In addition to the mutants mentioned above, we isolated two mutants, BG148 and BG104, with insertions in cytochrome
c maturation genes. BG148 has a transposon insertion in
ccmC which is located within the
ccmABCDE gene cluster. A 4.7-kb HindIII fragment that contains
ccmABCDE was cloned, sequenced, and used to complement BG148. The
ccm genes on this fragment encode proteins that are 50% or more identical to cytochrome
c maturation proteins from other bacteria (see reference
31 for a review). CcmA and CcmB are components of an ABC transporter that is required for cytochrome
c maturation, whereas CcmC is thought to bind heme and present it to the periplasmic heme chaperone CcmE (
20,
22,
28,
29).
BG104 has a transposon insertion in
ccmF1. CcmF1 is a protein of 660 amino acids (The Institute for Genomic Research [TIGR] locus number SO0266) that is 44% identical to CcmF from
E. coli (
32) (GenBank database entry U00008). CcmF is a heme lyase responsible for heme ligation to the apocytochrome (
21).
ccmF1 lies upstream of
ccmG,
ccmH, and a putative thioredoxin gene (TIGR locus no. SO0267, SO0268, and SO0269, respectively) (Fig. ). A 2.58-kb fragment that contains
ccmF1 was amplified by using cmfF (CGGCTTGGAAGCAAGATT), cmfR (CAGTTGGAAAGCCGGAATAGG), and Expand high-fidelity polymerase (Roche Biochemical), cloned into pJB3Cm6 (
4), and used to complement BG104.
The
ccm mutants, BG104 and BG148, were tested for anaerobic reduction or growth with different electron acceptors used by the wild type as described previously (
25). Both mutants were deficient in anaerobic growth with fumarate, trimethylamine oxide, and dimethyl sulfoxide (DMSO) (Table ). They were also deficient in Fe(III) and Mn(IV) reduction and in anaerobic growth with nitrate and nitrite (data not shown). Complementation of the mutants restored their ability to use these electron acceptors.
| TABLE 1.Anaerobic growth of wild-type S. oneidensis, ccm mutants (BG104 and BG148), and complemented mutants (BG104C and BG148C) |
BG104 and BG148 were tested for cytochrome
c production under aerobic and anaerobic conditions. Aerobic growth was in 50 ml LB in 500-ml flasks with vigorous shaking for 3 h (early log phase). Anaerobic growth was in LB supplemented with 50 mM lactate and 10 mM fumarate in a Coy anaerobic chamber. Because the
ccm mutants do not grow anaerobically, the cultures were first grown aerobically, then transferred to an anaerobic chamber, and incubated for 4 h. Heme staining was performed using 3,3′,5,5′-tetramethyl benzidine dihydrochloride as described previously (
30). Protein bands that exhibited heme
c peroxidase activity were detected in cell extracts of wild-type
S. oneidensis grown aerobically and anaerobically but were absent from the
ccm mutant cell extracts (Fig. ). In addition to having a loss of
c cytochromes, BG104 and BG148 were deficient in cytochrome
c oxidase activity. Complementation restored this activity to both mutants (data not shown). Loss of cytochrome
c oxidase activity has been observed in
Bradyrhizobium japonicum and
Paracoccus denitrificans mutants deficient in cytochrome
c maturation (
17-
19).
The genome sequence of S. oneidensis contains two ccmF homologs, ccmF1 (described above) and ccmF2 (TIGR locus no. SO0478). Although CcmF1 and CcmF2 are 50% identical, loss of CcmF1 led to loss of c cytochromes under the growth conditions used in our studies. This finding suggests that CcmF1 may be the major heme lyase in S. oneidensis. The function of CcmF2 remains to be determined.
This article has been 
