PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Lipids. Author manuscript; available in PMC 2007 April 5.
Published in final edited form as:
PMCID: PMC1847747
NIHMSID: NIHMS11851
Synthetic Lethal Interactions Involving Loss of the Yeast ERG24- the Sterol C-14 Reductase Gene.
M. Shah Alam Bhuiyan,1 James Eckstein,2 Robert Barbuch,2 and Martin Bard1*
1Indiana University-Purdue University Indianapolis, Biology Department, 723 West Michigan Street, Indianapolis, IN 46202.
2Department of Drug Disposition, Eli Lilly & Co., Lilly Corporate Center, Indianapolis, Indiana 46285
*Corresponding author. Mailing address: Martin Bard, IUPUI, Biology Department, 723 West Michigan Street, Indianapolis, IN 46202. e-mail: mbard/at/iupui.edu
ERG2 and ERG24 are yeast sterol biosynthetic genes and are targets of the morpholine antifungals. ERG2 and ERG24 encode the C-8 sterol isomerase and the C-14 reductase, respectively. ERG2 is considered a non-essential gene but the viability of ERG24 is dependent upon genetic background, type of medium, and CaCl2 concentration. We demonstrate that erg2 and erg24 mutants are viable in the deletion consortium background but are lethal when combined into the same haploid strain. The erg2erg24 double mutant can be suppressed by mutations in the sphingolipid gene ELO3 but not ELO2. However, suppression occurs on rich but not on synthetic complete medium. We also demonstrate that the suppressed elo3erg2erg24 does not show a sterol composition markedly different from erg24. Further genetic analysis indicates that erg24 when combined with mutations in erg6 or erg28 are synthetically lethal but when combined with mutations in erg3 are weakly viable. These results suggest that novel sterol intermediates likely contribute to the synthetic lethality observed in this investigation.
The synthesis of lanosterol is the first committed step in yeast sterol biosynthesis. The yeast ERG24 gene encodes the C-14 reductase required to complete C-14 demethylation of lanosterol. This gene was cloned and disrupted by several investigators who demonstrated that the C-14 reductase enzyme is essential for viability (1,2). Originally, erg24 mutants were found to be lethal in wildtype genetic backgrounds but viable in genetic backgrounds containing mutations in elo2/fen1 (1, 2). Mutations in the ELO2/FEN1 (3) gene result in resistance to the morpholine, fenpropimorph (1,2). The morpholines inhibit both the C-8 isomerase and the C-14 reductase encoded by ERG2 and ERG24, respectively (4,5) possibly indicating a common target site on the two enzymes or an uncharacterized protein-protein interaction between them. However, resistance to fenpropimorph due to a mutation in FEN1 results in tolerance to the accumulation of the sterol intermediate, ergosta-8,14-dienol. Lorenz and Parks were able to construct a deletion mutation in the ERG24 gene that was viable only in a fen1 background (1). Similarly, Ladeveze et al. also demonstrated that ERG24 mutants were viable in a fen1 background (6). Subsequent work by Baudry et al. demonstrated that erg24 mutants were also suppressed by mutations in elo3/sur4 (7). ELO2/FEN1 and ELO3/SUR4 encode enzymes that are involved in sphingolipid synthesis and are components of a fatty acid elongation system that elongates C16/C18 to C24/C26 (3). Further analyses indicated that erg24 mutants could be grown in some genetic backgrounds (wildtype for ELO2 and ELO3) on synthetic complete or rich medium containing Ca+2 or Mg+2 (8,9). Thus the replacement of ergosterol by ergosta-8,14-dienol is not lethal in itself but requires an adequate level of these ions. Even though both the C-8 isomerase and C-14 reductase enzymatic reactions are sensitive to the morpholine antifungals, overexpression of the non-essential gene, ERG2 does not lead to fenpropimorph resistance whereas overexpression of the essential gene, ERG24 does (10). While erg2 mutants have been generally isolated as non-essential in various genetic backgrounds, a single erg2 mutant isolate in a FL100 wildtype genetic background was demonstrated to be lethal but suppressible by mutations in either the ELO2 or ELO3 gene (11, 3).
Previously, we demonstrated that ERG24 is an essential gene in a wildtype Y294 genetic background (10) but the erg24 mutant strain produced by the deletion consortium project using the S288C wildtype genetic background clearly indicates that viable erg24 mutants can occur in genetic backgrounds not containing the ELO2 or ELO3 mutations. In this study we demonstrate the various synthetic lethal interactions that can occur with an erg24 strain derived from the deletion consortium genetic (S288C) background.
Strains, media, and growth conditions.
Yeast strains used in this study are derived from W303; SCY325 strain (MATα, ade2-1, his3-11,15, leu2-3,112, trp1-1, ura-3-1) and SCY328 (MATa, ade2-1, his3-11,15, leu2-3,112, trp1-1, ura-3-1) are wildtype laboratory strains and were used to generate all ergosterol mutant strains other than erg24. The erg24 strain was obtained from the deletion consortium (12) and the construction of other ergosterol deletion strains erg2, erg3, erg4, erg5, erg6, and erg28 were as published previously (13). The deletion mutant strains elo2 and elo3 were generated by homologous recombination with PCR products (14) from plasmid containing selectable marker genes (15) and oligonucleotides containing gene specific sequences. The elo2 and elo3 strains derived in the W303 background were isolated as elo2::TRP1 and elo3::TRP1 disruptions using the forward and reverse primers (ELO2fwd: 5’-ATGAATTCACTCGTTACTCAATATGCTGCTCCGTTGTTCGAGCGTTATCCCCAACTTCATTGGCGGGTGTCGGGGCTGGC -3′ and ELO2rev: 5′-TAGGAACGTTTTTCAAGTCAACGTTAACATACTCATTAACCTTTGCGGGAACACCGCCGTTTGCCGATTTCGGCCTATTG -3′ for elo3::TRP1 and ELO3fwd: 5′-AGCTTACTTCTAGTTTATTTATTCGGCTTTTTTCCGTTTGTTTACGAAACATAAACAGTCGGCGGGTGTCGGGGCTGGC-3′ and ELO3rev: 5′-TAAGCAGCAGCAGCCTGAGTACCATAACAAGTACCCTTGTTTGGTAAAATACCGTCCAAGTTGCCGATTTCGGCCTATT G-3′ for elo3::TRP1). Verification of the deletion was performed by PCR analysis using checking primers. Gene specific oligonucleotides were obtained from Invitrogen. Disruptions containing the kanamycin (G418) resistance marker were obtained from deletion consortium or isolated as segregants from different crosses. Yeast strains were grown in either YPAD (1% yeast extract, 2% bacto-peptone, 2% glucose, and .012% adenine sulfate) or in synthetic complete media (CSM) containing 0.67% yeast nitrogen base (Difco) supplemented with appropriate amino acids. Additional uracil, (.004%), leucine (.02%), histidine (.004%), and tryptophan (.01%) were supplemented when required. CSM lacking specific nutrients was used for selection of various marker genes. Ergosterol, when used, was added to autoclaved media at 20 μg/ml to rescue synthetically lethal double mutant strains. For anaerobic growth, anaerobic jars containing the GasPaks system (BBL Microbiology System) were used. Sporulation media has been described previously (14). All solid media for growth of yeast contained 2% Bacto Agar (Difco).
Genetic methods
Mating, sporulation, and genetic dissections to obtain double and triple mutants were as described previously (14). Crosses and asci dissections of the four-spore meiotic products were done on YPAD solid media supplemented with 20μg/ml ergosterol in a Tween 80/ethanol (1:1v/v) solution and grown anaerobically. Briefly, diploids grown on YPAD medium were transferred to a 1% potassium acetate medium to induce sporulation. After a 1 hr treatment with glusulase (Perkin Elmer Life science), the four spored-asci were dissected under a microscope using a micromanipulator. All meiotic segregants were analyzed by replica plating on YPAD and CSM plates with and without ergosterol for synthetic lethal screening and the genotype confirmed by genetic markers.
Sterol analysis
Sterols were isolated as described previously (16). Briefly, cells were grown for 20-24 hrs in YPAD liquid or solid media containing 20 μg/ml of cholesterol. Cells were pelleted, washed twice with Igepal (1%), and twice with distilled H20, saponified with alcoholic KOH and extracted in n-heptane. Sterols were preliminarily analyzed by gas chromatography (GC) with a Hewlett-Packard HP5890 series II chromatograph equipped with the HP CHEMSTATION software package. The DB-5 capillary column (15 m × 0.25 mm × 0.25 μm film thickness) with nitrogen as carrier gas (30 cm/sec) was programmed from 195° to 300°C (3 min at 195°C and then an increase at 5.5°C/min to 300°C and then held for 10 min). All injections were run in the splitless mode with an inlet temperature of 280°C. In order to identify novel sterols, gas-chromatography mass-spectrometry (GC-MS) analyses was also performed using a HP5890 GC coupled to a HP5972 mass selective detector. The GC separations were done on a fused silica column (DB-5 15 m × 0.32 mm × 0.25 m film thickness), programmed from 40°C to 300°C (40°C for 1 min, 30°C/min to 300°C and then held for 4 min). Helium was the carrier gas with a linear velocity of 50 cm/sec in the splitless mode. Mass spectra were generated in the electron impact mode at electron energy of 70 eV and an ion source temperature of 150°C. The instrument was programmed to scan from 40 to 700 amu at 1-s intervals.
Synthetic lethality of erg2erg24
The observations that both erg2 and erg24 mutants could be suppressed by elo2 or elo3 mutations and the further observation that erg24 was lethal in some genetic backgrounds but not in others led us to ask whether the erg2erg24 double mutant strain was viable. The erg2erg24 double mutant was obtained by mating viable erg2 and erg24 haploid strains to produce diploid heterozygotes; diploids were sporulated, and the four-spored asci were dissected on rich medium containing ergosterol (or cholesterol) and grown anaerobically. From a total of 100 tetrads, 83 erg2erg24 double mutants were obtained all of which could grow anaerobically with sterol supplement but failed to grow aerobically without sterol supplement (table 1). In fig. 1, wildtype, erg2, erg24, and erg2erg24 strains were plated on both aerobic YPAD rich medium and synthetic complete medium (CSM). On YPAD medium, erg24 strains grew but growth was diminished at lower inocula; on YPAD medium, erg2erg24 growth was completely absent. However, on CSM medium both erg2 and erg24 strains grew normally but the erg2erg24 strain demonstrated minimal growth indicating that it is not synthetically lethal on this medium. In the presence of ergosterol (which requires anaerobic growth conditions for sterol uptake) all four strains grew equally well. On YPAD or CSM media supplemented with 10 or 20 mM CaCl2, the growth responses were the same as without calcium. Results with 20mM CaCl2 (not shown) were exactly the same as for 10mM CaCl2 (fig. 1).
Table 1
Table 1
Genetic analysis to determine synthetic lethality of erg24 double mutants in YPAD medium.
Fig.1
Fig.1
Synthetically lethality of the erg2erg24 double mutant strain. Cells were serially diluted and 105 to 102 cells were sequentially spotted onto YPAD (upper panels) or CSM (lower panels) media with or without ergosterol or with 10 mM CaCl2 to compare the (more ...)
Suppression of erg2erg24
Mutations in ELO2 and ELO3 are known suppressors of erg2 or erg24 mutants (6,7). We generated elo2erg2erg24 and elo3erg2erg24 triple mutant strains to determine whether either or both suppressed lethality of the erg2erg24 strain. Fig. 2 demonstrates that only elo3 suppressed erg2erg24 lethality on YPAD medium as indicated by growth on this medium without ergosterol. However, on CSM medium neither elo2 or elo3 was found to be an efficient suppressor as there was only small residual growth on this medium without ergosterol. Again, CaCl2 supplementation in YPAD or CSM media did not rescue the synthetic lethality of erg2erg24.
Fig.2
Fig.2
The mutation elo3 but not the elo2 mutation suppresses the erg2erg24 double mutant. The growth response of strains elo2, erg2erg24elo2, elo3, and erg2erg24elo3 was compared by spotting serial dilutions of 105 to 102 cells of each strain onto YPAD (upper (more ...)
Sterol analysis of erg2erg24 and erg2erg24elo3
We proceeded to determine the sterol composition of each of these strains to assess whether a sterol composition difference could be attributable to the suppressed erg2erg24elo3 strain. Table 2 indicates the sterol composition of the wildtype, elo3, erg2, erg24, erg2erg24, erg2elo3, erg24elol3, and the suppressed erg2erg24elo3 strains grown in YPAD media under aerobic conditions. Identification of sterols was based on molecular ions and key fragment ions as well as comparison to standard sterol spectra and relative retention times (Table 3). The erg2erg24 strain was grown anaerobically in the presence of cholesterol. There was essentially no difference in sterol profiles between the wildtype and elo3strains. The erg2erg24 strain accumulated ergosta-8,14-diene sterols as well as squalene, lanosterol, and the cholesterol which was provided in the growth medium. Sterol profiles from erg24 and erg2erg24elo3 strains were also similar in that 94% and 99% of the sterols accumulated in these two strains were ergosta-8,14, or cholesta-8,14 sterols, respectively, suggesting that the major effect of elo3 suppression did not involve an alteration of sterols. For the most part, erg2elo3 and erg24elo3 reflected the sterol compositions of erg2 and erg24, respectively.
Table 2
Table 2
Sterol analyses of erg2erg24, erg2erg24elo3, and related strains
Table 3
Table 3
GC/MS data for erg2erg24, erg2erg24elo3, and related strains
Synthetic lethality of erg24 in combination with other ergosterol biosynthetic mutants.
It was of interest to ascertain whether other ergosterol mutations such as erg3, erg4, erg5, erg6, and erg28 would be synthetically lethal in combination with the erg24 mutation. ERG3 encodes the C-5 desaturase, ERG4 encodes the C-24 reductase, ERG5 encodes the C-22 desaturase, ERG6 encodes the C-24 transmethylase; mutations in these genes are viable (fig. 3B). ERG28 encodes a scaffold protein required for complete C-4 demethylation and it, too, is non-essential for growth. We crossed all single mutants with the erg24 strain to generate the haploid double mutants. All tetrads were dissected and grown anaerobically with ergosterol and then grown aerobically without ergosterol to assess viability (fig.3). Genetic analyses (table 1) and spot-plating (fig.3) on YPAD medium demonstrated that the double mutant erg4erg24 and erg5erg24 were viable but the erg6erg24 and erg28erg24 double mutants were not. However, the erg3erg24 double mutants was only weakly viable. The addition of CaCl2 had a growth enhancing effect on erg5erg24 on YPAD medium but not on CSM medium; on CSM medium, CaCl2 also had a growth enhancing effect on erg6erg24 and erg28erg24. Finally, elo3 failed to suppress erg6erg24 or erg28erg24 on YPAD or CSM media (data not shown). The observation that elo3 did not suppress erg6erg24 is expected as Eisenkolb et al. (17) demonstrated that the double mutant elo3erg6 is synthetically lethal.
Fig.3
Fig.3
An erg24 mutation is synthetically lethal with erg6 or erg28 but not with erg3, erg4, or erg5. (A) Growth of the erg24 mutant in combination with additional mutations in the ergosterol biosynthetic pathway-erg3, erg4, erg5, erg6, and erg28. Cells from (more ...)
The genes in the latter part of the yeast ergosterol pathway comprised of ERG6, ERG2, ERG3, ERG4, and ERG5 are considered non-essential because the sterols produced by mutations of these genes function nearly as well as ergosterol and meet the biophysical and biochemical requirements of a sterol molecule. However, mutations in ERG24 are lethal in some genetic backgrounds but not others.
The results presented here extend initial observations that the viability of erg24 is dependent on factors such as type of media, metal ion concentrations, and strain background. Studies in Parks’ lab (8,9) indicated that erg24 could not grow on a rich media (YPAD) but could grow on a synthetic complete media due to a greater abundance of Ca+2 in the latter. Addition of Ca+2 to rich medium restored growth. Our studies confirm some of these findings but differ in that the deletion consortium erg24 strain is viable on YPAD medium but growth is not enhanced with the addition of Ca+2 (fig.1). However growth is enhanced on CSM medium. The combination of erg2 and erg24, however, resulted in lethality on YPAD medium that was not rescued by Ca+2 supplementation. Growth of the erg2erg24 strain was marginal on synthetic complete medium. Suppression of this lethality was obtained by introducing a third mutation, elo3. The elo3 mutation was previously found to individually suppress lethal isolates of erg2 and erg24. However, while elo3 was able to restore growth of the erg2erg24 strain on YPAD medium, it failed to restore growth on CSM medium (fig. 2). Surprisingly elo2 failed to suppress the lethality of erg2erg24 on any media, even media containing Ca+2 supplementation.
We next asked the question whether other ergosterol mutants were lethal in combination with erg24 and the results indicated that erg6erg24 and erg28erg24 were also inviable on rich YPAD medium and this lack of growth was not suppressed by Ca+2 supplementation. The double mutant erg3erg24 grew poorly and only erg4erg24 and to a lesser extent erg5erg24was clearly growing on YPAD. However, on synthetic complete medium, we observed slightly better growth in the presence of Ca+2 (fig.3). All double mutants grew at least to some degree in synthetic complete medium if Ca+2 was added to the medium.
Crowley et al. (9) demonstrated that the concentration of Ca+2 was greater in a synthetic complete than on rich YPD medium and that increased Ca+2 resulted in resistance to fenpropimorph suggesting that Ca+2 enhances membrane integrity in strains in which ergosterol is replaced by ergosta-8,14 sterol intermediates. It is not obvious why erg2erg24 mutants are more compromised than erg24 alone since erg24 mutants are epistatic to erg2 and thus accumulate only C-8 sterols. Thus, in an erg24 strain there is no evidence of Erg2p activity as all accumulated sterols are C-8-sterols. Further work will determine whether there is a regulatory sterol defect that must be taken into consideration. However, in considering the synthetically lethality of erg6erg24 and erg28erg24 strains, each individual mutation should contribute to an altered sterol profile and thus may help to explain why the double mutants in these cases are lethal.
ACKNOWLEDGEMENTS
This work was supported by a NIH grant GM62104 to M.B.
Footnotes
Abbreviations:
CSMsynthetic complete media
GCgas chromatography
PCRpolymerase chain reaction
YPADyeast extract, peptone, adenine, dextrose

1. Lorenz RT, Parks LW. Cloning, Sequencing, and Disruption of the Gene Encoding Sterol C-14 Reductase in Saccharomyces cerevisiae. DNA Cell Biol. 1992;11:685–692. [PubMed]
2. Marcireau C, Guyonnet D, Karst F. Construction and Growth Properties of a Yeast Strain Defective in Sterol 14-Reductase. Curr. Genet. 1992;22:267–272. [PubMed]
3. Oh CS, Toke DA, Mandala S, Martin CE. ELO2 and ELO3, Homologues of the Saccharomyces Cerevisiae ELO1 Gene, Function in Fatty Acid Elongation and Are Required for Sphingolipid Formation. J. Biol. Chem. 1997;272:17376–17384. [PubMed]
4. Mercer EI. Inhibitors of Sterol Biosynthesis and Their Applications. Prog. Lipid Res. 1993;32:357–416. [PubMed]
5. Baloch RI, Mercer EI. Inhibition of Sterol Δ87 Isomerase and Δ14 Reductase by Fenpropiomorph, Tridemorph, and Fenpropidin in Cell-free Enzyme Systems from Saccharomyces cerevisiae. Phytochem. 1987;26:663–668.
6. Ladeveze V, Marcireau C, Delourme D, Karst F. General Resistance to Sterol Biosynthesis Inhibitors in Saccharomyces cerevisiae. Lipids. 1993;28:907–912. [PubMed]
7. Baudry K, Swain E, Rahier A, Germann M, Batta A, Rondet S, Mandala S, Henry K, Tint GS, Edlind T, Kurtz M, Nickels JT. The Effect of the Erg26-1 Mutation on the Regulation of Lipid Metabolism in Saccharomyces cerevisiae. J. Biol. Chem. 2001;276:12702–12711. [PubMed]
8. Crowley JH, Smith SJ, Leak FW, Parks LW. Aerobic Isolation of an ERG24 Null Mutant of Saccharomyces cerevisiae. J. Bacteriol. 1996;178:2991–2993. [PMC free article] [PubMed]
9. Crowley JH, Tove S, Parks LW. A Calcium-Dependent Ergosterol Mutant of Saccharomyces cerevisiae. Curr. Genet. 1998;34:93–99. [PubMed]
10. Lai MH, Bard M, Pierson CA, Alexander JF, Goebl M, Carter GT, Kirsch DR. The Identification of a Gene Family in the Saccharomyces Cerevisiae Ergosterol Biosynthesis Pathway. Gene. 1994;11:41–49. [PubMed]
11. Silve S, Leplatois P, Josse A, Dupuy PH, Lanau C, Kaghad M, Dhers C, Picard C, Rahier A, Taton M, Le Fur G, Caput D, Ferrara P, Loison G. The Immunosuppressant SR 31747 Blocks Cell Proliferation by Inhibiting a Steroid Isomerase in Saccharomyces cerevisiae. Mol. Cell. Biol. 1996;16:2719–2727. [PMC free article] [PubMed]
12. Winzeler EA, et al. Functional Characterization of the S. Cerevisiae Genome by Gene Deletion and Parallel Analysis. Science. 1999;6:901–906. [PubMed]
13. Valachovic M, Bareither BM, Bhuiyan MSA, Eckstein J, Barbuch R, Balderes D, Wilcox L, Sturley SL, Dickson RC, Bard M. Cumulative Mutations Affecting Sterol Biosynthesis In The Yeast Saccharomyces cerevisiae Result In Synthetic Lethality That Is Suppressed By Alterations In Sphingolipid Profiles. Genetics. 2006 In Press.
14. Adams A, Gottschling DE, Kaiser CA, Stearns T. Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press; New York, N.Y: 1997.
15. Sikorski RS, Hieter P. A System Of Shuttle Vectors and Yeast Host Strains Designed for Efficient Manipulation Of DNA In Saccharomyces cerevisiae. Genetics. 1989;122:19–27. [PubMed]
16. Gachotte D, Sen SE, Eckstein J, Barbuch R, Krieger M, Ray BD, Bard M. Characterization of the Saccharomyces cerevisiae ERG27 Gene Encoding the 3-Keto Reductase Involved in C-4 Sterol Demethylation. Proc Natl Acad Sci USA. 1999;26:12655–12660. [PubMed]
17. Eisenkolb M, Zenzmaier C, Leitner E, Schneiter R. A specific structural requirement for ergosterol in long-chain fatty acid synthesis mutants important for maintaining raft domains in yeast. Mol Biol Cell. 13:4414–4428. [PMC free article] [PubMed]