Search tips
Search criteria 


Logo of neoplasiaGuide for AuthorsAbout this journalExplore this journalNeoplasia (New York, N.Y.)
Neoplasia. 2006 November; 8(11): 933–938.
PMCID: PMC1716012

Immune Escape for Renal Cell Carcinoma: CD70 Mediates Apoptosis in Lymphocytes1,2


Tumors can escape immune recognition and destruction through the induction of apoptosis in lymphocytes. Although renal cell carcinoma (RCC) is able to prevent immune recognition, only a few genes (such as FasL) that are relevant for RCC immune escape have been identified so far. We have previously shown that some apoptosis-inducing genes are overexpressed in RCC. We hypothesized that these genes could be part of the immune-escape strategy of these tumors. Here we report that CD70, a cytokine overexpressed in RCC, promotes lymphocyte apoptosis through interaction with its receptor CD27 and with the intracellular receptor-binding protein SIVA. Apoptosis increased after cocultivating lymphocytes with the RCC cell lines A498 and CAKI2. The addition of recombinant soluble CD70 to both native lymphocytes and a T-cell cell line resulted in increased lymphocyte apoptosis as well. Furthermore, induced apoptosis could be partially blocked with anti-CD27 and anti-CD70 antibodies. Our results strongly indicate a role for CD70 and CD27 receptor in lymphocyte apoptosis within the tumor environment. Apoptosis mediated by exposure to the CD70 secreted by tumor cells may contribute to the failure of RCC patients to develop an effective lymphocyte-mediated antitumor response.

Keywords: Kidney, TNFSF7, CD27, SIVA, immune suppression


Despite the presence of lymphocytes in tumors, solid tumors successfully escape immune recognition. Clearly, an effective immune response can fail to develop in vivo. This has been further elucidated by studies showing that the tumor microenvironment has a deleterious effect on tumor-infiltrating lymphocytes (TILs) [1]. It has been suggested that tumor cells produce proteins that can induce apoptosis to prevent recognition by TILs. Even though renal cell carcinoma (RCC) is considered to be immune-suppressive and TILs have been reported, only a few possibly involved genes have been identified so far [2]. In gene expression studies of RCC, we have previously shown an upregulation of several immune-regulatory molecules, including TNFRSF10B, CD70, TNFR1, PDGFRB, and BAFF, that are capable of inducing apoptosis [3]. In the present study, we focused on the potential of the surface marker CD70 to induce apoptosis in lymphocytes. It is a member of the tumor necrosis factor ligand superfamily 7. In a previous study, we have identified this gene to be specifically overexpressed in clear cell RCC [4]. The upregulation of CD70 in RCC is particularly interesting because, in a previous study, we found hints on its possible involvement in immune-regulatory processes in RCC [5], and there is evidence for its immune-regulatory function in glioblastoma [6].

CD70 is the only known ligand for its receptor CD27, and both belong to the tumor necrosis factor receptor superfamily 7. It is known that receptor activation can lead to proliferation, as well as to apoptosis [6,7]. Interestingly, apoptosis can only be induced in the presence of the intracellular receptor-binding protein SIVA. This protein substitutes for the missing death domain of the CD27 receptor and mediates caspase activation [8].

To test whether CD70 upregulation in RCC has lymphocyte cytotoxic function, we performed coculture experiments using RCC cell lines and native lymphocytes or a T-cell cell line. We show that CD70 expressed by RCC cell lines, as well as rmsCD70, can induce lymphocyte apoptosis through interaction with its receptor CD27. This finding points to a so-far-unknown mechanism for RCC to escape immune recognition.

Materials and Methods

Established Cell Lines and Tissue Culture Conditions

Three RCC cell lines A498, CAKI1, and CAKI2 were maintained in RPMI 1640 (A498; Invitrogen, Carlsbad, CA) or DMEM (CAKI1 and CAKI2; Invitrogen) supplemented with 10% fetal bovine serum (FBS; Serum Med; Biochrom AG, Berlin, Germany). The T-cell line MOLT4 (American Type Culture Collection, Manassas, VA) was maintained in complete RPMI 1640 (Invitrogen) supplemented with 10% FBS. All cell lines were cultured at 37°C and 5% CO2.

Lymphocyte Isolation

Lymphocytes were isolated from the peripheral blood of healthy persons using a lymphocyte separation medium (PAA Laboratories GmbH, Pasching, Austria). Stimulation of lymphocytes was carried out by adding 12 µg/ml phytohemagglutinin A (Biochrom AG). Lymphocytes were cultivated for 72 hours in complete RPMI 1640 (Invitrogen) supplemented with 10% FBS at 37°C and 5% CO2 before adding 50 ng/ml rmsCD70 (Alexsis Biochemicals, Carlsbad, CA) to the cell culture.

Expression of CD70, CD27, and SIVA

We assessed CD70 and CD27 expression in cell lines using real-time polymerase chain reaction (PCR). Using the commercially available RNeasy Kit (Qiagen, Valencia, CA), total RNA isolation was performed according to the manufacturer's instructions. Using SuperScriptII reverse transcriptase (Invitrogen), RNA (2 µg) was reverse-transcribed with 100 µM random hexamer primers according to the manufacturer's protocol. Using a commercially available master mix containing HotStartTaq DNA polymerase and SYBR Green I deoxyribonucleoside triphosphates (QuantiTect SYBR Green PCR Kit; Qiagen), real-time reverse transcription (RT) PCR was performed with a LightCycler (Roche Molecular Biochemicals, Mannheim, Germany) in capillaries. The following real-time PCR protocol was used for all genes: initial 95°C denaturation phase of 15 minutes to activate the HotStart enzyme, followed by 45 rounds of amplification and quantification (15 seconds at 95°C; 10 seconds at 55°C; 30 seconds at 72°C), each with a single fluorescence measurement. The specificity of desired RT-PCR products was documented using gel electrophoresis and melting curve analysis (LightCyler Software Version 3.5, 2001; Roche Molecular Biochemicals). Primers were designed for the CD70 gene (3′-5′: AATCACACAGGACCTCAGCAGGACC; 5′3′: AGCAGATGGCCAGCGTCACC). For the genes CD27, SIVA, and ILRAP1 (reference gene), QuantiTect Primer Assay (Qiagen) was used. Product-specific melting curves showed only single peaks and no primer dimer peaks or artifacts. The “Delta Delta CT method” was applied to compare relative expression results in real-time PCR [9].

Immunohistochemistry (IHC)

Using DAKO Kit 5005 (DAKO, Glostrup, Denmark), IHC was performed on an RCC cell monolayer in a 96-well plate according to the manufacturer's instruction. In short, the cell monolayer was fixed in acetone and washed with Tris buffer/Tween [0.1% wt/vol Tween (TBS-T)]. Slides were overlaid with 0.1% avidin and 0.01% biotin. Biotin blocking was performed using the biotin blocking system from DAKO. After washing with TBS-T twice, protein blocking was carried out using a blocking solution containing goat serum in TBS, RPMI 1640, and sodium azide. Slides were washed and incubated with TBS-T. The primary antibody-antigen reaction was performed with antibody against CD70 (1:250 dilution; Ancell, Bayport, MN), CD27 (1:250 dilution; Ancell), and SIVA (1:200 dilution; Abnova, Taipei City, Taiwan) overnight at 4°C to 8°C. After washing with TBS-T, slides were incubated with biotin-coupled secondary antibody (DAKO Kit 5005) according to the manufacturer's instructions. Slides were washed with TBS-T, and avidin-alkaline phosphatase (DAKO Kit 5005) solution was added. After washing with TBS-T, enzyme reaction was carried out by adding a substrate solution (DAKO Kit 5005). Slides were washed with water. Finally, cells were stained with Hemalaun solution.

Analysis of Lymphocyte Apoptosis

MOLT4 cells were resuspended at a concentration of 1 x 106 cells/ml in PBS (Invitrogen) before being added to flasks containing an RCC cell monolayer at a 1.5:1 tumor cell/lymphocyte ratio. The cells were cocultivated in FBS-free medium for 3 hours. Floating lymphocytes were removed from RCC monolayers and assessed for apoptosis using APO-One Homogeneous Caspase-3/7 Assay (Promega, Madison, WI) according to the manufacturer's directions. Blocking experiments were performed by adding mouse monoclonal anti-human CD70 or mouse monoclonal anti-human CD27 antibodies (both from Ancell) when T cells were incubated with RCC monolayers. Both were used at a dilution of 5 µg/ml. The isotype control for CD70 antibody was purified mouse immunoglobulin G1 (Ancell). RmsCD70 was added to 1 x 106 cells/ml MOLT4 cells and native lymphocytes at a concentration of 50 ng/ml. The cells were cultivated in FBS-free medium for 3 hours before the performance of APO-One assay (Promega).


RCC Cell Lines Express CD70 Ligand But Not CD70 Receptor

To test whether RCC cell lines express the components required for CD70-initiated apoptosis, CD70, SIVA, and CD27 expression levels were analyzed using quantitative PCR (qPCR) and IHC.

All RCC cell lines tested through qPCR expressed the CD70 ligand, although only a negligible expression was found in the CAKI1 cell line (Table 1). In contrast, the A498 cell line showed a very prominent induction of CD70 compared to normal renal tissues. Experiments were performed in duplicate, and deviation within the standard error lies between 0.007% and 0.14%.

Table 1
Expression Ratios of CD70 and SIVA in Cell Lines Used, as Determined by qPCR.

In comparison to MOLT4 cells, the RCC cell lines A498 and CAKI2 showed less expression of SIVA (Table 1). These experiments were performed in duplicate, and the standard error lay between 0.01% and 0.27%. Additionally, expression of CD70, CD27, and SIVA in native lymphocytes was compared to that of MOLT4 T cells by qPCR (Table 2). A higher expression level for all three genes was found in native lymphocytes (Table 2). These experiments were performed in duplicate, and the standard error lay between 0.05% and 0.23%.

Table 2
Expression Ratios of CD70, CD27, and SIVA in Native Lymphocytes Versus Permanent MOLT4 T Cells, as Determined by qPCR.

Confirmation with IHC at the protein level showed a clear signal for CD70 in the cell line A498. In both cell lines CAKI2 and CAKI1, signals could also be detected even though staining was more heterogeneous than that of A498 cells (Figure 1). In contrast, staining for CD27 resulted in only weak signals in all three cell lines (Figure 1). For SIVA, a clear signal could be detected in A498 cells, whereas CAKI1 and CAKI2 cells showed weaker signals (Figure 1).

Figure 1
Immunostaining for CD70, CD27, and SIVA on adherent growing cell lines. (A.1) Cell line A498 stained against CD70 (original magnification, x200). (A.2) Cell line A498 stained against CD27 (original magnification, x200). (A.3) Cell line A498 stained against ...

RCC Cells Induce Apoptosis in MOLT-4 T Cells

The RCC cell lines CAKI1, CAKI2, and A498 were cocultured with MOLT-4 T cells for 3 hours. Apoptosis was assessed in T cells with caspase 3/7 assay after separation from adherent growing RCC cells. Two of these three RCC cell lines (A498 and CAKI2) induced T-cell apoptosis, whereas no effect was observed with CAKI1 (Figure 2). RCC-induced apoptosis in MOLT-4 T cells was 1.31-fold for A498 (n = 6) and 1.38-fold for CAKI2 (n = 4; Figure 2).

Figure 2
Apoptosis ratios of T cells cocultured with RCC cell lines CAKI1 (left), CAKI2 (middle), and A498 (right). Caspase activity ratios are shown relative to normal caspase activity in MOLT-4 cells in culture. Vertical stripes: no antibody added; white: anti-CD70 ...

To test whether this effect is mediated by CD70 expression and is transmitted through CD70/CD27 interaction, blocking experiments in which anti-CD70 and anti-CD27 antibodies had been added were performed. MOLT4 T cells cocultured with the CD70+ RCC cell lines A498 and CAKI2 were completely protected from induced apoptosis when anti-CD70 antibody (P = .019 for A498; P = .046 for CAKI2) or anti-CD27 antibody (P = .0014 for A498; P = .16 for CAKI2; Figure 2) was added to the cell culture. Mouse immunoglobulin G1 was used as negative control and showed no inhibitory effect.

Recombinant Soluble CD70 Induces Apoptosis in Lymphocyte Culture

The effect of recombinant soluble CD70 (rmsCD70) on lymphocytes was assessed to elucidate if the protein is responsible for induced apoptosis rates in lymphocytes. After the addition of 50 ng/ml rmsCD70 to permanently growing MOLT4 Tcells, an average of 1.26-fold (n = 5) T-cell apoptosis was observed. Native lymphocytes showed an average of 1.34-fold (n = 2) apoptosis (Figure 3).

Figure 3
Effect of recombinant soluble CD70 and anti-CD70 and anti-CD27 antibodies on the apoptosis rate of MOLT4 cells (left) and native lymphocytes (right). Rmscd70 was added at a concentration of 50 ng/ml. Vertical stripes: no antibody added; white: anti-CD70 ...

In summary, experiments with rmsCD70 and antibodies of anti-CD27 and anti-CD70 revealed that CD70 has a direct effect on the apoptosis rate of lymphocytes. RmsCD70-induced apoptosis in MOLT4 T cells was completely blocked in the presence of anti-CD27 antibody (P = .030) and in the presence of anti-CD70 antibody (P = .032; Figure 3). The induced apoptosis rate in native lymphocytes was completely blocked after the addition of anti-CD27 antibody (P = .011) and anti-CD70 antibody (P = .005; Figure 3). In addition, the inhibitory effect of anti-CD70 antibody observed on native lymphocytes overcompensated for induced apoptosis. No inhibitory effect was observed after the addition of mouse immunoglobulin G1.


Impaired antitumor immune responses are often observed in RCC patients, and RCC is generally known to be capable of impeding immune response. Nevertheless, only a few mechanisms for RCC immunosuppression have been identified. It has been demonstrated that alterations in proliferation, effector functioning, and intracellular signaling in lymphocytes are rendered [10,11]. These findings and those of others suggest that tumors have developed strategies to evade the immune system through induction of apoptosis in T cells [10,12–14]. One confirmed way for RCC to induce apoptosis in lymphocytes is through FasL expression [2].

Another potential immune-regulatory gene, CD70, a member of the tumor necrosis superfamily, has been identified in earlier studies to be specifically overexpressed in clear cell RCC [3,4]. Although some information about CD70 is available, the role of this gene in tumor development and behavior remains unclear. CD70 is a surface protein and ligand for CD27; both are members of the tumor necrosis factor receptor family [15]. Tumor necrosis factor/tumor necrosis factor receptor-related proteins have central roles in adaptive and antigen-directed immunity when they coordinate the response of lymphocytes to pathogens [16]. Herein we show that CD70 expressed by RCC cell lines is responsible for apoptotic cell death in lymphocytes.

The two tumor cell lines A498 and CAKI2, which express CD70, were found to be capable of increasing apoptosis in lymphocytes to about 30%, whereas the non-CD70-expressing tumor cell line CAKI1 had no measurable influence on the apoptosis rate of T lymphocytes. Furthermore, the addition of recombinant soluble CD70 (rmsCD70) in physiological concentrations to both a T-cell cell line and native lymphocytes in culture increased the apoptosis rate significantly to about 26% and 34%, respectively. The involvement of CD70 was shown by blocking experiments with antibodies against the CD70 ligand and the CD70 receptor. We also observed that the blocking effect of anti-CD70 antibody on native lymphocytes overcompensates for the apoptosis induced by rmsCD70 (Figure 3). We speculate that this could be a hint to a general mechanism in lymphocytes involving CD70/CD27 interaction as a regulatory pathway. Nevertheless, these findings have to be studied in more detail.

Recent data for CD70 lead to the assumption that apoptosis is mediated, in part, through the CD70/CD27 pathway involving the apoptotic protein SIVA [6,17]. We could show the expression of CD27, as well as of SIVA, in permanent and native lymphocytes, whereas no expression was found in permanent RCC cell lines. In addition, gene expression studies of clear cell RCC showed no expression of CD27 in tumor tissues [3]. These findings point to a specific activation of the CD70/CD27 pathway in TILs. However, it remains unclear how apoptotic signal is transmitted. The experimental design of this study suggests two possible ways: the induction of apoptotic signal through direct lymphocyte-RCC cell contact (Figure 4A) or the cleavage and release of CD70 to the surrounding environment. No direct cell-cell contact would be necessary (Figure 4B). However, this needs to be investigated in more detail.

Figure 4
Schematic representation of apoptosis induction through CD70 expression in RCC cells. (A) Apoptosis induction through cell-cell contact. CD27 receptor is expressed by lymphocytes, and CD70 ligand is membrane-bound in RCC cells. Apoptosis is induced after ...

Interestingly, RCC can induce the expression of immunosuppressive mediators, such as prostaglandin E2, by peripheral blood mononuclear cells [18]. It has already been speculated that this finding, in combination with CD70 expression, may skew immune response to a prominent humoral response or, even worse, may complete immune escape/successful immunosuppression [19]. Our findings support this hypothesis.

The assumption that CD70 could play a role in an immune-escape strategy for cancer has been already examined for glioblastoma, and the authors conclude that CD70 expressed by glioma cells evoked immune inhibition rather than immune stimulation [17]. However, a different study carried out by Aulwurm et al. [20] suggests that immune-stimulatory effects of CD70 override CD70-mediated immune cell apoptosis in rodent glioma models and confer long-lasting antiglioma immunity in vivo. These differing findings suggest that the effects carried out after the activation of the CD70/CD27 pathway are highly complex. Little is known so far about possible interaction partners for CD70 and CD27 that may conduct regulatory functions as well.

In conclusion, our study provides evidence that apoptosis in lymphocytes, induced through the expression of CD70, could be a mechanism used by RCC to prevent immune response. We showed that soluble CD70, as well as CD70 expressed by RCC cell lines, leads to apoptosis in lymphocytes through the CD70/CD27 pathway. Thus, we identified another molecule that enables RCC to successfully escape immune recognition.


We would like to thank Ryan K. Oyama and Kathy Astrahantseff for helpful comments and editorial assistance.


renal cell carcinoma
tumor-infiltrating lymphocyte
quantitative PCR


This work was supported by grants from the German Federal Ministry of Education and Research and the Interdisciplinary Center for Clinical Research, Jena, Germany.

Conflict-of-interest statement: none declared.


1. Finke J, Ferrone S, Frey A, Mufson A, Ochoa A. Where have all the T cells gone? Mechanisms of immune evasion by tumors. Immunol Today. 1999;20:158–160. [PubMed]
2. Uzzo RG, Rayman P, Rolenko V, Clark PE, Bloom T, Ward AM, Molto L, Tannenbaum C, Worford LJ, Bukowski R, et al. Mechanisms of apoptosis in T cells from patients with renal cell carcinoma. Clin Cancer Res. 1999;5:1219–1229. [PubMed]
3. Diegmann J, Junker K, Gerstmayer B, Bosio A, Hindermann W, Rosenhahn J, von Eggeling F. Identification of CD70 as a diagnostic biomarker for clear cell renal cell carcinoma by gene expression profiling, real-time RT-PCR and immunohistochemistry. Eur J Cancer. 2005;41:1794–1801. [PubMed]
4. Junker K, Hindermann W, von Eggeling F, Diegmann J, Haessler K, Schubert J. CD70: a new tumor specific biomarker for renal cell carcinoma. J Urol. 2005;173:2150–2153. [PubMed]
5. Diegmann J, Tomiuk S, Sanjmyatav J, Junker K, Hindermann W, von Eggeling Comparative transcriptional and functional profiling of clear cell and papillary renal cell carcinoma. Int J Mol Med. 2006;18:395–403. [PubMed]
6. Wischhusen J, Jung G, Radovanovic I, Beier C, Steinbach JP, Rimner A, Huang H, Schulz JB, Ohgaki H, Aguzzi A, et al. Identification of CD70-mediated apoptosis of immune effector cells as a novel immune escape pathway of human glioblastoma. Cancer Res. 2002;62:2592–2599. [PubMed]
7. Prasad KV, Ao Z, Yoon Y, Wu MX, Rizk M, Jacquot S, Schlossman SF. CD27, a member of the tumor necrosis factor receptor family, induces apoptosis and binds to Siva, a proapoptotic protein. Proc Natl Acad Sci USA. 1997;94:6346–6351. [PubMed]
8. Yoon Y, Ao Z, Cheng Y, Schlossman SF, Prasad KV. Murine Siva-1 and Siva-2, alternate splice forms of the mouse Siva gene, both bind to CD27 but differentially transduce apoptosis. Oncogene. 1999;18:7174–7179. [PubMed]
9. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. [PubMed]
10. Alexander JP, Kudoh S, Melsop KA, Hamilton TA, Edinger MG, Tubbs RR, Sica D, Tuason L, Klein E, Bukowski RM. T-cells infiltrating renal cell carcinoma display a poor proliferative response even though they can produce interleukin 2 and express interleukin 2 receptors. Cancer Res. 1993;53:1380–1387. [PubMed]
11. Li X, Liu J, Park JK, Hamilton TA, Rayman P, Klein E, Edinger M, Tubbs R, Bukowski R, Finke J. T cells from renal cell carcinoma patients exhibit an abnormal pattern of kappa B-specific DNA-binding activity: a preliminary report. Cancer Res. 1994;54:5424–5429. [PubMed]
12. Finke JH, Rayman P, Hart L, Alexander JP, Edinger MG, Tubbs RR, Klein E, Tuason L, Bukowski RM. Characterization of tumor-infiltrating lymphocyte subsets from human renal cell carcinoma: specific reactivity defined by cytotoxicity, interferon-gamma secretion, and proliferation. J Immunother Emphas Tumor Immunol. 1994;15:91–104. [PubMed]
13. O'Connell J, O'Sullivan GC, Collins JK, Shanahan F. The Fas counterattack: Fas-mediated T cell killing by colon cancer cells expressing Fas ligand. J Exp Med. 1996;184:1075–1082. [PMC free article] [PubMed]
14. Saas P, Walker PR, Hahne M, Quiquerez AL, Schnuriger V, Perrin G, French L, Van Meir EG, de Tribolet N, Tschopp J, et al. Fas ligand expression by astrocytoma in vivo: maintaining immune privilege in the brain? J Clin Invest. 1997;99:1173–1178. [PMC free article] [PubMed]
15. Goodwin RG, Alderson MR, Smith CA, Armitage RJ, VandenBos T, Jerzy R, Tough TW, Schoenborn MA, vis-Smith T, Hennen K. Molecular and biological characterization of a ligand for CD27 defines a new family of cytokines with homology to tumor necrosis factor. Cell. 1993;73:447–456. [PubMed]
16. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell. 2001;104:487–501. [PubMed]
17. Chahlavi A, Rayman P, Richmond AL, Biswas K, Zhang R, Vogelbaum M, Tannenbaum C, Barnett G, Finke JH. Glioblastomas induce T lymphocyte death by two distinct pathways involving gangliosides and CD70. Cancer Res. 2005;65:5428–5438. [PubMed]
18. Smyth GP, Stapleton PP, Barden CB, Mestre JR, Freeman TA, Duff MD, Maddali S, Yan Z, Daly JM. Renal cell carcinoma induces prostaglandin E2 and T-helper type 2 cytokine production in peripheral blood mononuclear cells. Ann Surg Oncol. 2003;10:455–462. [PubMed]
19. Oosterwijk E. Tumor markers for renal cell carcinoma. J Urol. 2005;173:1874. [PubMed]
20. Aulwurm S, Wischhusen J, Friese M, Borst J, Weller M. Immune stimulatory effects of CD70 override CD70-mediated immune cell apoptosis in rodent glioma models and confer long-lasting anti-glioma immunity in vivo. Int J Cancer. 2005;118:1728–1735. [PubMed]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press