PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of narLink to Publisher's site
 
Nucleic Acids Res. 1996 October 15; 24(20): 4029–4033.
PMCID: PMC146212

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

Abstract

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.

Full Text

The Full Text of this article is available as a PDF (83K).

Selected References

These references are in PubMed. This may not be the complete list of references from this article.
  • Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell. 1985 Dec;43(2 Pt 1):405–413. [PubMed]
  • Morin GB. The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell. 1989 Nov 3;59(3):521–529. [PubMed]
  • Counter CM, Hirte HW, Bacchetti S, Harley CB. Telomerase activity in human ovarian carcinoma. Proc Natl Acad Sci U S A. 1994 Apr 12;91(8):2900–2904. [PubMed]
  • Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, Shay JW. Specific association of human telomerase activity with immortal cells and cancer. Science. 1994 Dec 23;266(5193):2011–2015. [PubMed]
  • Broccoli D, Young JW, de Lange T. Telomerase activity in normal and malignant hematopoietic cells. Proc Natl Acad Sci U S A. 1995 Sep 26;92(20):9082–9086. [PubMed]
  • Williamson JR, Raghuraman MK, Cech TR. Monovalent cation-induced structure of telomeric DNA: the G-quartet model. Cell. 1989 Dec 1;59(5):871–880. [PubMed]
  • Sundquist WI, Klug A. Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops. Nature. 1989 Dec 14;342(6251):825–829. [PubMed]
  • Kang C, Zhang X, Ratliff R, Moyzis R, Rich A. Crystal structure of four-stranded Oxytricha telomeric DNA. Nature. 1992 Mar 12;356(6365):126–131. [PubMed]
  • Schultze P, Smith FW, Feigon J. Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG). Structure. 1994 Mar 15;2(3):221–233. [PubMed]
  • Leroy JL, Guéron M, Mergny JL, Hélène C. Intramolecular folding of a fragment of the cytosine-rich strand of telomeric DNA into an i-motif. Nucleic Acids Res. 1994 May 11;22(9):1600–1606. [PMC free article] [PubMed]
  • Giraldo R, Rhodes D. The yeast telomere-binding protein RAP1 binds to and promotes the formation of DNA quadruplexes in telomeric DNA. EMBO J. 1994 May 15;13(10):2411–2420. [PubMed]
  • Giraldo R, Suzuki M, Chapman L, Rhodes D. Promotion of parallel DNA quadruplexes by a yeast telomere binding protein: a circular dichroism study. Proc Natl Acad Sci U S A. 1994 Aug 2;91(16):7658–7662. [PubMed]
  • Coren JS, Epstein EM, Vogt VM. Characterization of a telomere-binding protein from Physarum polycephalum. Mol Cell Biol. 1991 Apr;11(4):2282–2290. [PMC free article] [PubMed]
  • Zhong Z, Shiue L, Kaplan S, de Lange T. A mammalian factor that binds telomeric TTAGGG repeats in vitro. Mol Cell Biol. 1992 Nov;12(11):4834–4843. [PMC free article] [PubMed]
  • Chong L, van Steensel B, Broccoli D, Erdjument-Bromage H, Hanish J, Tempst P, de Lange T. A human telomeric protein. Science. 1995 Dec 8;270(5242):1663–1667. [PubMed]
  • Raghuraman MK, Cech TR. Assembly and self-association of oxytricha telomeric nucleoprotein complexes. Cell. 1989 Nov 17;59(4):719–728. [PubMed]
  • Price CM. Telomere structure in Euplotes crassus: characterization of DNA-protein interactions and isolation of a telomere-binding protein. Mol Cell Biol. 1990 Jul;10(7):3421–3431. [PMC free article] [PubMed]
  • Sheng H, Hou Z, Schierer T, Dobbs DL, Henderson E. Identification and characterization of a putative telomere end-binding protein from Tetrahymena thermophila. Mol Cell Biol. 1995 Mar;15(3):1144–1153. [PMC free article] [PubMed]
  • Schierer T, Henderson E. A protein from Tetrahymena thermophila that specifically binds parallel-stranded G4-DNA. Biochemistry. 1994 Mar 1;33(8):2240–2246. [PubMed]
  • Petracek ME, Konkel LM, Kable ML, Berman J. A Chlamydomonas protein that binds single-stranded G-strand telomere DNA. EMBO J. 1994 Aug 1;13(15):3648–3658. [PubMed]
  • Cardenas ME, Bianchi A, de Lange T. A Xenopus egg factor with DNA-binding properties characteristic of terminus-specific telomeric proteins. Genes Dev. 1993 May;7(5):883–894. [PubMed]
  • Gualberto A, Patrick RM, Walsh K. Nucleic acid specificity of a vertebrate telomere-binding protein: evidence for G-G base pair recognition at the core-binding site. Genes Dev. 1992 May;6(5):815–824. [PubMed]
  • Weisman-Shomer P, Fry M. QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA. J Biol Chem. 1993 Feb 15;268(5):3306–3312. [PubMed]
  • Ishikawa F, Matunis MJ, Dreyfuss G, Cech TR. Nuclear proteins that bind the pre-mRNA 3' splice site sequence r(UUAG/G) and the human telomeric DNA sequence d(TTAGGG)n. Mol Cell Biol. 1993 Jul;13(7):4301–4310. [PMC free article] [PubMed]
  • Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983 Mar 11;11(5):1475–1489. [PMC free article] [PubMed]
  • Tommerup H, Dousmanis A, de Lange T. Unusual chromatin in human telomeres. Mol Cell Biol. 1994 Sep;14(9):5777–5785. [PMC free article] [PubMed]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press