PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of plosbiolPLoS BiologySubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)View this Article
 
PLoS Biol. 2006 January; 4(1): e10.
Published online 2005 December 20. doi:  10.1371/journal.pbio.0040010
PMCID: PMC1310653

Ets1-Related Protein Is a Key Regulator of Vasculogenesis in Zebrafish

Derek Stemple, Academic Editor

Abstract

During embryonic development, multiple signaling pathways control specification, migration, and differentiation of the vascular endothelial cell precursors, angioblasts. No single gene responsible for the commitment of mesenchymal cells to the angioblast cell fate has been identified as yet. Here we report characterization and functional studies of Etsrp, a novel zebrafish ETS domain protein. etsrp embryonic expression is only restricted to vascular endothelial cells and their earliest precursors. Morpholino knockdown of Etsrp protein function resulted in the complete absence of circulation in zebrafish embryos. Angioblasts in etsrp–morpholino-injected embryos (morphants) failed to undergo migration and differentiation and did not coalesce into functional blood vessels. Expression of all vascular endothelial molecular markers tested was severely reduced in etsrp morphants, whereas hematopoietic markers were not affected. Overexpression of etsrp RNA caused multiple cell types to express vascular endothelial markers. etsrp RNA restored expression of vascular markers in cloche mutants, defective in hematopoietic and endothelial cell formation, arguing that etsrp functions downstream of cloche in angioblast formation. etsrp gene function was also required for endothelial marker induction by the vascular endothelial growth factor (vegf) and stem cell leukemia (scl/tal1). These results demonstrate that Etsrp is necessary and sufficient for the initiation of vasculogenesis.

Introduction

Vasculogenesis, or formation of vascular endothelial cells de novo, begins very early after the initiation of gastrulation in a vertebrate embryo. In a mammalian embryo, vasculogenesis starts with the formation of the blood islands in the yolk sac and angioblast precursors in the head mesenchyme [1]. In the zebrafish, the first angioblasts arise from the lateral plate mesoderm, migrate to the trunk midline between ten- and 15-somite stages in response to hedgehog signaling, and coalesce to form the primary axial vessels of the trunk, the dorsal aorta, and the cardinal vein [24]. During subsequent angiogenesis, the axial vessels sprout to form secondary vessels in the trunk region of a zebrafish embryo [5]. In the zebrafish, as well as the mammalian yolk sac, there is a close association between the primitive hematopoietic cells and the developing endothelium, suggestive of a common precursor, the hemangioblast [6]. Zebrafish cloche mutants lack nearly all blood and endothelial cells suggesting that the hemangioblast lineage has been affected [7,8]. A basic helix-loop-helix transcription factor Scl/tal1 is expressed in hematopoietic and endothelial cells in both mouse and zebrafish suggesting a possible role in specification of the hemangioblast [912]. Recent knockdown analysis has demonstrated its essential function in blood and dorsal aorta formation in zebrafish embryos [13,14].

Members of the Ets family of transcription factors play multiple roles during vasculogenesis, angiogenesis, and hematopoiesis [15]. They share a conserved DNA-binding domain of 85 amino acids which folds into a winged helix-turn-helix motif. Ets1, the founding member of the family, is expressed in the embryonic endothelial cells as well as putative hemangioblasts, lymphoid precursors, and myeloid hematopoietic cells [1619]. The expression of Ets1 transcripts is associated in vivo with the activation of endothelial cells and the induction of angiogenesis. In vitro, Ets1 is expressed by proliferating and migrating endothelial cells but not after these cells have reached confluence [20,21]. In endothelial cells in vitro, Ets1 has been shown to regulate expression of the two vascular endothelial growth factor (Vegf) receptors Flt1 and Flk1 [22,23], the endothelial cell-specific adhesion protein VE-cadherin [24], the vascular-specific tyrosine kinases Tie1 and Tie2 [25], and numerous other target genes [15]. Ets1 antisense oligonucleotides inhibited angiogenesis in vitro [26,27]. However, no defects in vascular development have been found in the mouse embryos, nearly completely deficient in Ets1 function [28,29]. Therefore, the function of Ets1 in vascular development in vivo, if any, remains unclear.

A different Ets family member Fli1 has been implicated in mouse megakaryopoiesis, hemostasis, and maintenance of vascular integrity [30,31]. Zebrafish fli1 homolog is expressed during early somitogenesis in the putative hemangioblast cells, while later being restricted to vascular endothelial cells [32].

Recently, an endothelial-cell-specific Ets1-related zebrafish protein Etsrp has been identified [33]. In the current study, we demonstrate a critical role of Etsrp during vasculogenesis. In the absence of Etsrp, angioblast precursors fail to migrate, differentiate, and coalesce into functional vessels. Furthermore, ectopic expression of etsrp is sufficient to induce endothelial markers in a variety of different cell types throughout the embryo. These results suggest that Etsrp functions as a critical regulatory gene, directing etsrp-expressing cells to adopt vascular endothelial cell fate during embryonic development.

Results

Etsrp Encodes a Novel Ets1-Related Protein

A novel Ets1-related protein Etsrp has been identified in a recent microarray study of the zebrafish cloche mutants [33]. We performed detailed analysis of the protein sequence and its developmental expression pattern. Etsrp-predicted protein sequence contains 366 amino acids and displays 29% identity (37% similarity) to the human Ets1 protein and 26% identity (34% similarity) to the human Ets2 (Figure 1A) (unpublished data). Although Etsrp and hEts1 proteins are 88% similar within the ETS domain region (Figure 1A), there is little similarity between the two proteins within the rest of the sequence, therefore Etsrp may not be a functional ortholog of the Ets1 protein. Supporting this idea, a recently published protein sequence of the zebrafish, Ets1 homolog, was found to be highly similar to the Ets1 subfamily throughout most of the protein sequence (Figure 1A) [34]. No other homology domains were found outside the ETS domain of Etsrp. We were unable to find an apparent Etsrp ortholog in other species. As evident from the homology tree, Etsrp is the most closely related to Ets1 and Ets2 subfamilies (Figure 1B). We performed synteny analysis of human, mouse, and zebrafish ets1 or etsrp chromosomal regions. Human and mouse ets1 genes are positioned next to fli1 genes, which encode related ETS domain proteins (Figure 1C). ets1 and fli1 genes are transcribed in opposite directions and are likely to have originated from the same ancestral precursor via gene duplication. Zebrafish etsrp is also positioned in the opposite direction and next to a fli1-related gene fli1b [34]. This analysis suggests that etsrp is evolutionarily related to the mammalian ets1 genes. As the zebrafish genome has undergone an additional duplication [35], etsrp and ets1 may have diverged from each other and acquired separate functions. Alternatively, it is possible that ets1 duplicated prior to the divergence of teleosts and tetrapods, and etsrp was subsequently lost in the tetrapod lineage.

Figure 1
Sequence Analysis of the Zebrafish Ets1-Related Protein Etsrp

Etsrp Expression Pattern Analysis

We analyzed the expression pattern of etsrp RNA in early embryos using in situ hybridization. No expression was observed prior to the one-somite stage (unpublished data). From the two-somite stage onward, etsrp RNA was localized to two stripes of cells within the lateral mesoderm (five-somite embryo, Figure 2A). Two distinct expression domains, in the anterior and posterior parts of an embryo, were apparent. The anterior stripes merged at the prechordal plate. The etsrp-expressing cells are likely endothelial cell precursors based on the expression of the gene at later stages. At the 15-somite stage, expression in two bilateral stripes of cells within the lateral mesoderm in the anterior and middle/posterior parts of an embryo, was apparent (Figure 2B–2D). In addition, a stripe of etsrp-expressing cells was noted at the midline and extended through the trunk and posterior parts of an embryo. The middle stripe likely represents the endothelial precursor cells that have already migrated to the future intermediate cell mass (ICM) region. By 26 hours-post-fertilization (hpf), etsrp was expressed in vascular endothelial cells in the embryo marking main axial, head, and intersegmental vessels (Figure 2E). In addition, a group of etsrp-expressing cells was located in the intermediate mesoderm region (Figure 2E and and2F).2F). These cells which by 36 hpf were located close to the pronephros (Figure 2G), and appeared to migrate posteriorly, may represent endothelial cell precursors of pronephric vessels and/or gut vessels. By 36 hpf etsrp expression had mostly disappeared from the axial vessels and was prominent in a subset of head vessels, aortic arches, the cardinal vein plexus region, posterior intersomitic vessels, and the dorsal longitudinal anastomotic vessel (Figure 2G). At 52 hpf, etsrp expression was observed in a subset of head vessels, the common cardinal vein, blood vessels of the pectoral fin, the cardinal vein plexus region, and weakly in posterior intersegmental vessels and the dorsal vessel (Figure 2H).

Figure 2
Expression Pattern of etsrp as Analyzed by In Situ Hybridization

Morpholino Knockdown of Etsrp Function Results in Loss of Circulation

We used antisense morpholino (MO) oligonucleotides [36,37] to knockdown the function of Etsrp. Etsrp–MO-injected embryos (morphants) showed no apparent circulation. While red blood cells were actively circulating in wild-type (wt) embryos at 34 hpf, in etsrp morphants they stayed at their formation site, the ICM region (Figure 3A and and3B).3B). This observation was confirmed by the o-dianisidine staining of heme in the red blood cells (Figure 3C–3E). We performed microangiography analysis by injecting fluorescein-labeled high molecular weight dextran into the sinus venosus of the 2-day-old embryos. Lower doses of etsrp MOs caused partial loss of circulation in the intersegmental and axial vessels, particularly, in the posterior part of the embryo (Figure 3F and and3G).3G). Head circulation was not affected at this dose (Figure 3G). Higher doses of etsrp MOs resulted in the complete loss of functional blood vessels (Figure 3H and and3I,3I, Table 1). Other than the described defects, etsrp morphants appeared morphologically normal (Figure 3B). At 2–3 days-post-fertilization (dpf), etsrp morphants developed pericardial edema and eventually became necrotic and died (unpublished data). Injection of two different etsrp-specific translation-blocking MOs resulted in similar circulatory defects, demonstrating specificity of the observed phenotype (Table 1). To confirm that etsrp MOs were specifically inhibiting synthesis of Etsrp protein, we generated etsrp–green fluorescent protein (GFP) modified bacterial artificial chromosome (BAC). BAC construct of approximately 250 kilobases containing etsrp gene was modified using recA-mediated homologous recombination to replace etsrp coding sequence with GFP [38]. Microinjection of etsrp-GFP BAC resulted in the mosaic GFP expression (Figure S1A). Etsrp MO2, directed against the 5′ UTR of etsrp, completely inhibited this transient GFP expression (Figure S1B). Control injection of a 5-base mismatch MO had no effect on GFP expression (Figure S1C). These results confirm that etsrp MOs specifically inhibit etsrp gene function. Microinjection of a low dose of etsrp MO into flk1-GFP transgenic embryos [39] resulted in partial loss of flk1 expression in intersegmental vessels (Figure 3J–3L). High doses of etsrp MOs resulted in nearly complete loss of flk1 expression in axial vessels and strong downregulation of its expression in head vessels (Figure 3M).

Figure 3
MO Knockdown of Etsrp Protein Function Disrupts Blood Vessel Formation in the Zebrafish Embryos
Table 1
Dose Dependence of Etsrp MO Phenotype

Vascular Endothelial Markers Are Lost in Etsrp Morphants

We performed analysis of different molecular markers in etsrp morphants using high doses of etsrp MOs. Kinase insert domain receptor (kdr, flk1) [40], cadherin 5 (cdh5, VE-cadherin) [41], adrenomedullin receptor (admr) [42], dual specificity phosphatase 5 (dusp5) [42], and C1qR-like (crl) [42] genes are expressed in all vascular endothelial cells while fms-related tyrosine kinase 4 (flt4) [40] is restricted to the venous vessels in early zebrafish embryos. Expression of all of these markers in axial and intersegmental vessels was nearly completely abolished in etsrp morphants at 24 hpf (Figure 4A–4L). Head vessel expression, however, was reduced but still apparent even at high MO doses (Figure 4A–4D) (unpublished data). We were unable to use even higher MO doses to attempt to completely eliminate Etsrp function due to mild toxic effects observed at doses above 15 ng (unpublished data).

Figure 4
Molecular Analysis of Vascular Endothelial and Hematopoietic Markers in etsrp Morphants

Expression of friend leukemia integration 1 (fli1) [40] was downregulated but still apparent in etsrp morphants (Figure 4M and and4N).4N). Interestingly, expression of etsrp itself was upregulated in etsrp morphants, suggesting the presence of a negative autoregulatory loop (Figure 4O and and4P).4P). However, the number of etsrp-expressing angioblasts was reduced in etsrp morphants. These angioblasts remained scattered within the lateral mesoderm failing to coalesce into functional blood vessels (Figure 4P). Formation of hematopoietic precursors appeared unaffected as evident from scl and gata1 expression (Figure 4Q–4T).

We analyzed formation of hematopoietic and vascular progenitors during early somitogenesis stages. A transcription factor scl is expressed in both hematopoietic and vascular endothelial cell precursors [12]. Expression of scl in etsrp morphants was reduced in the anterior domain and absent from the trunk domain while its posterior expression was not affected at the six- and ten-somite stages (Figure 5A–5D). fli1 is expressed in the putative hemangioblast cells while later being restricted to vascular endothelial cells [32]. Anterior expression of fli1 was absent in etsrp morphants while its tail expression was not affected at the six-somite stage (Figure 5E and and5G).5G). At the ten-somite stage, fli1 expression in etsrp morphants was absent from the anterior and trunk domains (Figure 5F and and5H).5H). As described earlier, angioblasts migrate from the lateral mesoderm towards the midline during somitogenesis [2,3]. etsrp-expressing angioblasts were present within the lateral mesoderm but failed to migrate towards the midline in etsrp morphants (Figure 5I–5L). Also, no scl- or fli1-expressing migrating angioblasts were observed in etsrp morphants (unpublished data). etsrp expression level within the angioblasts was strongly increased in etsrp morphants suggesting the presence of negative autoregulation. All of the etsrp-expression domains, including the trunk domain, were present in etsrp morphants (Figure 5I–5L) (unpublished data).

Figure 5
Molecular Analysis of Early Vasculogenesis in etsrp Morphants

Etsrp is Sufficient for the Vascular Endothelial Marker Induction

We analyzed if etsrp mRNA was sufficient for induction of the vascular endothelial markers. Injection of synthetic etsrp mRNA into zebrafish embryos at the 1–16 cell stage resulted in strong ectopic induction of vascular endothelial markers flk1, scl, fli1, and cdh5 during somitogenesis (Figure 6A–6F) (unpublished data). Large patches of intense ectopic flk1 expression were observed within different germ layers including dorsal, lateral, and ventral mesoderm, endoderm and neuroectoderm (Figure 6E and and6F)6F) (unpublished data). No induction of hematopoietic marker gata1 was observed (Figure 6G and and6H).6H). These results indicate that etsrp is sufficient to induce vascular endothelial gene expression in a variety of cell types. Furthermore, etsrp specifically induces vascular markers without affecting closely related hematopoiesis.

Figure 6
etsrp RNA Overexpression Induces Ectopic Expression of Vascular Endothelial Markers

We tested if etsrp was sufficient for vascular induction in clo−/− mutant embryos. etsrp mRNA was injected into the progeny from clo+/− carriers, and the embryos were analyzed for flk1 expression at the ten- to 12-somite stages. As expected, 25% (23 out of 92) of the uninjected progeny from clo+/− carriers showed no flk1 expression. Among etsrp mRNA injected embryos (n = 110), 29% displayed normal flk1 expression pattern (with minor distortions in some embryos), 45% showed both endogenous and ectopic flk1 expression, 19% showed only ectopic flk1 expression, and 6% showed no detectable flk1 expression (Figure 6I–6L). The last two groups apparently represent clo−/− homozygous mutants. These results show that the induction of flk1 by etsrp is independent of clo function, suggesting that etsrp functions downstream of clo. etsrp mRNA did not fully restore the endogenous pattern of flk1 expression in clo−/− mutants most likely because it was expressed ubiquitously and not localized to vascular progenitors.

Etsrp Function Is Required for flk1 Induction by Vegf and Scl

We analyzed the epistatic relationship between vegf and etsrp. vegf overexpression has been reported to induce strong expression of vascular markers such as flk1 [43] (Figure 7A and and7B).7B). Co-injection of vegf mRNA together with etsrp MO resulted in the loss of flk1 expression, similar to etsrp MO phenotype, indicating that etsrp function is required for flk1 induction by vegf signaling (Figure 7C and and7D).7D). Downregulation of vegf expression resulted in the loss of etsrp expression in the intersegmental vessels (Figure 7E and and7F).7F). etsrp expression in dorsal aorta was also not apparent while cardinal vein seemed expanded. This is consistent with the previous report of vegf involvement in regulating arterial fate in zebrafish [44]. Expression of etsrp was not affected in vegf morphants during mid-somitogenesis stages (unpublished data).

Figure 7
etsrp Is Required for vegf and scl Signaling

Scl has been implicated in the hematopoietic and vascular development in zebrafish [13,14]. Downregulation of Scl function using two different MOs had no significant effect on the etsrp expression in angioblasts while the hematopoietic expression of gata1 was completely eliminated (Figure 7G–7J). Overexpression of scl mRNA has been reported to cause induction of vascular markers [45]. We tested if etsrp MO would block this induction by co-injecting it together with scl mRNA. The embryos were analyzed for flk1 expression at the 15-somite stage (Figure 7K–7N). As expected, no or only extremely weak flk1 expression was observed in etsrp–MO-injected embryos (Figure 7L). Overexpression of scl mRNA caused strong induction of flk1 (Figure 7M). Embryos, co-injected with scl mRNA and etsrp MO showed no or very weak flk1 expression (Figure 7N). These results demonstrate that etsrp function is required for flk1 induction by scl.

Discussion

In this study, we report characterization and functional analysis of a novel zebrafish Ets1-related protein, Etsrp. Knockdown of Etsrp resulted in the complete absence of functional blood vessels and downregulation of all endothelial-specific markers analyzed. In zebrafish, hedgehog signaling is necessary for migration of angioblasts from the lateral mesoderm toward the midline, where they subsequently differentiate within the ICM region [4]. Such migration is not apparent in the anterior region which gives rise to the anterior vessels including head vessels. Interestingly, vasculogenesis defects in etsrp morphants were more pronounced in the posterior region of the embryo which was particularly evident at lower downregulation levels. At high MO doses, endothelial cells were nearly completely absent from axial and intersegmental vessels. However, head expression of endothelial markers was not completely eliminated. It is possible that the remaining amount of Etsrp protein activity is sufficient for the head vasculogenesis. Upregulation of etsrp RNA was particularly strong in the head region in etsrp morphants, which may partially compensate for the MO-mediated translation inhibition. Alternatively, etsrp function may be redundant in the vasculogenesis of head vessels.

Among the vascular-specific genes analyzed, expression of only fli1 and scl was not globally downregulated in the early embryos. The early fli1 expression, which overlaps with the hematopoietic factor gata2 expression, is unaffected in the clo mutants and scl morphants and has been suggested to mark the common blood and vascular precursors, hemangioblasts [13,32]. fli1 is later expressed specifically in the vascular endothelial cell precursors, and this expression was reduced but not completely eliminated in etsrp morphants. fli1 expression may not be directly regulated by etsrp, therefore undifferentiated angioblasts retain some of fli1 expression in etsrp morphants. scl is expressed in both hematopoietic and vascular progenitors throughout most of the early development. Although we did not see global downregulation of scl expression in etsrp morphants, it is likely that scl expression is lost in angioblasts but retained in hematopoietic precursors. Interestingly, expression of both fli1 and scl genes was lost from the anterior and trunk domains of the lateral mesoderm. Anterior domain contains angioblast and myeloid progenitors, which appear to be absent from the etsrp morphants. The difference between the trunk and posterior lateral mesoderm has not been previously analyzed in great detail. Possibly, the trunk region contains mostly angioblasts, while the tail region contains both angioblasts and hematopoietic precursors.

Overexpression of etsrp induced strong ectopic expression of vascular markers in multiple cell types, including even tissues that normally commit to a very different fate such as neuroectoderm. Furthermore, overexpression of etsrp specifically initiated vascular development without affecting related hematopoiesis, which argues that the observed effects are not caused by an early ventralization of the whole embryo. These results indicate that etsrp is sufficient to initiate vasculogenesis. As a contrast, overexpression of other regulators of vasculogenesis such as vegf and scl induced expression of vascular markers only within the lateral or somitic mesoderm [14,43,45].

Overexpression of vegf and scl did not have an effect on vascular development in the absence of etsrp function, which suggests that etsrp is an essential mediator of vegf and scl signaling, at least in the vascular induction. Loss of vegf or scl did not affect early expression of etsrp within angioblasts. Overexpression of etsrp caused strong scl induction, indicating that etsrp plays an important role in controlling scl expression, at least within angioblasts. This is also supported by the loss of scl expression in the anterior and trunk regions in etsrp morphants. Our data suggest that etsrp is necessary for scl expression within angioblasts, and both genes are then required for induction of multiple vascular endothelial genes.

The current study shows for the first time that a single gene can be necessary and sufficient for initiating vascular development in vertebrates. Our results demonstrate that Etsrp acts as a very early regulator of vasculogenesis. These findings will greatly advance our understanding of vascular development and the general mechanisms of cell fate specification.

Materials and Methods

Microinjection of MOs

Two etsrp-specific MOs (MO1, TTGGTACATTTCCATATCTTAAAGT and MO2, CACTGAGTCCTTATTTCACTATATC; Gene Tools, Inc.) were used to inhibit the function of Etsrp protein. For the dose response curve, 1–6 nl of 1 mg/ml MO solution in the Danieau buffer supplemented with 15 mM Tris-Cl (pH 7.5) was injected into one- to two-cell-stage embryos [36]. For phenotypic and marker analysis, 3–4nl of 2.5 mg/ml MO2 solution was injected. A five-base MO2 mismatch ( CAGTGAGACCTTAATTCAGTATAAC) was used as a control MO. A previously described Vegf-A-1 MO (kindly donated by S.C. Ekker) was used to inhibit Vegf function [46]. Scl translation-blocking UTR-MO ( GCTCGGATTTCAGTTTTTCCATCAT) and previously described splice-blocking MO [13] were used to inhibit the function of Scl protein. Microinjections were performed as described [47].

BAC modification and microinjection

CHORI-211 BAC library from Children's Hospital Oakland Research Institute, Oakland, California, United States was used to identify etsrp-containing–BAC of approximately 250 kilobases. Replacement of Etsrp coding sequence with GFP was essentially performed as described [38]. Purified BAC DNA (100–150 pg) was injected into blastomere at the one-cell stage.

RNA overexpression and epistasis experiments

Etsrp overexpression construct was generated by subcloning the open reading frame of etsrp into the SpeI site of pT3TS [47]. To synthesize mRNA, Etsrp-T3TS was linearized with XbaI and transcribed using T3 mMessage mMachine Kit (Ambion, Austin, Texas, United States). At the two- to 16-cell stage for overexpression studies, 75–15 pg of etsrp mRNA was injected into zebrafish embryos. For epistasis studies, approximately 50 pg of VEGF121 and VEGF165 mRNA 1:1 mixture was injected [43]. Approximately 300 pg of scl mRNA was injected for epistasis studies [12].

In situ hybridization

In situ hybridization was performed as described [48]. The following probes were used: etsrp [42], flk1 [40], fli1 [40], flt4 [40], scl [12], gata1 [49], admr [42], cdh5 [42], crl [42].

Analysis of etsrp knockdown phenotype

o-dianisidine heme staining was performed as described [49]. Microangiography was performed as described [46].

Zebrafish strains

Majority of etsrp knockdown analysis was performed in the wild-type zebrafish from Scientific Hatcheries (Huntington Beach, California, United States). As confirmed by sequencing, no polymorphisms in the etsrp MO-binding sites were detected in this wild-type strain. In addition, flk1-GFP transgenic zebrafish line was used [39]. clom39 line was used in etsrp overexpression experiments [7].

Supporting Information

Figure S1

Etsrp MO Blocks GFP Expression in the Embryos Injected with etsrp–GFP-Modified BAC Construct:

Mosaic panels have been generated by taking individual images of randomly chosen embryos from each batch. Embryos are at the 90% epiboly stage. (A) Following microinjection, etsrp-GFP BAC is transiently expressed in a mosaic pattern. Note that the transient BAC expression commonly does not recapitulate the endogenous expression pattern. (B) Co-injection of etsrp-GFP BAC and 10 ng of etsrp MO2 completely eliminated GFP fluorescence. (C) Co-injection of etsrp-GFP BAC and 10 ng of 5-base MO2 mismatch had no effect on GFP fluorescence.

(2.5 MB TIF).

Accession Numbers

GenBank (http://www.ncbi.nlm.nih.gov/Genbank) accession number for etsrp is DQ021472.

Acknowledgments

Research was supported by grants from the National Institutes of Health (R01 DK54508 to SL and T32 HL069766 to SS). We thank S. Palencia-Desai and H. Jiang for their help with experiments.

Competing interests. The authors have declared that no competing interests exist.

Abbreviations

BAC
bacterial artificial chromosome
dpf
days-post-fertilization
GFP
green fluorescent protein
hpf
hours-post-fertilization
ICM
intermediate cell mass
MO
morpholino
Vegf
vascular endothelial growth factor
wt
wild-type

Footnotes

Author contributions. SL and SS conceived and designed the experiments. SS performed the experiments. SL and SS analyzed the data. SS wrote the paper.

Citation: Sumanas S, Lin S (2006) Ets1-related protein is a key regulator of vasculogenesis in zebrafish. PLoS Biol 4(1): e10.

References

  • Risau W, Flamme I. Vasculogenesis. Annu Rev Cell Dev Biol. 1995;11:73–91. [PubMed]
  • Zhong TP, Childs S, Leu JP, Fishman MC. Gridlock signaling pathway fashions the first embryonic artery. Nature. 2001;414:216–220. [PubMed]
  • Fouquet B, Weinstein BM, Serluca FC, Fishman MC. Vessel patterning in the embryo of the zebrafish: Guidance by notochord. Dev Biol. 1997;183:37–48. [PubMed]
  • Gering M, Patient R. Hedgehog signaling is required for adult blood stem cell formation in zebrafish embryos. Dev Cell. 2005;8:389–400. [PubMed]
  • Isogai S, Lawson ND, Torrealday S, Horiguchi M, Weinstein BM. Angiogenic network formation in the developing vertebrate trunk. Development. 2003;130:5281–5290. [PubMed]
  • Robb L, Elefanty AG. The hemangioblast—an elusive cell captured in culture. Bioessays. 1998;20:611–614. [PubMed]
  • Stainier DY, Weinstein BM, Detrich HW, Zon LI, Fishman MC. Cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages. Development. 1995;121:3141–3150. [PubMed]
  • Parker L, Stainier DY. Cell-autonomous and non-autonomous requirements for the zebrafish gene cloche in hematopoiesis. Development. 1999;126:2643–2651. [PubMed]
  • Begley CG, Aplan PD, Denning SM, Haynes BF, Waldmann TA, et al. The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif. Proc Natl Acad Sci U S A. 1989;86:10128–10132. [PubMed]
  • Kallianpur AR, Jordan JE, Brandt SJ. The SCL/TAL-1 gene is expressed in progenitors of both the hematopoietic and vascular systems during embryogenesis. Blood. 1994;83:1200–1208. [PubMed]
  • Gering M, Rodaway AR, Gottgens B, Patient RK, Green AR. The SCL gene specifies haemangioblast development from early mesoderm. Embo J. 1998;17:4029–4045. [PubMed]
  • Liao EC, Paw BH, Oates AC, Pratt SJ, Postlethwait JH, et al. SCL/Tal-1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish. Genes Dev. 1998;12:621–626. [PubMed]
  • Patterson LJ, Gering M, Patient R. Scl is required for dorsal aorta as well as blood formation in zebrafish embryos. Blood. 2005;105:3502–3511. [PubMed]
  • Dooley KA, Davidson AJ, Zon LI. Zebrafish scl functions independently in hematopoietic and endothelial development. Dev Biol. 2005;277:522–536. [PubMed]
  • Lelievre E, Lionneton F, Soncin F, Vandenbunder B. The Ets family contains transcriptional activators and repressors involved in angiogenesis. Int J Biochem Cell Biol. 2001;33:391–407. [PubMed]
  • Vandenbunder B, Pardanaud L, Jaffredo T, Mirabel MA, Stehelin D. Complementary patterns of expression of c-ets 1, c-myb and c-myc in the blood-forming system of the chick embryo. Development. 1989;107:265–274. [PubMed]
  • Pardanaud L, Dieterlen-Lievre F. Expression of C-ETS1 in early chick embryo mesoderm: relationship to the hemangioblastic lineage. Cell Adhes Commun. 1993;1:151–160. [PubMed]
  • Queva C, Leprince D, Stehelin D, Vandenbunder B. p54c-ets-1 and p68c-ets-1, the two transcription factors encoded by the c-ets-1 locus, are differentially expressed during the development of the chick embryo. Oncogene. 1993;8:2511–2520. [PubMed]
  • Anderson MK, Hernandez-Hoyos G, Diamond RA, Rothenberg EV. Precise developmental regulation of Ets family transcription factors during specification and commitment to the T cell lineage. Development. 1999;126:3131–3148. [PubMed]
  • Tanaka K, Oda N, Iwasaka C, Abe M, Sato Y. Induction of Ets-1 in endothelial cells during reendothelialization after denuding injury. J Cell Physiol. 1998;176:235–244. [PubMed]
  • Wernert N, Raes MB, Lassalle P, Dehouck MP, Gosselin B, et al. c-ets1 proto-oncogene is a transcription factor expressed in endothelial cells during tumor vascularization and other forms of angiogenesis in humans. Am J Pathol. 1992;140:119–127. [PubMed]
  • Wakiya K, Begue A, Stehelin D, Shibuya M. A cAMP response element and an Ets motif are involved in the transcriptional regulation of flt-1 tyrosine kinase (vascular endothelial growth factor receptor 1) gene. J Biol Chem. 1996;271:30823–30828. [PubMed]
  • Kappel A, Ronicke V, Damert A, Flamme I, Risau W, et al. Identification of vascular endothelial growth factor (VEGF) receptor-2 (Flk-1) promoter/enhancer sequences sufficient for angioblast and endothelial cell-specific transcription in transgenic mice. Blood. 1999;93:4284–4292. [PubMed]
  • Lelievre E, Mattot V, Huber P, Vandenbunder B, Soncin F. ETS1 lowers capillary endothelial cell density at confluence and induces the expression of VE-cadherin. Oncogene. 2000;19:2438–2446. [PubMed]
  • Iljin K, Dube A, Kontusaari S, Korhonen J, Lahtinen I, et al. Role of ets factors in the activity and endothelial cell specificity of the mouse Tie gene promoter. Faseb J. 1999;13:377–386. [PubMed]
  • Chen Z, Fisher RJ, Riggs CW, Rhim JS, Lautenberger JA. Inhibition of vascular endothelial growth factor-induced endothelial cell migration by ETS1 antisense oligonucleotides. Cancer Res. 1997;57:2013–2019. [PubMed]
  • Wernert N, Stanjek A, Kiriakidis S, Hugel A, Jha HC, et al. Inhibition of angiogenesis in vivo by ets-1 antisense oligonucleotides-inhibition of Ets-1 transcription factor expression by the antibiotic fumagillin. Angew Chem Int Ed Engl. 1999;38:3228–3231. [PubMed]
  • Barton K, Muthusamy N, Fischer C, Ting CN, Walunas TL, et al. The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity. 1998;9:555–563. [PubMed]
  • Wang D, John SA, Clements JL, Percy DH, Barton KP, et al. Ets-1 deficiency leads to altered B cell differentiation, hyper-responsiveness to TLR9 and autoimmune disease. Int Immunol. 2005;17:1179–1191. [PubMed]
  • Hart A, Melet F, Grossfeld P, Chien K, Jones C, et al. Fli-1 is required for murine vascular and megakaryocytic development and is hemizygously deleted in patients with thrombocytopenia. Immunity. 2000;13:167–177. [PubMed]
  • Spyropoulos DD, Pharr PN, Lavenburg KR, Jackers P, Papas TS, et al. Hemorrhage, impaired hematopoiesis, and lethality in mouse embryos carrying a targeted disruption of the Fli1 transcription factor. Mol Cell Biol. 2000;20:5643–5652. [PMC free article] [PubMed]
  • Brown LA, Rodaway AR, Schilling TF, Jowett T, Ingham PW, et al. Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech Dev. 2000;90:237–252. [PubMed]
  • Sumanas S, Jorniak T, Lin S. Identification of novel vascular endothelial-specific genes by the microarray analysis of the zebrafish cloche mutants. Blood. 2005;106:534–541. [PubMed]
  • Zhu H, Traver D, Davidson AJ, Dibiase A, Thisse C, et al. Regulation of the lmo2 promoter during hematopoietic and vascular development in zebrafish. Dev Biol. 2005;281:256–269. [PubMed]
  • Hoegg S, Brinkmann H, Taylor JS, Meyer A. Phylogenetic timing of the fish-specific genome duplication correlates with the diversification of teleost fish. J Mol Evol. 2004;59:190–203. [PubMed]
  • Nasevicius A, Ekker SC. Effective targeted gene knockdown in zebrafish. Nat Genet. 2000;26:216–220. [PubMed]
  • Sumanas S, Larson JD. Morpholino phosphorodiamidate oligonucleotides in zebrafish: A recipe for functional genomics? Brief Funct Genomic Proteomic. 2002;1:239–256. [PubMed]
  • Gong S, Yang XW, Li C, Heintz N. Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication. Genome Res. 2002;12:1992–1998. [PubMed]
  • Cross LM, Cook MA, Lin S, Chen JN, Rubinstein AL. Rapid analysis of angiogenesis drugs in a live fluorescent zebrafish assay. Arterioscler Thromb Vasc Biol. 2003;23:911–912. [PubMed]
  • Thompson MA, Ransom DG, Pratt SJ, MacLennan H, Kieran MW, et al. The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev Biol. 1998;197:248–269. [PubMed]
  • Larson JD, Wadman SA, Chen E, Kerley L, Clark KJ, et al. Expression of VE-cadherin in zebrafish embryos: A new tool to evaluate vascular development. Dev Dyn. 2004;231:204–213. [PubMed]
  • Sumanas S, Jorniak T, Lin S. Identification of novel vascular endothelial-specific genes by the microarray analysis of the zebrafish cloche mutants. Blood. 2005;106:534–541. [PubMed]
  • Liang D, Chang JR, Chin AJ, Smith A, Kelly C, et al. The role of vascular endothelial growth factor (VEGF) in vasculogenesis, angiogenesis, and hematopoiesis in zebrafish development. Mech Dev. 2001;108:29–43. [PubMed]
  • Lawson ND, Vogel AM, Weinstein BM. Sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev Cell. 2002;3:127–136. [PubMed]
  • Gering M, Yamada Y, Rabbitts TH, Patient RK. Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts which differentiate into endothelial cells in the absence of Gata1. Development. 2003;130:6187–6199. [PubMed]
  • Nasevicius A, Larson J, Ekker SC. Distinct requirements for zebrafish angiogenesis revealed by a VEGF-A morphant. Yeast. 2000;17:294–301. [PMC free article] [PubMed]
  • Hyatt TM, Ekker SC. Vectors and techniques for ectopic gene expression in zebrafish. Methods Cell Biol. 1999;59:117–126. [PubMed]
  • Jowett T. Analysis of protein and gene expression. Methods Cell Biol. 1999;59:63–85. [PubMed]
  • Detrich HW, Kieran MW, Chan FY, Barone LM, Yee K, et al. Intraembryonic hematopoietic cell migration during vertebrate development. Proc Natl Acad Sci U S A. 1995;92:10713–10717. [PubMed]

Articles from PLoS Biology are provided here courtesy of Public Library of Science