PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of mbcLink to Publisher's site
 
Mol Biol Cell. 2006 December; 17(12): 5105–5114.
PMCID: PMC1679676

A Nuclear Function of Hu Proteins as Neuron-specific Alternative RNA Processing Regulators

Peter Walter, Monitoring Editor

Abstract

Recent advances in genome-wide analysis of alternative splicing indicate that extensive alternative RNA processing is associated with many proteins that play important roles in the nervous system. Although differential splicing and polyadenylation make significant contributions to the complexity of the nervous system, our understanding of the regulatory mechanisms underlying the neuron-specific pathways is very limited. Mammalian neuron-specific embryonic lethal abnormal visual-like Hu proteins (HuB, HuC, and HuD) are a family of RNA-binding proteins implicated in neuronal differentiation and maintenance. It has been established that Hu proteins increase expression of proteins associated with neuronal function by up-regulating mRNA stability and/or translation in the cytoplasm. We report here a novel function of these proteins as RNA processing regulators in the nucleus. We further elucidate the underlying mechanism of this regulation. We show that in neuron-like cells, Hu proteins block the activity of TIA-1/TIAR, two previously identified, ubiquitously expressed proteins that promote the nonneuronal pathway of calcitonin/calcitonin gene-related peptide (CGRP) pre-mRNA processing. These studies define not only the first neuron-specific regulator of the calcitonin/CGRP system but also the first nuclear function of Hu proteins.

INTRODUCTION

Alternative RNA processing is one of the major mechanisms that expand the functional proteome from a limited genome size. Recent genome-wide bioinformatic analyses have demonstrated that the majority of human pre-mRNAs undergo alternative RNA processing (Modrek and Lee, 2002 blue right-pointing triangle). A global survey of alternative splicing by using exon–junction microarrays indicated that at least 74% of multi-exonic human pre-mRNAs are alternatively spliced (Johnson et al., 2003 blue right-pointing triangle). The most extensive alternative splicing occurs in brain tissues (Xu et al., 2002 blue right-pointing triangle). It is not uncommon for hundreds of different isoforms to be generated from a single gene through alternative splicing in the mammalian nervous system. The genes that undergo extensive alternative splicing include those involved in cell-cell interactions, such as cell surface receptor molecules and various ion channels (Grabowski and Black, 2001 blue right-pointing triangle; Black and Grabowski, 2003 blue right-pointing triangle; Lipscombe, 2005 blue right-pointing triangle). Significant advances have been made in dissecting the functional differences between different isoforms. As a result, it was postulated that alternative splicing plays a key role in supporting the complex functions of the nervous system (Grabowski and Black, 2001 blue right-pointing triangle; Black and Grabowski, 2003 blue right-pointing triangle; Lipscombe, 2005 blue right-pointing triangle).

Although recent studies have provided exciting insight into the distinct functions played by individual alternatively spliced protein isoforms during neuronal development, understanding of the regulatory mechanisms that control neuron-specific alternative splicing remains very limited. Despite the extensive nature of alternative splicing in the nervous system, only a small number of factors involved in regulation of alternative splicing in the nervous system of mammals have been identified and even fewer characterized (Black and Grabowski, 2003 blue right-pointing triangle). These factors include classical RRM-containing proteins such as nPTB/brPTB, NAPOR/CUGBP2, and Fox-1/Fox-2; KH-type proteins such as Nova; and the STAR/GRG family proteins such as QK1 (Ashiya and Grabowski, 1997 blue right-pointing triangle; Zhang et al., 1999 blue right-pointing triangle; Jensen et al., 2000 blue right-pointing triangle; Markovtsov et al., 2000 blue right-pointing triangle; Polydorides et al., 2000 blue right-pointing triangle; Wu et al., 2002 blue right-pointing triangle; Zhang et al., 2002 blue right-pointing triangle; Dredge and Darnell, 2003 blue right-pointing triangle; Ule et al., 2003 blue right-pointing triangle; Underwood et al., 2005 blue right-pointing triangle). All of these factors function by binding to their cognate target sequences on the pre-mRNA molecules and by modulating splicing of neuron-specifically processed exons either positively or negatively. In most cases, it is not clear how these factors interact with the basic splicing machinery to modulate splicing; however, one recent report demonstrated elegantly that the PTB protein blocks entry of U2AF into the presplicesomal E complex, thereby suppressing inclusion of the neuron-specific c-src N1 exon in nonneuronal cells; suppression is relieved in neuronal cells by the replacement of the ubiquitous form of PTB with a different form of PTB, nPTB/brPTB (Sharma et al., 2005 blue right-pointing triangle). A clue to how alternative splicing regulates brain-specific functions came from a study by Ule and colleagues, in which they provided compelling evidence to support the existence of a multi-tiered network regulated by Nova. They demonstrated that, in a coordinated manner, Nova regulates the exon content of RNAs encoding a large number of proteins that interact in the synapse, which accounts for 7% of the brain-specific alternative splicing in the neocortex (Ule et al., 2005 blue right-pointing triangle).

Mammalian Hu proteins are a group of RNA-binding proteins consisting of four family members: HuA (HuR in human), HuB (HelN1 in human), HuC, and HuD. Similar to Nova1 and Nova2, which are autoimmune targets in paraneoplastic opsoclonus myoclonus ataxia (Buckanovich et al., 1996 blue right-pointing triangle), HuD was originally cloned by screening a cerebellar expression library by using antisera from patients with paraneoplastic encephalomyelitis, one form of paraneoplatic syndrome in which Hu proteins are the autoimmune antigens (Szabo et al., 1991 blue right-pointing triangle). All three neuron-specific members of the Hu family, HuB, HuC, and HuD, were shown to be autoimmune antigens of the Hu syndrome (Posner and Dalmau, 1997 blue right-pointing triangle). Several in vivo and in vitro experiments indicate an important role of neuron-specific Hu proteins in neuronal differentiation (Wakamatsu and Weston, 1997 blue right-pointing triangle; Akamatsu et al., 1999 blue right-pointing triangle, 2005 blue right-pointing triangle; Anderson et al., 2000 blue right-pointing triangle). At the molecular level, all members of the Hu protein family, including HuA (HuR) have been shown to play important roles in the cytoplasm. They interact with AU-rich elements (AREs) in 3′-untranslated regions (UTRs) to regulate mRNA stability (Jain et al., 1997 blue right-pointing triangle; Myer et al., 1997 blue right-pointing triangle; Anderson et al., 2000 blue right-pointing triangle); the human HuB and HuD proteins have also been shown to modulate translation (Antic et al., 1999 blue right-pointing triangle; Kullmann et al., 2002 blue right-pointing triangle).

Despite evidence of nuclear-cytoplasmic shuttling (Fan and Steitz, 1998 blue right-pointing triangle; Burry and Smith, 2006 blue right-pointing triangle) and the predominant nuclear localization (Okano and Darnell, 1997 blue right-pointing triangle), none of the Hu proteins have been reported to have a nuclear function. However, in Drosophila, the Hu protein homologue, the embryonic lethal abnormal visual (ELAV) protein, has been shown to have a very important function in the nucleus. ELAV regulates alternative pre-mRNA processing in neurons (Lisbin et al., 2001 blue right-pointing triangle; Soller and White, 2003 blue right-pointing triangle, 2005 blue right-pointing triangle). Although the idea that Hu proteins may regulate alternative splicing in mammalian neurons seemed extremely promising, it remains a mystery whether Hu proteins can function as splicing regulators, because no target sequence of Hu proteins as alternative splicing regulators has been identified. In this report, we describe our finding of the first such target of Hu proteins, the human calcitonin/calcitonin gene-related peptide (CGRP) pre-mRNA.

Calcitonin/CGRP pre-mRNA represents one of many RNA transcripts that undergo neuron-specific regulation of alternative RNA processing. In a subset of neurons, the six exon-containing calcitonin/CGRP pre-mRNA is processed to skip the alternative 3′-terminal exon 4, leading to the production of the neurotransmitter CGRP, in contrast to thyroid C cells where this exon is included and exons 5 and 6 are skipped leading to the production of the peptide hormone calcitonin (Figure 1A) (Rosenfeld et al., 1982 blue right-pointing triangle). Previous studies demonstrated that the rate-limiting step for processing the calcitonin/CGRP pre-mRNA is the decision about whether to include or exclude the nonneuronal exon 4, which contains suboptimal RNA processing signals (Bovenberg et al., 1986 blue right-pointing triangle; Adema et al., 1990 blue right-pointing triangle). An enhancer element located downstream of exon 4 was demonstrated to promote inclusion of the exon partly through enhancing polyadenylation (Lou et al., 1996 blue right-pointing triangle). Although it was speculated that neuron-specific factors exist to regulate the CGRP-specific pathway (Leff et al., 1987 blue right-pointing triangle; Roesser et al., 1993 blue right-pointing triangle), previous studies have only identified a number of factors that affect the nonneuronal pathway (Lou and Gagel, 1999 blue right-pointing triangle; Tran et al., 2003 blue right-pointing triangle; Tran and Roesser, 2003 blue right-pointing triangle; Zhu et al., 2003 blue right-pointing triangle; Roesser, 2004 blue right-pointing triangle).

Figure 1.
Alternative pre-mRNA processing of the calcitonin/CGRP gene. (A) Schematic diagram of the calcitonin/CGRP gene and its alternative RNA processing in thyroid and neuronal cells. (B) Diagram showing the calcitonin/CGRP reporter gene and its cell-specific ...

Here, we report the identification of the Hu proteins as pre-mRNA processing regulators promoting the CGRP-specific pathway. Previously, we demonstrated that the ubiquitously expressed TIA-1/TIAR proteins promote the calcitonin-specific pathway through interacting with a U-rich sequence located in the intronic element downstream of the calcitonin exon (Zhu et al., 2003 blue right-pointing triangle). In this report, we show that Hu proteins interact with the same U-rich sequence and strongly compete with TIA-1/TIAR for binding in neuron-like cells. We provide evidence that the major function of Hu proteins is to block the activity of TIA-1/TIAR. Hu proteins represent the first neuron-specific regulator of the calcitonin/CGRP system. Our studies also define the first and long speculated nuclear function of Hu proteins as RNA processing factors (Szabo et al., 1991 blue right-pointing triangle).

MATERIALS AND METHODS

Plasmids

The human calcitonin/CGRP reporter constructs used in transfection experiments consist of calcitonin/CGRP exons 4–6 fused to a heterologous first exon from adenovirus (Lou et al., 1995 blue right-pointing triangle). The reporter construct that contains mutations at the U-tract sequences (UUUUUUAUUUU to GUGUUGAUGGU) and plasmids used to generate in vitro transcribed RNA substrates for UV cross-linking and gel-shift assays were described previously (Zhu et al., 2003 blue right-pointing triangle). The calcitonin/CGRP reporter construct containing a Rev-responsive element (RRE) sequence was generated by insertion of an XhoI restriction enzyme recognition sequence upstream of the U-tract through polymerase chain reaction (PCR)-directed mutagenesis followed by ligation of two oligonucleotides complimentary to each other at the XhoI site (sense oligonucleotide, 5′-TCGAGTGGGCGCAGCGTCAATGACGCTGACGGTACAC; and antisense oligonucleotide, 5′-TCGAGTGTACCGTCAGCGTCATTGACGCTGCGCCCAC).

To generate cDNA sequences of the mouse HuB and HuC, reverse transcription (RT)-PCR was carried out using RNA isolated from the mouse F9 cells and mHuB- or mHuC-specific oligonucleotides (5′-GCGGATCCAATGGAAACACAACTGTCTAA and 5′-GCGAATTCTTAGGCTTTGTGCGTTTTGTT for mHuB and 5′-GCGGATCCAATGGTCACTCAGATACTGGG and 5′-GCGAATTCTCAGGCCTTGTGCTGCTTGC for mHuC). The PCR products were digested with BamHI and EcoRI and cloned into the BamHI and EcoRI sites in the pGEX-2TK (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) vector for glutathione S-transferase (GST) recombinant proteins production or the BamHI-EcoRI sites in the pcDNA3.1HisB (Invitrogen, Carlsbad, CA) vector for mammalian cell transfection. Truncated mHuC constructs were generated by similar PCR-directed cloning. mHuC RRM12 and mHuC RRM3 were created using oligonucleotide pairs 5′-GCGGATCCAATGGAAACACAACTGTCTAA and 5′-GAATTCGTTTGCGAACTTGACCGT, and 5′-GCGGATCCAAAGACAGGGCAGGCCCTGCT and 5′-GCGAATTCTCAGGCCTTGTGCTGCTTGC, respectively. The TIA-1-Rev and HuC-Rev plasmids were constructed by PCR amplifying TIA-1 or HuC and inserting the PCR product into the SphI and BglII sites of the PC12-Rev vector (a gift from Dr. Christine Herrmann, Baylor College of Medicine, Houston, TX). All of these plasmids were verified by DNA sequencing.

Cell Culture, P19 Differentiation, and Cell Transfection

HeLa, Chinese hamster ovary (CHO), F9, PC12 TT, SK-N-SH, and P19 cell lines were maintained according to instructions from American Type Culture Collection (Manassas, VA). CA77 cells, a cell line derived from rat medullary thyroid carcinoma (a gift from Drs. Alison Hall at Case Western Reserve University, Cleveland, OH, and Andrew Russo, University of Iowa, Iowa City, IA) were cultured in DMEM/F-12 (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen) and 1% Pen/Strep (Invitrogen). For differentiation of P19 cells, cells were aggregated in bacterial culture dishes and either untreated or treated with 0.3 μM all-trans retinoid acid (Sigma-Aldrich, St. Louis, MO) or 1% dimethyl sulfoxide (DMSO) for 4 d and then plated in tissue culture dishes. Transfection of differentiated P19 cells was carried out 48 h after the cells were transferred to tissue culture dishes by using Lipofectamine (Invitrogen), and cells were collected 4 d after transfection for analysis. HeLa cells were transfected as described previously (Zhu et al., 2003 blue right-pointing triangle). Transfection of CA77 cells was carried out essentially the same as HeLa cells except that Lipofectamine 2000 (Invitrogen) was used, and cells were grown for 72 h before and after transfection. Cotransfections used 1 μg of the calcitonin/CGRP reporter plasmid and either 0.2–0.4 μg of TIA-1, Rev, TIA-1-Rev or HuC-Rev plasmids, or 1–2 μg of mHuC RRM12 or mHuC RRM3 plasmids.

RNA and Protein Analysis

Procedures for total RNA and protein isolation and RT-PCR analysis were described previously (Zhu et al., 2003 blue right-pointing triangle). Use of low cycle (18–22) PCR permitted determination of the relative abundance of individual RNA species. Quantification of exon inclusion was determined using a PhosphorImager (GE Healthcare). The results shown are representative of at least three independent transfections for each experiment. The effect of TIA-1, Rev, TIA-1-Rev, HuC-Rev, mHuC RRM12, or mHuC RRM3 on RNA processing of the reporter pre-mRNA was calculated as percentage of the calcitonin exon inclusion [calcitonin exon inclusion/(calcitonin exon inclusion + CGRP exon inclusion)]. Western blot analysis using the proteins isolated from the untransfected or transfected cells was carried out with anti-Xpress antibody (Invitrogen) or anti-TIA-1/TIAR antibody (3E6) (Zhu et al., 2003 blue right-pointing triangle) and anti-Hu sera (a gift from Dr. Jerome Posner, Sloan Kettering Cancer Center, New York, NY). Because it is difficult to detect overexpressed proteins in CA77 cells due to the extremely low transfection efficiency, protein expression of Rev, TIA-1-Rev, mHuC-Rev, mHuC RRM12, and mHuC RRM3 was verified using HeLa cells.

In Vitro Assays

UV cross-linking reactions were carried out as described previously (Zhu et al., 2003 blue right-pointing triangle). Cross-linked polypeptides were immunoprecipitated using monoclonal antibodies against TIA-1 and TIAR (3E6) or anti-Hu sera. Gel-shift assays were performed using recombinant GST-TIAR or His-HuD prepared from bacteria and in vitro-transcribed RNA substrates. The reactions were described previously (Zhu et al., 2003 blue right-pointing triangle).

Immunoprecipitation of CA77 Nuclear Extract and RT-PCR Analysis

Eight hundred micrograms of CA77 cell nuclear extract proteins was immunoprecitated with anti-Hu sera in NET supplemented with RNase Out (Invitrogen). The pellet was washed five times in NET (150 mM NaCl, 50 mM Tris, pH 7.5, and 0.05% NP-40), treated with proteinase K, and extracted with phenol/chloroform, followed by RNA precipitation. RT-PCR was carried out as described previously (Zhu et al., 2003 blue right-pointing triangle). Oligonucleotides used for RT-PCR were TTAGCCCCGGAGGTTAAGCA and TTGATGCCACCTCTGAGCCT for calcitonin/CGRP (both in intron 4) and ACCTCCAAACTGAAGAGC and TGGCAGGTTTCTCCAGGCGGC for rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (in intron 3 and exon 5, respectively).

Nuclear Extract Preparation from HeLa and CA77 Cells

HeLa cell nuclear extracts were prepared using S3 suspension culture and standard techniques (Zhu et al., 2003 blue right-pointing triangle). To make nuclear extracts from CA77 cells, 100 100-mm dishes of monolayer of CA77 cells were collected and used following a standard procedure (Zhu et al., 2003 blue right-pointing triangle).

RESULTS

Correlation between Hu Protein Expression and CGRP-specific Processing

In mammals, Hu proteins comprise a family of RNA-binding proteins that contains four closely related members: HuA (HuR in human), HuB (HelN1 in human), HuC, and HuD. Three of these proteins, HuB, HuC, and HuD, are normally exclusively expressed in all neurons of the central and peripheral nervous systems with the exception of HuB, which is also expressed in germ cells (Okano and Darnell, 1997 blue right-pointing triangle). Although distinct combinations of the individual Hu proteins do exist for individual neurons, every neuron has at least one Hu protein (Okano and Darnell, 1997 blue right-pointing triangle). CGRP is naturally produced in a subset of neurons, including hippocampal neurons, trigeminal ganglion, dorsal root ganglion, and spinal cord (Rosenfeld et al., 1992 blue right-pointing triangle). Thus, a correlation between Hu protein expression and CGRP production is obvious in vivo.

Several cell lines have been used in previous studies that recapitulate either the calcitonin- or CGRP-specific RNA processing pathway. In our studies, we use HeLa cells to mimic the calcitonin pathway, and CA77 cells derived from rat medullary thyroid carcinoma (MTC) to mimic the CGRP pathway. HeLa cells do not express the calcitonin/CGRP gene endogenously. However, when transfected with a calcitonin/CGRP reporter construct that contains a fragment of the human calcitonin/CGRP gene extending from the middle of intron 3 to the 3′ end of the gene fused with a first exon and half of an intron from the major late transcription unit of adenovirus, these cells process the reporter pre-mRNA in the calcitonin-specific pathway (Figure 1, B and C, lane 1). To examine CGRP-specific processing, we chose CA77 cells in our current study. These cells provide an optimal system for our purposes because although the line is derived from a rat MTC, medullary thyroid carcinoma, the CA77 cells have a neuronal phenotype characterized by neurites and neuronal antigens (Russo et al., 1992 blue right-pointing triangle) (Figure 1C, right). Most relevant to us is the endogenous expression of the calcitonin/CGRP gene and the switch from 95% calcitonin to as high as 80–90% CGRP mRNA production (Russo et al., 1992 blue right-pointing triangle). When CA77 cells are transfected with the reporter construct shown in Figure 1B, processing of the reporter pre-mRNA closely mimics that of the endogenous calcitonin/CGRP, with CGRP-specific processing as the predominant pathway (Figure 1C, lane 2) (Russo et al., 1992 blue right-pointing triangle).

To examine the expression level of Hu family members, proteins in the whole cell lysate isolated from eight cell lines were separated on SDS-PAGE and probed with anti-Hu sera derived from patients who suffer from a paraneoplastic syndrome in which Hu proteins are autoimmune antigens. The anti-Hu sera can detect all three neuron-specific Hu proteins (HuB, HuC, and HuD) but not the ubiquitously expressed HuA (HuR) in a Western blot analysis. Strong signals were observed in F9, PC12, TT, CA77, mouse embryonic stem (ES) cells, and SK-N-SH cells, where the CGRP pathway is preferred based on published and unpublished work (Bennett and Amara, 1992 blue right-pointing triangle; Russo et al., 1992 blue right-pointing triangle; our unpublished data). In contrast, no Hu signals were detected in the HeLa and CHO cells, where the calcitonin pathway is preferred (Figure 2A) (Lou et al., 1996 blue right-pointing triangle, 1998 blue right-pointing triangle). Expression of a group of generally expressed splicing regulators, TIA-1 and TIAR, did not show significant differences among these cell lines (Figure 2A). In an attempt to further correlate Hu protein expression level and CGRP production, we isolated total RNA from four cell lines that endogenously express both Hu proteins and the calcitonin/CGRP gene and carried out RT-PCR analysis. It is very clear that the highest CGRP expression was observed in the two cell lines that express very high levels of Hu proteins, F9 and mouse ES cells. Note that only one-sixth of the total protein lysate was loaded for these two cell lines in the blot probed with anti-Hu sera. In CA77 and TT cells, where the Hu protein level is much lower, a higher calcitonin expression level was observed (Figure 1A).

Figure 2.
Expression of Hu proteins correlates with the CGRP processing pathway. (A) Hu proteins are highly expressed in cells that undergo CGRP-specific RNA processing. Western blot analysis was carried out with human anti-Hu serum or anti-TIA-1/R antibody. Splicing ...

It has been established that P19 (mouse embryonal carcinoma) cells can be induced to differentiate into neuron-like cells by retinoic acid (RA) treatment (Strickland and Mahdavi, 1978 blue right-pointing triangle). Taking advantage of this system, we studied calcitonin/CGRP pre-mRNA processing in RA-treated P19 cells by transfecting a calcitonin/CGRP reporter gene. As shown in Figure 2B, the major RNA-processing product switched from the calcitonin pathway to the CGRP pathway after RA treatment, but not after the control DMSO treatment. The mRNA level of the three neuron-specific Hu proteins (HuB, HuC, and HuD) was examined by RT-PCR and was shown to be significantly increased in P19 neurons, suggesting up-regulation of these proteins by RA treatment, which is consistent with previous findings that Hu proteins are induced in P19 neurons and the human equivalent NT2 neurons (Gao and Keene, 1996 blue right-pointing triangle; Antic et al., 1999 blue right-pointing triangle; Kasashima et al., 1999 blue right-pointing triangle). The correlation between the expression of Hu proteins and the CGRP-specific pre-mRNA processing strongly suggests a role for Hu proteins in regulating the neuron-specific CGRP pathway.

Hu Proteins and TIA-1/TIAR Compete for Binding to the Same U-rich Sequence Located in a Previously Characterized Intronic Enhancer

Hu proteins have been shown to have strong affinity for U-rich sequences (Chung et al., 1996 blue right-pointing triangle). They bind to ARE sequences in the 3′-UTRs of many mRNAs to regulate mRNA stability (Brennan and Steitz, 2001 blue right-pointing triangle; Keene, 2001 blue right-pointing triangle; Perrone-Bizzozero and Bolognani, 2002 blue right-pointing triangle). Previously, we identified a U-tract sequence located in an intronic element downstream of the calcitonin exon 4 and showed that it plays an important role in inclusion of this exon in nonneuronal cells (Lou et al., 1995 blue right-pointing triangle). Furthermore, we demonstrated that TIA-1/TIAR proteins bind to the U-tract sequence and promote inclusion of the exon (Zhu et al., 2003 blue right-pointing triangle). We hypothesized that in neurons, Hu proteins bind to the same sequence and block access by the TIA-1/TIAR proteins that are also present in neurons (Figure 2A). To determine whether the U-tract sequence is a Hu protein-binding target, UV cross-linking/immunoprecipitation (IP) was carried out in CA77 nuclear extract by using Hu anti-sera derived from patients with Hu syndrome. Hu proteins are abundantly expressed in these cells (Figure 2A). As expected, we detected a strong signal indicative of Hu proteins binding to an RNA substrate containing the U-rich sequence, but not to an RNA containing the mutated sequence (Figure 3, A and B). Note that the same mutations were also shown to abolish the binding of TIA-1/TIAR proteins (Zhu et al., 2003 blue right-pointing triangle). The gel mobility shift assay using the same wild-type and mutant RNA substrates showed a result consistent with the UV cross-linking/IP experiment (Figure 3C).

Figure 3.
Hu proteins interact with the U-tract in the intronic element. (A) RNAs used in the UV cross-linking/IP and RNA gel mobility shift assay. Wild-type and mutated U-tract sequences are indicated. (B) UV cross-linking/IP assay. The 32P-labeled in vitro transcribed ...

To test whether Hu proteins and TIA-1/TIAR can compete with each other for binding at the U-tract sequence, we carried out two experiments: gel mobility shift and UV cross-linking/IP assays. In the gel mobility shift assay, we incubated both GST-TIAR and His-HuD with the RNA substrate shown in Figure 3A. When 0.1 μg of either His-HuD or GST-TIAR was added, the majority of the RNA substrate moved slower to a position indicative of a complex between the RNA and His-HuD or GST-TIAR (Figure 4A, compare lanes 2 and 6 with lane 1). When the same, constant amount of His-HuD and increasing amounts of GST-TIAR were added, the complex formed between the RNA and His-HuD was gradually replaced by a new complex formed between the RNA and GST-TIAR, which moved more slowly on the gel due to the size difference between the two complexes (lanes 3–5). Likewise, when GST-TIAR was held constant and His-HuD added in increasing amounts, the larger complex was shifted to a smaller complex (lanes 7–9). To determine whether a similar competition between Hu proteins and TIA-1/TIAR exists in the nucleus of the CA77 cells, we also carried out UV cross-linking assay. In this assay, increasing amounts of recombinant GST-TIAR protein were added to the CA77 nuclear extract and binding of both proteins to the RNA substrate was examined. Figure 4B shows that Hu binding decreases when TIAR binding increases. The reciprocal experiment—adding recombinant HuD protein to HeLa cell nuclear extract—showed a similar result (Figure 4B). These experiments establish that Hu proteins do compete with TIA proteins for the calcitonin/CGRP regulatory RNA sequence and in cells.

Figure 4.
Hu proteins compete with TIAR for binding at the U-tract sequence. (A) Gel mobility shift assay. The 32P-labeled in vitro transcribed RNAs indicated in Figure 3A were incubated with GST-TIAR and His-HuD. Lane 1, no protein added; lanes 2–5, 0.1 ...

We next compared binding of TIA-1/TIAR to the same sequence in HeLa and CA77 cells. Although the protein level of TIA-1/TIAR is the same in nuclear extracts isolated from HeLa and CA77 cells, cross-linking of these proteins to the U-tract sequence is significantly reduced in CA77 nuclear extract (Figure 4C). These results are consistent with the possibility that reduced binding of TIA-1/TIAR to the U-tract is the underlying cause of the neuron-specific exon 4 skipping phenotype in CA77 cells. Furthermore, they suggest that competition between Hu proteins and TIA-1/TIAR may be responsible for the reduced binding of TIA-1/TIAR to the U-tract sequence in the calcitonin/CGRP pre-mRNA in these cells.

Tethering of TIA-1 Protein in the Vicinity of the U-Tract in CA77 Cells Promotes Exon 4 Inclusion

Our previous experiments using HeLa cells show that TIA-1/TIAR proteins are required for exon 4 inclusion (Zhu et al., 2003 blue right-pointing triangle). Because interaction of TIA-1/TIAR with the U-tract is dramatically reduced in CA77 cells, we reasoned that if we could increase binding of this protein, we might be able to increase exon 4 inclusion in these cells. We first tried to overexpress TIA-1 or TIAR in CA77 cells, but we observed no increase in exon 4 inclusion (our unpublished data). This result was not unexpected because binding of TIA-1/TIAR to the U-tract may remain low in CA77 cells even when the overall protein level is higher due to the presence of endogenous Hu proteins. Next, we took advantage of a well-established fusion protein approach to target TIA-1 to the vicinity of the U-tract sequence. This approach has been successfully used to bring protein factors to RNA targets (Tiley et al., 1992 blue right-pointing triangle) and is similar to the MS2-MS2 coat protein fusion approach. We introduced a human immunodeficiency virus RRE immediately upstream of the U-tract of the calcitonin/CGRP reporter gene (Figure 5A) and brought TIA-1 to the sequence through a TIA-1-Rev fusion protein. The introduced RRE sequence contains a minimal, 29-nucleotide single stem-loop structure shown to have strong binding for Rev (Tiley et al., 1992 blue right-pointing triangle). The resulting reporter construct behaved like the parental construct in that its pre-mRNA was processed to predominantly skip exon 4 (Figure 5B, lane 1, compare to lane 2 in Figure 1C). However, when a TIA-1-Rev fusion protein construct was cotransfected with the RRE-containing reporter gene, exon 4 inclusion was increased by 2- to 2.5-fold, whereas cotranfection of Rev alone construct did not significantly affect RNA processing of this reporter gene (Figure 5B, lanes 2–5). As expected, cotransfection of TIA-1 with the RRE-containing reporter did not change the splicing phenotype (our unpublished data). These experiments establish that reduced binding of TIA-1/TIAR at the U-tract sequence is responsible for the low level of exon 4 inclusion in CA77 cells.

Figure 5.
Targeted binding of TIA-1 to the U-tract region increased exon 4 inclusion. (A) Diagram showing the location of the RRE stem-loop sequence. (B) RT-PCR analysis using RNAs isolated from transfected CA77 cells that preferentially exclude exon 4. CA77 cells ...

Hu Proteins Are Functionally Involved in Regulating Exon 4 Skipping

To further investigate the role of Hu proteins in regulating CGRP processing, it is necessary to disrupt the function of the endogenous Hu protein in CA77 cells and to study its effect on alternative RNA processing of calcitonin/CGRP. Although the commonly used RNA interference approach is very attractive, it is very difficult to knockdown all three neuron-specific Hu proteins to sufficiently low levels to force a change in RNA processing. All of the experiments we have carried out to date suggest that individual Hu proteins have redundant functions in the calcitonin/CGRP system (our unpublished data). We therefore turned to the dominant-negative mutant protein approach. It was previously shown that either HuB or HuC RRM3 can function dominant negatively to interfere with the function of both HuB and HuC in a neuronal differentiation experiment (Akamatsu et al., 1999 blue right-pointing triangle). Thus, it is possible that a dominant-negative protein of one Hu protein will interfere with the activity of all of the Hu proteins. Different domains of Hu proteins have been shown to have distinct functions. In the study by Akamatsu et al. (1999) blue right-pointing triangle, it was shown that the RRM1 and RRM2 of mouse HuB or HuC protein have strong binding affinity for poly(U)-Sepharose, whereas RRM3 binds to RNA only weakly. Other studies indicate that the RRM1 and RRM2 domains of the HuD protein have high RNA-binding activity and contribute to the RNA-binding properties of the HuD protein to the c-fos ARE (Chung et al., 1996 blue right-pointing triangle), whereas the RRM3 domain of human HuB (HelN1) binds to the c-myc ARE (Levine et al., 1993 blue right-pointing triangle; Gao and Keene, 1996 blue right-pointing triangle). Moreover, the RRM3 of human HuB was shown to interfere with multimerization of the full-length HuB (Gao and Keene, 1996 blue right-pointing triangle), whereas the hinge and RRM3 domains of the human HuA (HuR) was demonstrated to be necessary and sufficient for export of HuR through the CRM1 pathway (Gallouzi et al., 2001 blue right-pointing triangle).

When we cotransfected a construct containing the mouse HuC RRM3 together with the hinge domain with the calcitonin/CGRP reporter gene into CA77 cells, the production of CGRP was compromised and inclusion of the calcitonin exon was increased by approximately twofold compared with cells transfected without any Hu proteins (Figure 6, A and B, compare lane 1 with lanes 4 and 5. Transfection of the CA77 cells with the mHuC RRM12 construct did not significantly affect inclusion of the calcitonin exon (Figure 6, A and B, compare lane 1 with lanes 2 and 3).

Figure 6.
Neuronal exclusion of exon 4 in CA77 cells is compromised by a truncated mHuC protein containing RRM3 domain with the hinge domain. (A) Diagram of the two truncated forms of mHuC is shown in the top panel. (B) CA77 cells were cotransfected with a calcitonin/CGRP ...

There are two possibilities for how Hu proteins contribute to the CGRP-specific processing. Hu proteins may simply block the activity of TIA-1/TIAR proteins, or they have a secondary function upon binding to the U-tract sequence. We carried out a simple experiment to address this question, again, by using the Rev-RRE approach. As shown in Figure 5B, TIA-1-Rev increased the calcitonin exon inclusion of the transcribed RRE-containing reporter pre-mRNA. This activity can be competed away by cotransfection of the Rev alone construct in increasing amounts together with TIA-1-Rev (Figure 5C, lanes 3, 6, and 7). If Hu proteins do not have any additional function other than blocking TIA-1/TIAR activity, cotransfection of a HuC-Rev fusion construct would decrease the calcitonin exon inclusion to the similar extent as Rev alone, which is exactly what we observed (Figure 5C, compare lanes 6 and 7 and 8 and 9). Cotransfection of HuC without the Rev fusion and TIA-1-Rev did not have a different effect from TIA-1-Rev (compare lane 3 with lanes 4 and 5). This result implies that the major function of the Hu proteins upon binding to the intronic U-tract sequence is to block the activity of TIA-1/TIAR.

Hu Proteins Interact with Endogenously Expressed Calcitonin/CGRP pre-mRNA

We took advantage of the fact that Hu proteins and calcitonin/CGRP are both endogenously expressed in CA77 cells and tested whether they interact in the natural environment of these cells. We immunoprecipitated the Hu protein-containing complex from a CA77 cell nuclear extract by using anti-Hu sera and examined the RNA in the complex by RT-PCR analysis. As shown in Figure 7, significant association of calcitonin/CGRP pre-mRNA was present in the immunoprecipitate, whereas no GAPDH pre-mRNA was brought down. PhosphorImager measurement of radioactivity in the RT-PCR products indicates that 55% of the imput calcitonin/CGRP pre-mRNA was pulled down by the anti- Hu sera. The strong association of Hu proteins and calcitonin/CGRP pre-mRNA supports the role of Hu proteins in regulating the neuron-specific RNA processing of this pre-mRNA.

Figure 7.
Association of Hu proteins and the calcitonin/CGRP pre-mRNA in CA77 cells. The nuclear extract prepared from CA77 cells was immunoprecipitated with anti-Hu sera. RNA was isolated from either total nuclear extract or immunoprecipitated pellet and analyzed ...

DISCUSSION

In this report, we demonstrate a novel mechanism of neuron-specific regulation of alternative RNA processing. We argue that the mammalian Hu proteins regulate neuron-specific alternative RNA processing of the calcitonin/CGRP pre-mRNA by blocking the activity of ubiquitously expressed TIA-1/TIAR, which were previously shown to play an important role in inclusion of the nonneuronal 3′-terminal exon, exon 4 (Zhu et al., 2003 blue right-pointing triangle). The two groups of proteins compete for binding to the same U-tract sequence located in an intronic element of the calcitonin/CGRP pre-mRNA. It is interesting that even though these two groups of proteins have a similar affinity to the U-tract–containing RNA target in a gel mobility shift assay, Hu proteins seem to cross-link RNA more strongly in the neuron-like CA77 cells (Figure 4C). This result, coupled with the lack of effect of overexpression of TIA-1 on exon 4 inclusion in CA77 cells, implies that other factors in these cells may contribute to the apparently stronger interaction of Hu proteins with the target in these cells. We demonstrated previously that TIA-1/TIAR binding at this particular U-tract sequence depends on the interaction between U1 Small nuclear ribonucleoprotein (snRNP) and a pseudo-5′ splice site sequence located immediately upstream of the U-tract (Zhu et al., 2003 blue right-pointing triangle). The reported direct interaction between U1C and TIA-1 is a likely liaison between U1 snRNP and TIA-1/TIAR in the calcitonin/CGRP system (Forch et al., 2002 blue right-pointing triangle). In CA77 cells, this interaction may be blocked by Hu proteins, thereby leading to reduced binding of TIA-1/TIAR to the U-tract, indicated by the cross-linking/IP analysis. It is also possible that other neuron-specific factors exist to help Hu proteins outcompete TIA-1/TIAR proteins.

It seems that the major function of Hu proteins upon binding to the intronic U-tract sequence in neuronal or neuron-like cells, such as CA77 cells, is to block the activity of TIA-1/TIAR proteins, which would otherwise promote the inclusion of the calcitonin exon 4 (Figure 5C). Of particular note is the fact that in the experiment where TIA-1-Rev fusion protein is cotransfected with the RRE-containing reporter construct into CA77 cells, Hu proteins are presumably still able to bind the U-tract immediately downstream of the RRE stem-loop structure. However, such binding does not impact the inclusion of the calcitonin exon if TIA-1-Rev is present. Likewise, increasing amounts of HuC protein did not change the outcome either if TIA-1-Rev is present (Figure 5C).

If the major function of Hu proteins is to block TIA-1 and TIAR proteins, why does the RRM3 domain, but not the RRM1 and RRM2 domains together, have a dominant-negative effect? The lack of a dominant-negative effect by RRM1 and RRM2 can be explained by the fact that this protein, although binding to RNA specifically, has lowered binding affinity as judged by RNA gel-shift analysis (our unpublished data). Consistent with our results, the study by Chung et al. (1996) blue right-pointing triangle demonstrated that the RNA-binding affinity of the HuD full-length protein is almost 8 times greater than that of the HuDRRM1+ 2 protein. It is unclear at present how the RRM3 and hinge domains of Hu proteins functions as a dominant-negative protein. However, a hint came from the following studies. In one study, RRM3 of the human HuB protein interferes with the multimerization of the full-length proteins (Gao and Keene, 1996 blue right-pointing triangle). Two other studies indicated that HuD as well as ELAV, the Drosophila homologue of Hu proteins, exist as multimers (Kasashima et al., 2002 blue right-pointing triangle; Soller and White, 2005 blue right-pointing triangle). The study on ELAV further demonstrated that binding of the multimerized ELAV on ewg RNA is functionally important (Soller and White, 2005 blue right-pointing triangle). Thus, it is very tempting to suggest that multimerzation of Hu proteins is important for their functions as RNA processing factors, and overexpression of the RRM3 and hinge domains interferes with multimerization of the full-length proteins, which causes its dominant-negative effect.

Although in RNA gel mobility shift assay, recombinant proteins of the three neuron-specific Hu proteins show strong affinity for the calcitonin/CGRP intronic element containing the U-rich sequence (our unpublished data), our cell transfection experiments did not distinguish effect by individual Hu proteins (Figures 5 and and6).6). In CGRP-producing neurons, including hippocampus, dorsal root ganglia, and spinal cord, all three of the neuron-specific Hu proteins, HuB, HuC, and HuD, are present in adult mice (Okano and Darnell, 1997 blue right-pointing triangle). A recent study using HuD-deficient mice demonstrated that HuD is involved at multiple stages during neuronal development. However, no difference of expression of several Hu protein targets was detected, suggesting at least a partial functional redundancy of Hu family proteins (Akamatsu et al., 2005 blue right-pointing triangle).

The precise role of TIA-1/TIAR in promoting the nonneuronal inclusion of calcitonin/CGRP exon 4 is not clear. We propose that TIA-1/TIAR may play one of the two roles: inhibit recognition of the 3′ splice site of exon 5, or enhance recognition of the 3′ splice site of exon 4 (Zhu et al., 2003 blue right-pointing triangle). In addition to the function mediated by intronic element, TIA-1/TIAR have been shown to promote authentic 5′ splice site recognition by U1 snRNP (Del Gatto-Konczak et al., 2000 blue right-pointing triangle; Forch et al., 2000 blue right-pointing triangle; Le Guiner et al., 2001 blue right-pointing triangle). In those examples, the TIA-1/TIAR binding sites are located immediately downstream of suboptimal 5′ splice sites. Recent studies demonstrate an emerging theme of regulated alternative splicing by competing activities of TIA-1 and PTB. In one example, the two proteins bind to two different RNA sequences on the Fas pre-mRNA and have opposing activities in regulating the fate of Fas exon 6 (Izquierdo et al., 2005 blue right-pointing triangle). In the other two examples, TIA-1 and PTB compete for binding at the same intronic sequences following the 5′ splice sites (Zuccato et al., 2004 blue right-pointing triangle; Shukla et al., 2005 blue right-pointing triangle). The competing nature of binding of Hu and TIA-1/TIAR proteins at similar target sequence may be a wide spread phenomenon of neuron-specific alternatively spliced exons. Conceptually, it is likely that a subset of alternatively spliced exons is controlled by the competing activity of these two groups of proteins. However, at this point, it remains possible that other AU-rich sequence-binding proteins that we did not examine may also be involved in regulated RNA processing.

Experiments reported in this communication reveal a functional role of Hu proteins in regulating the neuron-specific alternative RNA processing of the calcitonin/CGRP pre-mRNA. However, although Hu proteins are necessary for the regulation, they are not sufficient. In HeLa cells, overexpression of Hu proteins, alone or in combination, did not switch the RNA processing phenotype (our unpublished data). This result suggests that other proteins may also be required for regulation in neurons. There is precedent that more than one neuron-specific protein is needed to include an alternative exon. At least two neuron-enriched proteins, nPTB and Fox-1, are required for inclusion of the c-src N1 exon in neurons (Markovtsov et al., 2000 blue right-pointing triangle; Underwood et al., 2005 blue right-pointing triangle).

Experiments using cell lines, embryos, and knockout mice demonstrated that Hu proteins are involved in early neuronal differentiation (Wakamatsu and Weston, 1997 blue right-pointing triangle; Akamatsu et al., 1999 blue right-pointing triangle, 2005 blue right-pointing triangle; Anderson et al., 2000 blue right-pointing triangle). Because some of the neuron-specific members of the Hu protein family have been shown to regulate mRNA stability and translation, it was postulated that the function of Hu proteins during neuron differentiation is to stabilize or promote translation of those mRNAs involved in neuronal function, such as the growth-associated protein-43 and neurofilament M, through binding at the AU-rich element located in 3′ UTR (Antic et al., 1999 blue right-pointing triangle; Anderson et al., 2000 blue right-pointing triangle). Our results define the first nuclear function of Hu proteins and therefore suggest a novel mechanism by which Hu proteins regulate neuronal differentiation. It is entirely possible that Hu proteins regulate expression of genes associated with neuronal differentiation or maintenance by affecting alternative splicing of their pre-mRNAs. It is therefore of great importance to identify additional targets of Hu proteins and study the role of Hu proteins in regulating alternative splicing of these Hu target-containing pre-mRNAs. Our initial search of the alternative splicing database identified several neuron-specific alternatively spliced exons that are surrounded by U-rich sequences. Experiments are under way to investigate the role of Hu proteins in regulating these alternative splicing events.

Our studies reported here add Hu proteins to the currently very short list of tissue-specific RNA processing regulators. Additional studies of these proteins will provide significant insight into the regulatory mechanisms of neuron-specific alternative RNA processing.

ACKNOWLEDGMENTS

We thank the following individuals for providing cell lines, antibody, and plasmids: Alison Hall and Andrew Russo (CA77), Lloyd Culp (SK-N-SH), Gary Landreth (PC12), Jerome Posner (Hu patient sera), Ite Laird-Offringa (HuD plasmid), and Christine Herrmann (PC12-Rev). We thank Helen Salz, and Jo Ann Wise for critical reading of the manuscript. This work was supported by National Science Foundation Grant MCB-0237685 and National Institutes of Health Grant to H.L. (NS-049103-01). H.Z. is supported by a predoctoral fellowship from American Heart Association.

Abbreviations used:

CGRP
calcitonin gene-related peptide.

Footnotes

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-02-0099) on October 11, 2006.

REFERENCES

  • Adema G. J., van Hulst K. L., Baas P. D. Uridine branch acceptor is a cis-acting element involved in regulation of the alternative processing of calcitonin/CGRP-l pre-mRNA. Nucleic Acids Res. 1990;18:5365–5373. [PMC free article] [PubMed]
  • Akamatsu W., et al. The RNA-binding protein HuD regulates neuronal cell identity and maturation. Proc. Natl. Acad. Sci. USA. 2005;102:4625–4630. [PubMed]
  • Akamatsu W., Okano H. J., Osumi N., Inoue T., Nakamura S., Sakakibara S., Miura M., Matsuo N., Darnell R. B., Okano H. Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc. Natl. Acad. Sci. USA. 1999;96:9885–9890. [PubMed]
  • Anderson K. D., Morin M. A., Beckel-Mitchener A., Mobarak C. D., Neve R. L., Furneaux H. M., Burry R., Perrone-Bizzozero N. I. Overexpression of HuD, but not of its truncated form HuD I+II, promotes GAP-43 gene expression and neurite outgrowth in PC12 cells in the absence of nerve growth factor. J. Neurochem. 2000;75:1103–1114. [PubMed]
  • Antic D., Lu N., Keene J. D. ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells. Genes Dev. 1999;13:449–461. [PubMed]
  • Ashiya M., Grabowski P. J. A neuron-specific splicing switch mediated by an array of pre-mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart. RNA. 1997;3:996–1015. [PubMed]
  • Bennett M. M., Amara S. G. Molecular mechanisms of cell-specific and regulated expression of the calcitonin/alpha-CGRP and beta-CGRP genes. Ann. NY Acad. Sci. 1992;657:36–49. [PubMed]
  • Black D. L., Grabowski P. J. Alternative pre-mRNA splicing and neuronal function. Prog. Mol. Subcell. Biol. 2003;31:187–216. [PubMed]
  • Bovenberg R. A., van de Meerendonk W. P., Baas P. D., Steenbergh P. H., Lips C. J., Jansz H. S. Model for alternative RNA processing in human calcitonin gene expression. Nucleic Acids Res. 1986;14:8785–8803. [PMC free article] [PubMed]
  • Brennan C. M., Steitz J. A. HuR and mRNA stability. Cell Mol. Life Sci. 2001;58:266–277. [PubMed]
  • Buckanovich R. J., Yang Y. Y., Darnell R. B. The onconeural antigen Nova-1 is a neuron-specific RNA-binding protein, the activity of which is inhibited by paraneoplastic antibodies. J. Neurosci. 1996;16:1114–1122. [PubMed]
  • Burry R. W., Smith C. L. HuD distribution changes in response to heat-shock, but not neurotrophic stimulation. J. Histochem. Cytochem. 2006;54:1129–1138. [PubMed]
  • Chung S., Jiang L., Cheng S., Furneaux H. Purification and properties of HuD, a neuronal RNA-binding protein. J. Biol. Chem. 1996;271:11518–11524. [PubMed]
  • Del Gatto-Konczak F., Bourgeois C. F., Le Guiner C., Kister L., Gesnel M. C., Stevenin J., Breathnach R. The RNA-binding protein TIA-1 is a novel mammalian splicing regulator acting through intron sequences adjacent to a 5′ splice site. Mol. Cell. Biol. 2000;20:6287–6299. [PMC free article] [PubMed]
  • Dredge B. K., Darnell R. B. Nova regulates GABA(A) receptor gamma2 alternative splicing via a distal downstream UCAU-rich intronic splicing enhancer. Mol. Cell. Biol. 2003;23:4687–4700. [PMC free article] [PubMed]
  • Fan X. C., Steitz J. A. HNS, a nuclear-cytoplasmic shuttling sequence in HuR. Proc. Natl. Acad. Sci. USA. 1998;95:15293–15298. [PubMed]
  • Forch P., Puig O., Kedersha N., Martinez C., Granneman S., Seraphin B., Anderson P., Valcarcel J. The apoptosis-promoting factor TIA-1 is a regulator of alternative pre-mRNA splicing. Mol. Cell. 2000;6:1089–1098. [PubMed]
  • Forch P., Puig O., Martinez C., Seraphin B., Valcarcel J. The splicing regulator TIA-1 interacts with U1-C to promote U1 snRNP recruitment to 5′ splice sites. EMBO J. 2002;21:6882–6892. [PubMed]
  • Gallouzi I. E., Brennan C. M., Steitz J. A. Protein ligands mediate the CRM1-dependent export of HuR in response to heat shock. RNA. 2001;7:1348–1361. [PubMed]
  • Gao F. B., Keene J. D. Hel-N1/Hel-N2 proteins are bound to poly(A)+ mRNA in granular RNP structures and are implicated in neuronal differentiation. J. Cell Sci. 1996;109:579–589. [PubMed]
  • Grabowski P. J., Black D. L. Alternative RNA splicing in the nervous system. Prog. Neurobiol. 2001;65:289–308. [PubMed]
  • Izquierdo J. M., Majos N., Bonnal S., Martinez C., Castelo R., Guigo R., Bilbao D., Valcarcel J. Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition. Mol. Cell. 2005;19:475–484. [PubMed]
  • Jain R. G., Andrews L. G., McGowan K. M., Pekala P. H., Keene J. D. Ectopic expression of Hel-N1, an RNA-binding protein, increases glucose transporter (GLUT1) expression in 3T3-L1 adipocytes. Mol. Cell. Biol. 1997;17:954–962. [PMC free article] [PubMed]
  • Jensen K. B., Dredge B. K., Stefani G., Zhong R., Buckanovich R. J., Okano H. J., Yang Y. Y., Darnell R. B. Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron. 2000;25:359–371. [PubMed]
  • Johnson J. M., Castle J., Garrett-Engele P., Kan Z., Loerch P. M., Armour C. D., Santos R., Schadt E. E., Stoughton R., Shoemaker D. D. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science. 2003;302:2141–2144. [PubMed]
  • Kasashima K., Sakashita E., Saito K., Sakamoto H. Complex formation of the neuron-specific ELAV-like Hu RNA-binding proteins. Nucleic Acids Res. 2002;30:4519–4526. [PMC free article] [PubMed]
  • Kasashima K., Terashima K., Yamamoto K., Sakashita E., Sakamoto H. Cytoplasmic localization is required for the mammalian ELAV-like protein HuD to induce neuronal differentiation. Genes Cells. 1999;4:667–683. [PubMed]
  • Keene J. D. Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome. Proc. Natl. Acad. Sci. USA. 2001;98:7018–7024. [PubMed]
  • Kullmann M., Gopfert U., Siewe B., Hengst L. ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5′UTR. Genes Dev. 2002;16:3087–3099. [PubMed]
  • Le Guiner C., Lejeune F., Galiana D., Kister L., Breathnach R., Stevenin J., Del Gatto-Konczak F. TIA-1 and TIAR activate splicing of alternative exons with weak 5′ splice sites followed by a U-rich stretch on their own pre-mRNAs. J. Biol. Chem. 2001;276:40638–40646. [PubMed]
  • Leff S. E., Evans R. M., Rosenfeld M. G. Splice commitment dictates neuron-specific alternative RNA processing in calcitonin/CGRP gene expression. Cell. 1987;48:517–524. [PubMed]
  • Levine T. D., Gao F., King P. H., Andrews L. G., Keene J. D. Hel-N 1, an autoimmune RNA-binding protein with specificity for 3′ uridylate-rich untranslated regions of growth factor mRNAs. Mol. Cell. Biol. 1993;13:3494–3504. [PMC free article] [PubMed]
  • Lipscombe D. Neuronal proteins custom designed by alternative splicing. Curr. Opin. Neurobiol. 2005;15:358–363. [PubMed]
  • Lisbin M. J., Qiu J., White K. The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA. Genes Dev. 2001;15:2546–2561. [PubMed]
  • Lou H., Gagel R. F. Mechanism of tissue-specific alternative RNA processing of the calcitonin CGRP gene. Front. Horm. Res. 1999;25:18–33. [PubMed]
  • Lou H., Gagel R. F., Berget S. M. An intron enhancer recognized by splicing factors activates polyadenylation. Genes Dev. 1996;10:208–219. [PubMed]
  • Lou H., Neugebauer K. M., Gagel R. F., Berget S. M. Regulation of alternative polyadenylation by U1 snRNPs and SRp20. Mol. Cell. Biol. 1998;18:4977–4985. [PMC free article] [PubMed]
  • Lou H., Yang Y., Cote G. J., Berget S. M., Gagel R. F. An intron enhancer containing a 5′ splice site sequence in the human calcitonin/calcitonin gene-related peptide gene. Mol. Cell. Biol. 1995;15:7135–7142. [PMC free article] [PubMed]
  • Markovtsov V., Nikolic J. M., Goldman J. A., Turck C. W., Chou M. Y., Black D. L. Cooperative assembly of an hnRNP complex induced by a tissue-specific homolog of polypyrimidine tract binding protein. Mol. Cell. Biol. 2000;20:7463–7479. [PMC free article] [PubMed]
  • Modrek B., Lee C. A genomic view of alternative splicing. Nat. Genet. 2002;30:13–19. [PubMed]
  • Myer V. E., Fan X. C., Steitz J. A. Identification of HuR as a protein implicated in AUUUA-mediated mRNA decay. EMBO J. 1997;16:2130–2139. [PubMed]
  • Okano H. J., Darnell R. B. A hierarchy of Hu RNA binding proteins in developing and adult neurons. J. Neurosci. 1997;17:3024–3037. [PubMed]
  • Perrone-Bizzozero N., Bolognani F. Role of HuD and other RNA-binding proteins in neural development and plasticity. J. Neurosci. Res. 2002;68:121–126. [PubMed]
  • Polydorides A. D., Okano H. J., Yang Y. Y., Stefani G., Darnell R. B. A brain-enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing. Proc. Natl. Acad. Sci. USA. 2000;97:6350–6355. [PubMed]
  • Posner J. B., Dalmau J. Paraneoplastic syndromes. Curr. Opin. Immunol. 1997;9:723–729. [PubMed]
  • Roesser J. R. Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene. RNA. 2004;10:1243–1250. [PubMed]
  • Roesser J. R., Liittschwager K., Leff S. E. Regulation of tissue-specific splicing of the calcitonin/calcitonin gene-related peptide gene by RNA-binding proteins. J. Biol. Chem. 1993;268:8366–8375. [PubMed]
  • Rosenfeld M. G., Emeson R. B., Yeakley J. M., Merillat N., Hedjran F., Lenz J., Delsert C. Calcitonin gene-related peptide: a neuropeptide generated as a consequence of tissue-specific, developmentally regulated alternative RNA processing events. Ann. NY Acad. Sci. 1992;657:1–17. [PubMed]
  • Rosenfeld M. G., Lin C. R., Amara S. G., Stolarsky L., Roos B. A., Ong E. S., Evans R. M. Calcitonin mRNA polymorphism: peptide switching associated with alternative RNA splicing events. Proc Natl. Acad. Sci. USA. 1982;79:1717–1721. [PubMed]
  • Russo A. F., Lanigan T. M., Sullivan B. E. Neuronal properties of a thyroid C-cell line: partial repression by dexamethasone and retinoic acid. Mol. Endocrinol. 1992;6:207–218. [PubMed]
  • Sharma S., Falick A. M., Black D. L. Polypyrimidine tract binding protein blocks the 5′ splice site-dependent assembly of U2AF and the prespliceosomal E complex. Mol. Cell. 2005;19:485–496. [PMC free article] [PubMed]
  • Shukla S., Del Gatto-Konczak F., Breathnach R., Fisher S. A. Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1. RNA. 2005;11:1725–1736. [PubMed]
  • Soller M., White K. ELAV inhibits 3′-end processing to promote neural splicing of ewg pre-mRNA. Genes Dev. 2003;17:2526–2538. [PubMed]
  • Soller M., White K. ELAV multimerizes on conserved AU4-6 motifs important for ewg splicing regulation. Mol. Cell. Biol. 2005;25:7580–7591. [PMC free article] [PubMed]
  • Strickland S., Mahdavi V. The induction of differentiation in teratocarcinoma stem cells by retinoic acid. Cell. 1978;15:393–403. [PubMed]
  • Szabo A., Dalmau J., Manley G., Rosenfeld M., Wong E., Henson J., Posner J. B., Furneaux H. M. HuD, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is homologous to Elav and Sex-lethal. Cell. 1991;67:325–333. [PubMed]
  • Tiley L. S., Madore S. J., Malim M. H., Cullen B. R. The VP16 transcription activation domain is functional when targeted to a promoter-proximal RNA sequence. Genes Dev. 1992;6:2077–2087. [PubMed]
  • Tran Q., Coleman T. P., Roesser J. R. Human transformer 2beta and SRp55 interact with a calcitonin-specific splice enhancer. Biochim. Biophys. Acta. 2003;1625:141–152. [PubMed]
  • Tran Q., Roesser J. R. SRp55 is a regulator of calcitonin/CGRP alternative RNA splicing. Biochemistry. 2003;42:951–957. [PubMed]
  • Ule J., Jensen K. B., Ruggiu M., Mele A., Ule A., Darnell R. B. CLIP identifies Nova-regulated RNA networks in the brain. Science. 2003;302:1212–1215. [PubMed]
  • Ule J., et al. Nova regulates brain-specific splicing to shape the synapse. Nat. Genet. 2005;37:844–852. [PubMed]
  • Underwood J. G., Boutz P. L., Dougherty J. D., Stoilov P., Black D. L. Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals. Mol. Cell. Biol. 2005;25:10005–10016. [PMC free article] [PubMed]
  • Wakamatsu Y., Weston J. A. Sequential expression and role of Hu RNA-binding proteins during neurogenesis. Development. 1997;124:3449–3460. [PubMed]
  • Wu J. I., Reed R. B., Grabowski P. J., Artzt K. Function of quaking in myelination: regulation of alternative splicing. Proc. Natl. Acad. Sci. USA. 2002;99:4233–4238. [PubMed]
  • Xu Q., Modrek B., Lee C. Genome-wide detection of tissue-specific alternative splicing in the human transcriptome. Nucleic Acids Res. 2002;30:3754–3766. [PMC free article] [PubMed]
  • Zhang L., Liu W., Grabowski P. J. Coordinate repression of a trio of neuron-specific splicing events by the splicing regulator PTB. RNA. 1999;5:117–130. [PubMed]
  • Zhang W., Liu H., Han K., Grabowski P. J. Region-specific alternative splicing in the nervous system: implications for regulation by the RNA-binding protein NAPOR. RNA. 2002;8:671–685. [PubMed]
  • Zhu H., Hasman R. A., Young K. M., Kedersha N. L., Lou H. U1 snRNP-dependent function of TIAR in the regulation of alternative RNA processing of the human calcitonin/CGRP pre-mRNA. Mol. Cell. Biol. 2003;23:5959–5971. [PMC free article] [PubMed]
  • Zuccato E., Buratti E., Stuani C., Baralle F. E., Pagani F. An intronic polypyrimidine-rich element downstream of the donor site modulates cystic fibrosis transmembrane conductance regulator exon 9 alternative splicing. J. Biol. Chem. 2004;279:16980–16988. [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology