A conditionally toxic substrate vector was designed to possess ten 5′-GCTGCCGC-3′ cleavage sites (Figure 3). The vector carries a modified
E.coli yidC gene and the product acts as a bacteriostat when overproduced by Isopropyl-β-
d-thiogalactopyranoside (IPTG) induction of gene expression and vector copy number. In earlier studies, overproduction of 6His-YidC from pPROEX-HTb (Invitrogen) was found to arrest the growth of
E.coli in exponential phase (
20). Likewise, cells carrying pPROEX-
6hisyidC do not form colonies when plated on LB-agar containing ≥50 µM IPTG. The wt
yidC gene was transferred to vector pR976 (P. Riggs, NEB) using the cloning sites NcoI and EcoRI. A DNA linker was ligated into the NcoI site of pR976-
yidC to provide multiple 5′-GCTGCCGC-3′ substrate sites and to provide coding sequence for additional N-terminal amino acids, notably histidine residues. The insertion clones were tested for conditional-toxicity in strain ER1992 by streaking on LB-agar containing IPTG. Clone p15A-TC1E imposed lethality at 1 mM IPTG and was subsequently sequenced to find 2 linkers and thus four 5′-GCTGCCGC-3′ substrate sites at the beginning of the
yidC gene. The coding strand linker sequence is 5′-P-CATG
GCTGCCGCGTACTACCACCACCACCTCGATTACGATATCCCAACGACCGAAAACCTGTATTTT
GCTGCCGC-3′. The antisense strand linker sequence is 5′P-CATG
GCGGCAGCAAAATACAGGTTTTCGGTCGTTGGGATATCGTAATCGAGGTGGTGGTGGTAGTAC
GCGGCAGC-3′ (substrate sites are underlined). Insertion of 2 linkers results in the following extension to the N-terminus of YidC: NH
2-MAAAYYHHHLDYDIPTTENLYFAAAMAAAYYHHHLDYDIPTTENLYFAAA-. The
lacI-yidC gene pair was amplified from p15A-TC1E by KOD HiFi DNA polymerase (Novagen) using forward and reverse primers both containing one 5′-GCTGCCGC-3′ substrate site. The
lacI primer anneals to the
lacI promoter sequence and creates the
lacIq mutation (C→T). The
lacIq primer sequence is 5′-GTGACTGAATTC
GCTGCCGCCACCATCGAATGGTGCAAAACCTTTCGCG-3′. The
yidC reverse primer sequence is 5′-GAGCTCGAATTCGAA
GCTGCCGCTTCCAATTGGTGTGGCGGATGC-3′. The toxic operon (
lacIq-P
tac-yidC) was cloned into vector pBAClac832, whose copy number is controlled by LacI repression/IPTG induction. Vector pBAClac832 was created by combining seqments of pFOS1 (NEB) and a modified pUC18. Vector pUC18 was first modified by replacing the ori RNAII promoter with the
lacZ operator/promoter sequence. Next, the BspHI site at position 2534 was destroyed, which enabled reversal of the ampicillin resistance gene (
bla) by digestion at BspHI sites 1526 and 2639. Reversal of the
bla gene eliminates read-through transcription from priming plasmid replication. After
bla reversal, IPTG-dependent replication of this pUC18 derivative was confirmed in strain ER2502 (LacI
+). Further modification to pUC18 consisted of ligating two substrate linkers into the PciI site to insert four 5′-GCTGCCGC-3′ sites. The modified pUC origin and
bla gene were excised by SfoI–SalI digestion and ligated into the HpaI site and the SalI site (at position 2560) of pFOS1 to create pBAClac832. The toxic operon (
lacIq-P
tac-yidC) was EcoRI-digested and cloned into the EcoRI sites of pBAClac832 to create the final selection vector ptoxBAC832 (Figure 3). Single copy replication (without IPTG) was verified by comparing DNA yields of ptoxBAC832 to a low-copy reference plasmid after co-propagation in Luria–Bertani (LB) media containing 0.2% glucose. The addition of 0.2% glucose is reported to limit the copy number of BAC clones to one copy (
21). The selection strain was derived from ER1992 (
22), a DNA-damage indicator strain. In addition to carrying the toxic selection vector, the selection strain also carried a plasmid expressing M.EagI (
23) to protect the NotI and EagI sites within the
E.coli chromosome. ER1992 was first transformed with pSYX20-
eagIM (Tet
R) followed by transformation with ptoxFOS832 to yield the final selection strain. The selection strain was propagated in LB (0.2% glucose) plus 15 µg/ml tetracycline and 50 µg/ml carbenicillin (Cb). Note that the selection strain does not grow at higher levels of carbenicillin or ampicillin as a result of the
bla promoter modification (BspHI site mutagenesis). Electro-competent cells ER1992 [pSYX20-
eagIM, ptoxBAC832] were prepared by washing two times with ice-cold 10% glycerol after growth to OD
600 = 0.8. After growth to OD
600 = 0.8, toxic vector maintenance was analyzed by diluting the cell culture and plating on LB, LB + IPTG, LB + Cb and LB + Cb + IPTG. Under conditions used in the selection (LB + IPTG), loss of toxicity was found to occur at a frequency of 0.7% primarily due to loss of the entire vector. When plated on LB + Cb + IPTG, loss of toxicity occurs at a frequency of 1 × 10
−4. This indicates that mutation/deletion of
tox-yidC is rare since toxicity is maintained when the
bla gene is maintained.