycerol/50% PBS solution. A Bio-Rad MRC 1024 laser scanning system with 15 mW mixed gas (krypton/argon) laser was utilized to view GFP labeled cells. The Bio-Rad MRC 1024 system was mounted on a Nikon Diaphot 200 inverted microscope. Images of the fluorescent-labeled cells were scanned under a x40 objective with normal speed, x2 zoom. The confocal system was set to 3.6 for iris, laser power at 100%, and camera sensitivity gain to 900. A Kalman collection filter with three frames per image was applied to record the image.
Demographics and clinical presentation
Table 1 summarizes the demographics of the 541 unrelated patients referred for LQTS genetic testing and the frequency of a positive mutational analysis of genes for LQTS1–6, ryanodine receptor gene RYR2 for catecholaminergic polymorphic VT, and KCNJ2. No examples of compound heterozygosity involving KCNJ2 were identified as none of the 292 patients with a previously established LQT1–6 or RYR2-associated mutation hosted a KCNJ2 mutation. Instead, comprehensive open reading frame/splice mutational analysis of KCNJ2 revealed 4 distinct missense mutations (R67Q, T75M, R82W, and T305A) in 4/249 (1.6%) genotype negative patients (Figure 1) for an overall incidence of 0.7% (4/541). Except for T75M, the mutations were novel. Each mutation involved a highly conserved amino acid residue and was absent in 400 reference alleles.
Figure 1
Figure 1
Abnormal KCNJ2 genotypes of 4 patients referred for LQTS testing and a channel diagram showing location of new and previously reported mutations. Examples of the sequencing reaction are shown in the insets along with the predicted amino acid substitution. (more ...)
Table 2 details the genotype-phenotype correlations of the KCNJ2 mutation positive cases including age at diagnosis, presentation, cardiac electrical abnormalities and a history of periodic paralysis or presence of a physical malformation. Briefly, all KCNJ2 harboring individuals were young white females with a normal QTc and a negative family history, two had prominent U waves (Figure 2), two were symptomatic (syncope or palpitations), four displayed ECG abnormalities such as ventricular ectopy, premature ventricular beats, or polymorphic VT (Figure 2), and one had a history of periodic paralysis. Facial/skeletal dysmorphism was unremarkable in all.
Table 2
Table 2
Genotype-phenotype summary of ATS1-associated KCNJ2 mutations
Figure 2
Figure 2
Representative 12-lead electrocardiograms from the four cases. Note prominent U waves, and polymorphic ventricular triplet in Case 2 (T75M).
KCNJ2 mutations caused non-functioning channels in COS-1 cells
The R67Q, T75M, R82W, and T305A KCNJ2 mutations were compared with wild type (WT) in COS-1 cells and analyzed by whole cell patch clamp technique. Representative current traces from WT and two of the mutations (T75M and R82W) expressed singly, or from the mutations each co-expressed with WT are shown in Figure 3. Summary data for the current-voltage relationships are shown in Figure 4A (R67Q, T75M, R82W) and Figure 5 (T305A). WT current expression was robust and exhibited a typical inward rectifier N-shaped curve on the current-voltage plot. In contrast, all of the mutant channels: R67Q, T75M, R82W, and T305A, were non-functional channels, showing no measurable current.
Figure 3
Figure 3
Representative current traces. From a holding potential of −70 mV, step pulses from −140 to 40 mV were applied to the cells in 20 mV increments for 100 ms (see protocol diagram). Zero current level is indicated by the dotted line in each (more ...)
Figure 4
Figure 4
Summary data represented as current voltage plots for WT and mutant KCNJ2 (T75M, R82Q, R67Q) expressed alone (A) or co-expressed with WT (B) to assess for dominant negative interactions. Mutant channels showed no current (A), whereas dominant negative (more ...)
Figure 5
Figure 5
Summary data represented as current voltage plots for WT and mutant KCNJ2 T305A. The mutant expressed alone showed no current. When co-expressed with WT the inward currents were largely preserved suggesting minimal dominant negative suppression, but the (more ...)
Dominant negative effects of mutations when co-expressed with WT
Kir2.1 channels assemble in a tetramer comprised of four separate subunits that could be transcribed from either gene. Individuals with KCNJ2 mutations are heterozygous for the mutation. Therefore, we also analyzed the effect on Kir2.1 current when the WT gene was co-expressed with each of the KCNJ2 mutant alleles. Equal concentrations of mutant and WT DNA (2.5μg) were transfected in COS-1 cells to investigate for dominant negative effects. T75M and R82W both caused a significant (p<.05) dominant-negative type effect on WT current to 37% and 18% respectively of maximal WT inward current at −140mV, and abolished outward current at −40 mV (Figure 4B). T305A caused a smaller dominant negative suppression to 74% of maximal WT inward current at −140mV that did not reach statistical significance (Figure 5), but abolished outward current at −40 mV (Figure 5 inset). Despite the dramatic molecular phenotype when expressed alone, R67Q exerted no apparent dominant negative effect when co-expressed with WT.
N-terminus KCNJ2 mutations demonstrate normal cellular trafficking
COS-1 cells transfected with WT and mutant DNA were analyzed by confocal microscopy. Light and fluorescent microscopy (Figure 6) demonstrated normal cellular trafficking for WT KCNJ2 with a clearly delineated membrane distribution of green fluorescence. Identical patterns were found for R67Q-, T75M-, R82W-, and T305A-KCNJ2 in at least 5 experiments (T305A data not shown).
Figure 6
Figure 6
KCNJ2 mutations exhibit normal trafficking. Representative WT and mutant KCNJ2 DNA transfected into COS-1 cells and analyzed by confocal microscopy. Light microscopy (bottom panels) and fluorescent microscopy (top panels) are shown; the fluorescent images (more ...)
The prevalence of loss of function KCNJ2 mutations in suspected LQT inherited arrhythmia syndromes
We found 4 KCNJ2 mutations (R67Q, T75M, R82W, and T305A), three of them novel, in nearly 2% of LQTS genotype negative subjects who had been referred for genetic arrhythmia testing. None of the subjects had been diagnosed with ATS. No KCNJ2 mutations were detected in patients hosting an established LQT1-6 or RyR2 receptor mutation. Previous studies of KCNJ2 selected patients based on probands exhibiting strong features of Andersen-Tawil syndrome (ATS)1,5,6,7,8. A study of 22 individuals from 11 families derived from a cohort of more than 140 subjects with a diagnosis of periodic paralysis13 found eleven mutations in KCNJ2, five of them novel, including T75M that we found in our cohort as well. All patients from that cohort of periodic paralysis also had dysmorphic features, but only 10/22 had cardiac signs or symptoms and only 4/22 had a long QTc. In a study with a design similar to ours, 188 unrelated patients with clinically suspected LQTS were screened for KCNJ2 mutations and 2 novel loss of function mutations (T75A, 163–164delFQ) were found14. Neither family had dysmorphic features, one family relative had periodic paralysis, and the mean QTc intervals were < 460 ms. Our results from a larger cohort with a similar referral pattern also showed an overall ~2% incidence of KCNJ2 mutations.
Comparison with previous KCNJ2 mutations
To date, 35 unique loss of function mutations (Figure 1) have been described in KCNJ2, and 24 of these have been expressed for voltage clamp data. With this study, these totals come to 38 and 27 respectively. We confirm the previous report13 that T75M shows a dominant negative effect on current, and additionally we show that it traffics normally. This T75M mutation and two of the new mutations (R67Q, R82W) are located at the same amino acid positions as previous mutations in a clustering of previously published N-terminal mutations: R67W, D71V, D71N, T74A, T75R, T75M, D78G, R82Q 7,5,8,15,13. Of note, we could not demonstrate a dominant negative effect for the new mutation R67Q. This is in contrast to a mutation at the same position R67W which showed a dominant negative effect in oocytes5. This lack of suppression or even haploid insufficiency for R67Q makes it difficult to explain how a patient heterozygous for R67Q would have loss of function, but a common caveat is that these mutations are studied in cell culture or oocytes, not the native cardiac muscle environment, where effects may be different. In addition, perhaps environmental influences such as acidosis16 are necessary to bring out the abnormality. Perhaps also this is simply a rare variant and not related to the patient’s arrhythmia. All the mutations reported here traffic normally in the COS cells (Figure 6), as do most KCNJ2 mutations that have been studied. Only four mutations are trafficking defective, two in the M1 region (delta95–9817 and C101R18) and two in the C-terminus (delta 314–315 and V302M)17. Residues in the N- and C- termini are important for PIP2 binding8 which is important for the function of inward rectifier channels19 and this has been proposed as the mechanism for loss of function 8.
A novel molecular phenotype for T305A
The newly described C-terminal mutation, T305A, is interesting in that the dominant negative suppression of outward current was more marked than that of inward current, suggesting a selective effect on the rectification mechanism. This mechanism is distinct from other mutations in the region that have been studied (G300V, V302M, E303K, T309I)7,8,20 which show dominant negative suppression equally of inward and outward currents. Residues in the C-terminus have been implicated in the rectification mechanism21,22. For T305A the effect on rectification involves an interaction of WT and mutant subunits as the mutant alone showed no currents (Figure 5). A full biophysical explanation for this effect requires further study. Clinically, the patient with T305A presented with ventricular ectopy and no other features, whereas patients with other mutations in this region show dysmorphic features20.
Implications for classification
The clinical heterogeneity of KCNJ2 mutation poses some difficulties for classification as well as diagnosis. The common abnormality is a loss of function mutation in the KCNJ2 gene, but up to 40% of patients with clinical features of ATS are KCNJ2 genotype negative23. Therefore, there is anticipated genetic heterogeneity for ATS, and designations as ATS1, ATS2, etc might be reasonable. More recently, mutations in KCNJ2 have been implicated in the pathogenesis of familial atrial fibrillation24 and short QT syndrome25. These, however, are gain-of-function mutations and should cause no confusion with ATS. Recently, we described a loss-of-function KCNJ2 mutation in a cohort referred for evaluation of CPVT 26. Should this be considered a new CPVT mutation (CPVT3) or as a manifestation of ATS1? None of the KCNJ2 positive individuals had a long QT but had rather had prominent U-waves, a feature previously recognized4. This brings to question whether or not ATS or loss of function KCNJ2 mutations should be classified as LQT77. As more studies characterize the range of genotypes, clinical phenotypes, and the mechanistic molecular and cellular phenotypes, a naming consensus may emerge.
Study caveats
The patients studied were from a referral cohort that was based upon the referring physician’s suspicion of inherited arrhythmia of the long QT type, and with a presumed clinical diagnosis of autosomal dominant, Romano-Ward LQTS. While this represents a real world patient selection process, entry into this cohort was not prospectively defined by strict criteria. Also, as mentioned above, the molecular phenotype was determined in heterologous expression system, not in cardiac cells. Since Kir2.1 is a hetero-tetramer and can also combine with Kir2.2 and 2.327, there may be compensation or other effects for these mutant channels. Ultimately, variation in other genes, as well as broader environmental and developmental considerations may be required to fully define the phenotype at both the molecular and the clinical level.
Conclusions
Three novel KCNJ2 arrhythmia mutations are reported and the ionic currents characterized. A novel biophysical mechanism, enhanced inward rectification, was found for T305A. Mutations in KCNJ2 may underlie arrhythmia in a small number of patients lacking criteria for ATS yet suspected of an inherited arrhythmia.
Acknowledgments
LLE and ALF were funded by T32 HL07936 (JCM, PI) “Translational Research Training in Cardiovascular Sciences”. Other support from HL-57414 (JCM) and HD42569 (MJA).
Abbreviations used
ATSAndersen Tawil Syndrome
WTwild-type
LQTSlong QT syndrome
VTventricular tachycardia

Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1. Plaster NM, Tawil R, Tristani-Firouzi M, Canun S, Bendahhou S, Tsunoda A, Donaldson MR, Iannaccone ST, Brunt E, Barohn R, Clark J, Deymeer F, George AL, Fish FA, Hahn A, Nitu A, Ozdemir C, Serdaroglu P, Subramony SH, Wolfe G, Fu YH, Ptacek LJ. Mutations in Kir2.1 cause the developmental and episodic electrical phenotypes of Andersen’s syndrome. Cell. 2001;105:511–519. [PubMed]
2. Andersen ED, Krasilnikoff PA, Overvad H. Intermittent muscular weakness, extrasystoles, and multiple developmental anomalies. A new syndrome? Acta Paediatr Scand. 1971;60:559–564. [PubMed]
3. Tawil R, Ptacek LJ, Pavlakis SG, DeVivo DC, Penn AS, Ozdemir C, Griggs RC. Andersen’s syndrome: potassium-sensitive periodic paralysis, ventricular ectopy, and dysmorphic features. Ann Neurol. 1994;35:326–330. [PubMed]
4. Zhang L, Benson DW, Tristani-Firouzi M, Ptacek LJ, Tawil R, Schwartz PJ, George AL, Horie M, Andelfinger G, Snow GL, Fu YH, Ackerman MJ, Vincent GM. Electrocardiographic features in Andersen-Tawil syndrome patients with KCNJ2 mutations: characteristic T-U-wave patterns predict the KCNJ2 genotype. Circulation. 2005;111:2720–2726. [PubMed]
5. Andelfinger G, Tapper AR, Welch RC, Vanoye CG, George AL, Jr, Benson DW. KCNJ2 mutation results in Andersen syndrome with sex-specific cardiac and skeletal muscle phenotypes. Am J Hum Genet. 2002;71:663–668. [PubMed]
6. Ai T, Fujiwara Y, Tsuji K, Otani H, Nakano S, Kubo Y, Horie M. Novel KCNJ2 mutation in familial periodic paralysis with ventricular dysrhythmia. Circulation. 2002;105:2592–2594. [PubMed]
7. Tristani-Firouzi M, Jensen JL, Donaldson MR, Sansone V, Meola G, Hahn A, Bendahhou S, Kwiecinski H, Fidzianska A, Plaster N, Fu YH, Ptacek LJ, Tawil R. Functional and clinical characterization of KCNJ2 mutations associated with LQT7 (Andersen syndrome) J Clin Invest. 2002;110:381–388. [PMC free article] [PubMed]
8. Donaldson MR, Jensen JL, Tristani-Firouzi M, Tawil R, Bendahhou S, Suarez WA, Cobo AM, Poza JJ, Behr E, Wagstaff J, Szepetowski P, Pereira S, Mozaffar T, Escolar DM, Fu YH, Ptacek LJ. PIP2 binding residues of Kir2.1 are common targets of mutations causing Andersen syndrome. Neurology. 2003;60:1811–1816. [PubMed]
9. Sherman J, Tester DJ, Ackerman MJ. Targeted mutational analysis of ankyrin-B in 541 consecutive, unrelated patients referred for long QT syndrome genetic testing and 200 healthy subjects. Heart Rhythm. 2005;2:1218–1223. [PubMed]
10. Tester DJ, Will ML, Haglund CM, Ackerman MJ. Compendium of cardiac channel mutations in 541 consecutive unrelated patients referred for long QT syndrome genetic testing. Heart Rhythm. 2005;2:507–517. [PubMed]
11. Tester DJ, Kopplin LJ, Will ML, Ackerman MJ. Spectrum and prevalence of cardiac ryanodine receptor (RyR2) mutations in a cohort of unrelated patients referred explicitly for long QT syndrome genetic testing. Heart Rhythm. 2005;2:1099–1105. [PubMed]
12. World Medical Association Declaration of Helsinki. Recommendations guiding physicians in biomedical research involving human subjects. Cardiovasc Res. 1997;35:2–3. [PubMed]
13. Davies NP, Imbrici P, Fialho D, Herd C, Bilsland LG, Weber A, Mueller R, Hilton-Jones D, Ealing J, Boothman BR, Giunti P, Parsons LM, Thomas M, Manzur AY, Jurkat-Rott K, Lehmann-Horn F, Chinnery PF, Rose M, Kullmann DM, Hanna MG. Andersen-Tawil syndrome: new potassium channel mutations and possible phenotypic variation. Neurology. 2005;65:1083–1089. [PubMed]
14. Hosaka Y, Hanawa H, Washizuka T, Chinushi M, Yamashita F, Yoshida T, Komura S, Watanabe H, Aizawa Y. Function, subcellular localization and assembly of a novel mutation of KCNJ2 in Andersen’s syndrome. J Mol Cell Cardiol. 2003;35:409–415. [PubMed]
15. Fodstad H, Swan H, Auberson M, Gautschi I, Loffing J, Schild L, Kontula K. Loss-of-function mutations of the K(+) channel gene KCNJ2 constitute a rare cause of long QT syndrome. J Mol Cell Cardiol. 2004;37:593–602. [PubMed]
16. Plant LD, Bowers PN, Liu Q, Morgan T, Zhang T, State MW, Chen W, Kittles RA, Goldstein SA. A common cardiac sodium channel variant associated with sudden infant death in African Americans, SCN5A S1103Y. J Clin Invest. 2006;116:430–435. [PMC free article] [PubMed]
17. Bendahhou S, Donaldson MR, Plaster NM, Tristani-Firouzi M, Fu YH, Ptacek LJ. Defective potassium channel Kir2.1 trafficking underlies Andersen-Tawil syndrome. J Biol Chem. 2003;278:51779–51785. [PubMed]
18. Ballester LY, Benson DW, Wong B, Law IH, Mathews KD, Vanoye CG, George AL., Jr Trafficking-competent and trafficking-defective KCNJ2 mutations in Andersen syndrome. Hum Mutat. 2006;27:388. [PubMed]
19. Fan Z, Makielski JC. Anionic phospholipids activate ATP-sensitive potassium channels. J Biol Chem. 1997;272:5388–5395. [PubMed]
20. Bendahhou S, Fournier E, Sternberg D, Bassez G, Furby A, Sereni C, Donaldson MR, Larroque MM, Fontaine B, Barhanin J. In vivo and in vitro functional characterization of Andersen’s syndrome mutations. J Physiol. 2005;565:731–741. [PubMed]
21. Lu Z. Mechanism of rectification in inward-rectifier K+ channels. Annu Rev Physiol. 2004;66:103–129. [PubMed]
22. Pegan S, Arrabit C, Zhou W, Kwiatkowski W, Collins A, Slesinger PA, Choe S. Cytoplasmic domain structures of Kir2.1 and Kir3.1 show sites for modulating gating and rectification. Nat Neurosci. 2005;8:279–287. [PubMed]
23. Donaldson MR, Yoon G, Fu YH, Ptacek LJ. Andersen-Tawil syndrome: a model of clinical variability, pleiotropy, and genetic heterogeneity. Ann Med. 2004;36 (Suppl 1):92–97. [PubMed]
24. Xia M, Jin Q, Bendahhou S, He Y, Larroque MM, Chen Y, Zhou Q, Yang Y, Liu Y, Liu B, Zhu Q, Zhou Y, Lin J, Liang B, Li L, Dong X, Pan Z, Wang R, Wan H, Qiu W, Xu W, Eurlings P, Barhanin J, Chen Y. A Kir2.1 gain-of-function mutation underlies familial atrial fibrillation. Biochem Biophys Res Commun. 2005;332:1012–1019. [PubMed]
25. Priori SG, Pandit SV, Rivolta I, Berenfeld O, Ronchetti E, Dhamoon A, Napolitano C, Anumonwo J, di Barletta MR, Gudapakkam S, Bosi G, Stramba-Badiale M, Jalife J. A novel form of short QT syndrome (SQT3) is caused by a mutation in the KCNJ2 gene. Circ Res. 2005;96:800–807. [PubMed]
26. Tester DJ, Arya P, Will M, Haglund CM, Farley AL, Makielski JC, Ackerman MJ. Genotypic heterogeneity and phenotypic mimicry among unrelated patients referred for catecholaminergic polymorphic ventricular tachycardia genetic testing. Heart Rhythm. 2006;3:800–805. [PubMed]
27. Zaritsky JJ, Redell JB, Tempel BL, Schwarz TL. The consequences of disrupting cardiac inwardly rectifying K(+) current (I(K1)) as revealed by the targeted deletion of the murine Kir2.1 and Kir2.2 genes. J Physiol. 2001;533:697–710. [PubMed]