PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jcinvestThe Journal of Clinical InvestigationCurrent IssueArchiveSubscriptionAbout the Journal
 
J Clin Invest. 2005 May 2; 115(5): 1250–1257.
PMCID: PMC1087158

A novel COL1A1 mutation in infantile cortical hyperostosis (Caffey disease) expands the spectrum of collagen-related disorders

Abstract

Infantile cortical hyperostosis (Caffey disease) is characterized by spontaneous episodes of subperiosteal new bone formation along 1 or more bones commencing within the first 5 months of life. A genome-wide screen for genetic linkage in a large family with an autosomal dominant form of Caffey disease (ADC) revealed a locus on chromosome 17q21 (LOD score, 6.78). Affected individuals and obligate carriers were heterozygous for a missense mutation (3040C[dbl head right arrow]T) in exon 41 of the gene encoding the α1(I) chain of type I collagen (COL1A1), altering residue 836 (R836C) in the triple-helical domain of this chain. The same mutation was identified in affected members of 2 unrelated, smaller families with ADC, but not in 2 prenatal cases and not in more than 300 chromosomes from healthy individuals. Fibroblast cultures from an affected individual produced abnormal disulfide-bonded dimeric α1(I) chains. Dermal collagen fibrils of the same individual were larger, more variable in shape and size, and less densely packed than those in control samples. Individuals bearing the mutation, whether they had experienced an episode of cortical hyperostosis or not, had joint hyperlaxity, hyperextensible skin, and inguinal hernias resembling symptoms of a mild form of Ehlers-Danlos syndrome type III. These findings extend the spectrum of COL1A1-related diseases to include a hyperostotic disorder.

Introduction

Infantile cortical hyperostosis (Caffey disease; OMIM 114000) is a genetic disorder characterized by an infantile episode of massive subperiosteal new bone formation that typically involves the diaphyses of the long bones, mandible, and clavicles (1). In addition to these changes, which can appear quite prominently on x-ray, the involved bones may also appear inflamed, with painful swelling and systemic fever often accompanying the illness. Consistent with the observed increased bone formation, laboratory findings include an elevated level of alkaline phosphatase. Furthermore, there can be an elevation in white blood cell count and erythrocyte sedimentation rate, which indicate an inflammatory response. The bone changes usually begin before 5 months of age and resolve before 2 years of age (1, 2). Recurrent episodes of cortical hyperostosis are uncommon, and there are few reports concerning adverse sequelae of the hyperostotic lesions in affected individuals (3, 4). The inflammatory nature of the symptoms has led to treatment trials with antiinflammatory agents, and resolution of symptoms has been reported with the use of indomethacin (5) and with glucocorticoid therapy (6).

Information on several unrelated pedigrees indicates that Caffey disease can be inherited in an autosomal dominant manner (79). Review of these pedigrees showed evidence of incomplete penetrance, as there were obligate carriers who lacked episodes of cortical hyperostosis (79). However, the signs and symptoms of Caffey disease can be subtle and are typically only manifested at a preverbal age, which thus makes it plausible that the diagnosis could have been missed in some of these apparently unaffected carriers. A more severe and often lethal prenatal form of Caffey disease appears to be inherited as an autosomal recessive disorder (10).

In addition to the inherited forms of Caffey disease, sporadic cases of infantile cortical hyperostosis have also been described (reviewed in ref. 11). At least some of these nonfamilial cases can be attributed to administration of prostaglandin E1 (PGE1) and PGE2 for treatment of ductal-dependent cardiac lesions (1214). In fact, the incidence of this complication of prostaglandin therapy is high, with radiographic changes occurring in 62% of all infants receiving PGE1 infusion for more than 60 days (14). Other conditions that can cause cortical bone lesions in children less than 2 years of age, and may thus mimic infantile cortical hyperostosis, include trauma (15), hypervitaminosis A (16), hyperphosphatemia (17), and infection (18). Sporadic cases of infantile cortical hyperostosis not associated with PGE1 or PGE2 infusion appear to be on the decline, but the reason(s) for the diminished frequency of these bone abnormalities remain(s) uncertain (8).

The gene or genes responsible for the prenatal and postnatal inherited forms of Caffey disease have not been reported. We therefore undertook genetic linkage studies using genomic DNA from a large kindred with the autosomal dominant form of the condition (autosomal dominant Caffey disease [ADC]) (7, 8). Affected individuals and obligate carriers in this kindred, as well as affected individuals in 2 other kindreds, were shown to be heterozygous for the same novel missense mutation affecting the gene that encodes the α1(I) chain of type I collagen (COL1A1).

Results

Genetic linkage analysis.

Three unrelated families with at least 2 members affected by ADC (7, 8, 19) (Figure (Figure1),1), 1 sporadic case, and 2 prenatal cases were available for analysis (20, 21). DNA from family 1 was used for a genome-wide scan, which revealed linkage to chromosome 17q21 (Figure (Figure2A).2A). Fine mapping reduced the size of the linked region to a 2.3-Mb interval delimited by markers D17S1868 and D17S1877. The maximal LOD score obtained within this region by 2-point analysis was 6.78 for marker D17S1795 (θ = 0), which is only slightly lower than the maximal theoretical LOD score of 7.12. Nucleotide sequence analysis of 13 candidate genes within the linked region (GNGT2, NESH, PHB, LOC81558, ITGA3, LOC84687, XT2, PRO1855, CHAD, EPN3, FLJ21347, OA48-18, and TOB1) did not reveal any heterozygous mutations that segregated with ADC. However, affected individuals and obligate carriers were heterozygous for a missense mutation in exon 41 of COL1A1 (also referred to as exon 42, corresponding to the exon structure of COL1A2, which contains 1 additional exon; ref. 22) (Figure (Figure3).3). This C[dbl head right arrow]T transition at nucleotide position 3040 of the cDNA (relative to the translation initiation codon), which alters codon 1014 of prepro-α1(I) mRNA, was predicted to produce an R836C amino acid substitution within the triple-helical domain of the α1(I) chain of collagen. The nucleotides were numbered relative to the ATG start site of prepro-α1(I) cDNA, and amino acid residues were numbered relative to the first glycine residue of the main triple-helical domain of the α1(I) protein chain (22).

Figure 1
Radiographic features of infantile cortical hyperostosis. Radiographs of 3 affected individuals of 2 unrelated kindreds showing subperiosteal thickening of the femur, tibia, and fibula (left and upper middle panels: tibia and fibula, respectively, of ...
Figure 2
Haplotype analyses of families with infantile cortical hyperostosis. (A) Family 1: Fine mapping of the locus for Caffey disease on chromosome 17q21. Standard techniques were used to establish the genetic locus of the disease in a large Canadian family ...
Figure 3
Nucleotide sequence analysis of portions of exon 41 of COL1A1 and adjacent intronic regions of an affected individual from family 1. The individual was heterozygous for the transition, which is indicated by the arrow, and the approximate location of both ...

To confirm the mutation identified by sequence analysis, a 495-bp fragment comprising exon 41 was PCR amplified and digested with HpyCH4IV (ACGT). The PCR product derived from the mutant allele lacked 1 recognition site for HpyCH4IV, thus generating an additional DNA fragment of 319 bp (Figure (Figure2B).2B). The same COL1A1 mutation was also found in the 3 affected members but not in the unaffected father of family 2 (Figure (Figure2C).2C). Furthermore, the mutation was found in the clinically affected identical twins but not in the clinically unaffected parents and brother of family 3 (Figure (Figure2D).2D). The affected twins and the unaffected sibling had inherited identical parental alleles in this region. Consequently, the clinically affected twins were likely to have acquired a de novo COL1A1 mutation.

Haplotype analysis of the affected members of families 1–3 did not reveal any shared alleles, which supported the historical evidence that the 3 families that were heterozygous for the R836C substitution were not related to each other. The 3040C[dbl head right arrow]T transition was not detected in genomic DNA from more than 150 healthy controls (more than 300 chromosomes), in SNP databases (dbSNP, http://www.ncbi.nlm.nih.gov/SNP; JSNP, http://snp.ims.u-tokyo.ac.jp; Celera Discovery System, http://publication.celera.com/humanpub/index.jsp; and Applied Biosystems SNPbrowser Software, http://marketing.appliedbiosystems.com/mk/get/snpb_landing), or in the Mutations in COL1A1 database (http://www.le.ac.uk/genetics/collagen/col1a1.html) (22). The latter findings suggest that the 3040C[dbl head right arrow]T transition in exon 41 of COL1A1 and the resulting R836C amino acid substitution within the triple-helical domain of the α1(I) chain can be a cause of ADC.

A possible sporadic case of Caffey disease with hyperostosis of a rib did not have any demonstrable mutations in COL1A1 or in the COL1A2 gene, which encodes the α2(I) chain of type I collagen. Mutations of COL1A1 or COL1A2 were also not detected in 2 cases of prenatal Caffey disease (20, 21).

Dermal collagen morphology and collagen biosynthesis.

To further investigate whether the Col1A1 mutation results in changes in type I collagen, we obtained skin biopsies from an affected adult female in family 1 (IV-2). This individual had an episode of infantile cortical hyperostosis and from early childhood had clinical signs of hyperextensible skin and generalized joint instability, as well as a history of several fractures. As an adult, she had the same clinical signs, as well as more severe voluntary subluxation of the shoulders. Electron microscopy of her dermis showed normal fibroblast morphology (data not shown). The collagen fibrils were more variable in shape and size and were less densely packed (Figure (Figure4A)4A) than fibrils in age- and sex-matched control dermal samples (Figure (Figure4B).4B). The fibrils were also significantly larger and were more variable in size in the affected individual (Caffey disease, 108 ± 15 nm; control, 91 ± 8 nm; n = 1,000; P < 0.001). Granular material was visible in the matrix surrounding many of the collagen fibrils (Figure (Figure44A).

Figure 4
Dermal ultrastructure from proband IV-2 of family 1. (A) Ultrastructure of the extracellular matrix of the proband’s dermis (magnification, ×60,000). The collagen fibrils are more variable in shape and size and are less densely packed ...

One-dimensional gel electrophoresis showed that cultured dermal fibroblasts from the proband of family 1 produced a mixture of apparently normal type I, III, and V collagens as well as an abnormal disulfide-linked dimer (Figure (Figure5A).5A). As the dimer was likely to include 2 α1(I) chains bearing the R836C substitution, it was designated β11′. Two-dimensional gel electrophoresis showed that the abnormal β11′ dimers dissociated after reduction of disulfide bonds into α1(I) chains that were designated as α1(I)′ chains (Figure (Figure5B).5B). Although β-aminopropionitrile, an inhibitor of the formation of lysine-derived collagen cross-linkages, was added to the cultures, a small amount of dimeric collagen chains (β11 and β12) was formed. These lysine-derived crosslinked dimers do not dissociate into α chains after reduction of disulfide bonds with dithiothreitol.

Figure 5
Collagen biosynthesis by cultured fibroblasts from proband IV-2 of family 1. (A) One-dimensional gel electrophoresis of dermal and fibroblast collagens: lane 1, pepsin-solubilized collagen from normal dermis (ND); lane 2, proband fibroblast cell layer ...

Genotype/phenotype correlations.

Of the 24 members of family 1 in our study with the R836C mutation, only 19 members had experienced an episode of cortical hyperostosis, while 5 were obligate carriers. Thus, 79% of the individuals who were heterozygous for the COL1A1 mutation had an episode of cortical hyperostosis, and 21% of them did not. Detailed interviews of family members did not reveal any precipitating events other than the consistent report that the onset of cortical hyperostosis usually occurred before 5 months of age. None of the children had been given prostaglandins, which can induce subperiosteal new bone formation in neonates (23). The clinical course of the hyperostotic episode was often protracted but resolved after about 2 years. By mid- to late childhood, the hyperostotic long bones in the affected children of families 2 and 3 had remodeled extensively. However, in each affected bone, the central portion of the diaphysis, corresponding to the complete diaphysis of infancy, showed mild external and internal thickening of the cortex. In contrast, the diaphyseal and metaphyseal bone above and below the central region, which would have formed after the episode of hyperostosis, was radiographically normal (data not shown). The epiphyses and growth plates were also radiographically normal.

In family 1, individuals with the R836C substitution (affected individuals and obligate carriers) had varying degrees of joint hyperlaxity that was first observed in early childhood (24). The hyperlaxity was apparent in large and small joints and allowed some individuals bearing the Caffey allele to voluntarily sublux their shoulders and finger joints (Figure (Figure6).6). Instability of the joints, particularly the shoulder joints, worsened with age. These individuals had abnormally soft and hyperextensible skin, which was otherwise normal in appearance. They did not bruise easily. Members of family 1 who did not bear the Caffey allele did not have the skin or joint anomalies. The 3 members of family 2 with the R836C mutation (see Figure Figure2C)2C) also had hyperextensible skin, joint hyperlaxity, and inguinal hernias, while the identical twins in family 3 did not demonstrate such anomalies.

Figure 6
Voluntary subluxation of various joints in ADC patients. Photographs of 4 individuals carrying the R836C mutation (III-13, IV-2, IV-3, and IV-4 of family 1): upper left, 2 individuals with subluxation of the shoulders; lower left, 2 views of patellar ...

None of the affected individuals or obligate carriers in any of the families had clinical signs of the major type I collagen disorder, osteogenesis imperfecta (25). In particular, they lacked gray-blue sclerae, dentinogenesis imperfecta, premature hearing loss, short stature, deformities, and scoliosis (25, 26). Skull radiographs from the clinically affected identical twins did not contain wormian bones, which can occur in patients with osteogenesis imperfecta (25, 26). Neither of the twins had radiographic evidence of platyspondyly, which is also a common feature of osteogenesis imperfecta. In family 1, 9 of the 18 individuals with Caffey disease, for whom detailed fracture histories were available, had a total of 14 peripheral fractures (1–4 in each). Bone mineral density was assessed in 1 affected adult with Caffey disease from family 1 and the results were within normal limits for the lumbar spine and femoral neck; spinal radiographs in this patient showed no evidence of platyspondyly or compression fractures.

Discussion

In family 1, we mapped ADC to an interval on chromosome 17q21. All affected individuals and obligate carriers were heterozygous for a 3040C[dbl head right arrow]T transition in a CpG dinucleotide of exon 41 of COL1A1, which encodes the α1(I) chain of type I collagen. The same 3040C[dbl head right arrow]T transition was also present in affected members of families 2 and 3. The recurrent nature of the mutation indicates that the involved CpG dinucleotide is a mutational “hot spot” in COL1A1 (2729). The mutation is predicted to introduce an R836C substitution into the triple-helical domain of α1(I) chains of type I collagen (22). Results from collagen biosynthetic studies supported this proposal, as cultured dermal fibroblasts from an affected individual produced an abnormal disulfide-bonded α1(I) dimer. Ultrastructural studies of the dermis revealed that in vivo, the mutation was associated with an abnormal collagen fibril architecture.

The absence of the nucleotide change in any of the databases of normal DNA sequence variants as well as in normal DNA samples supports our proposal that it is a cause of ADC. While the R836C mutation therefore appears to be required for the development of ADC, it remains uncertain how the identified amino acid change can result in a spatially and temporally limited increase in cortical bone formation. COL1A1 and COL1A2 mutations were not found in a sporadic case of Caffey disease in which, according to radio-graphy, changes were limited to a single rib, which suggests that other genetic defects or environmental factors can lead to localized hyperostosis. Mutations of the type I collagen genes were also not detected in 2 cases of the prenatal form of the disease, which is usually more severe and may be inherited in an autosomal recessive manner (21). Consequently, it is likely that the prenatal form of Caffey disease constitutes a separate disorder (11).

The R836C amino acid substitution changes the X position of one of the 338 Gly-X-Y repeating amino acid triplets of the triple-helical domain of the α1(I) chain of type I collagen. Cysteine residues are normally present in the amino and carboxyl propeptides of type I procollagen chains, but they are removed when type I procollagen is enzymatically processed to type I collagen (30). While many G[dbl head right arrow]C mutations have been described in osteogenesis imperfecta, only 1 other R[dbl head right arrow]C amino acid substitution has been reported in the α1(I) chain of type I collagen. Two unrelated patients with classical Ehlers-Danlos syndrome type 1 were heterozygous for a 934C[dbl head right arrow]T transition at a CpG dinucleotide in exon 14 of COL1A1 (31). The resulting amino acid substitution, R134C, also involved the X position of a Gly-X-Y triplet within the main triple-helical domain of the α1(I) chain of type I collagen (Figure (Figure3).3). Ultrastructural studies of skin biopsies from these patients revealed variability in diameter and irregularity of dermal collagen fibrils, with granulofilamentous material visible along the collagen fibrils (similar to what is shown in Figure Figure4A),4A), and collagen biosynthetic studies using fibroblast cultures bearing the R134C substitution also showed disulfide-bonded α1(I) dimers within the fibroblasts. Thus, the ultrastructural and biosynthetic anomalies produced by the R134C and the R836C substitutions were similar. However, in contrast to the R134C substitution that was associated with a classical Ehlers-Danlos syndrome type I phenotype (soft, velvety, and hyperextensible skin; numerous atrophic paper scars of the skin; ecchymoses on the legs; and generalized joint hyperlaxity), the present R836C substitution was associated with episodes of infantile cortical hyperostosis, and 2 of the 3 Caffey families showed features of Ehlers-Danlos syndrome type III (24). Interestingly, neither R[dbl head right arrow]C mutation was associated with osteogenesis imperfecta.

There are several possible mechanisms by which the R836C mutation could result in the observed ADC phenotype. The analysis of collagen fibrils in skin fibroblasts showed increased disulfide crosslinking, either within or between mutant collagen fibrils, which may be responsible for the observed alterations in collagen architecture. Disulfide crosslinking may also occur between the mutant collagens and other cystein-containing proteins in the bone matrix. The Caffey mutation may furthermore disrupt an important site of interaction with other peptides or proteins. Arg836 is located within the carboxyterminal cyanogen bromide peptide 6 (CB6) of the α1(I) chain, which has been shown to bind with high affinity to IL-2 and to the amyloid protein precursor (APP) (3234). However, the CB6 peptide comprises 218 amino acid residues, i.e. approximately 21% of the α1(I) chain (22), and the specific binding sites for IL-2 and APP within the CB6 peptide are currently unknown. It also is plausible that the R836C substitution within the α1(I) chain reduces the thermal stability of the collagen triple helix. Based on studies with a host-guest collagen peptide, Ac-(Gly-Pro-Hyp)3-Gly-X-Y-(Gly-Pro-Hyp)4-Gly-Gly-CONH2, in which an arginine residue had been replaced with a cysteine residue in the X position (30, 35), the R836C mutation identified in Caffey patients would be predicted to decrease the melting temperature of the collagen triple helix by 4.5°C. This change could provide another possible explanation for the observed alterations in collagen architecture. Last, prostaglandins may be involved in the development of hyperostosis, as short-term PGE1 or PGE2 administration for the treatment of ductal-dependent cardiac lesions typically leads to bone changes that resemble those present in ADC (1214, 36). The inflammatory signs that often accompany the hyperostotic lesions in Caffey disease support this hypothesis. However, examination of additional ADC families, as well as in vitro and in vivo studies, are needed to help define the mechanism(s) that lead to the disease phenotype.

While the hyperostotic lesions in ADC occur only in infancy, the mutant α1(I) chain is presumably present in the bone matrix throughout life. Based on our radiographic observations, detachment of the periosteum from the underlying bone appears to be a key pathological process in the onset of episodes of cortical hyperostosis. However, there was no consistent reporting of events in our families that may have precipitated this periosteal detachment. The only recurrent finding was the onset of episodes of cortical hyperostosis within the first 5 months of postnatal life, which suggests that infants in this age group may have an increased susceptibility to periosteal injury. Consistent with this hypothesis, a radiographic study of babies who died of sudden infant death syndrome between 1 and 4 months of age showed that mild subperiosteal new bone formation, which was distinct from the underlying diaphysis and metaphysis, had occurred in the long bones of 35% of the cases (37). Furthermore, large amounts of subperiosteal new bone characteristically accompany healing fractures (38), osteomyelitis (39), and scurvy (40, 41) in neonates and infants. In all of these conditions, the bone can enlarge in diameter by several fold but remodels over the following 2 years, similar to what occurs with the hyperostotic lesions in Caffey disease. In contrast, subperiosteal elevation is more limited in older children with fractures and osteomyelitis (42). Thus, intrinsic differences in periosteal bone formation in infants and adults may explain the absence of hyperostotic lesions in adults with the R836C mutation. Furthermore, differences in the clinical threshold for periosteal detachment, influenced by the genetic background and/or environmental exposures, may explain the incomplete penetrance of the hyperostotic phenotype. Similar explanations have been provided to account for the widely differing fracture rates among affected individuals in families with classical osteogenesis imperfecta type I due to autosomal dominant COL1A1 haploinsufficiency (26, 43, 44).

Our clinical evaluations of the affected individuals in the 3 families have extended the reported phenotype of Caffey disease (1). Individuals bearing the Caffey allele in 2 of the 3 families had features that were similar to those observed in patients with Ehlers-Danlos syndrome type III (24), and the absence of such features in the third family may be attributed to the current young age of the affected individuals. The relatively high number of fractures in family 1 suggested that bone fragility may also be part of the phenotype. However, bone densitometry studies in an affected adult patient (IV-2) were found to be normal, and similar fracture rates can occur in the normal population (45). Nonetheless, bone health of the ADC families requires further study, as radiographs taken during the episodes of cortical hyperostosis show that abnormalities in cortical and endosteal bone accompany the more obvious formation of subperiosteal new bone.

In summary, ADC is associated with a mutation in COL1A1 and thus belongs to the family of type I collagen–related conditions that include osteogenesis imperfecta types I–IV (46); Ehlers-Danlos syndrome types I (31) and VII (47, 48) and a recessive cardiac valvular form (49); idiopathic osteoporosis (50); arterial dissections (51); and dermatofibrosarcoma protuberans, which was found to be associated with translocations between chromosomes 17 and 22 leading to the production of a fusion protein consisting of α1(I) collagen and PDGF-β (52). The findings in the present study extend the phenotypic spectrum of disorders associated with genetic changes in the type I collagen genes to include a hyperostotic disorder, but it remains uncertain how the R836C mutation results in a temporally and spatially limited defect in bone.

Methods

Families with ADC.

A large, 3-generation Canadian ADC family (family 1) was ascertained, and historical details concerning episodes of infantile cortical hyperostosis were obtained from family members. Previous reports on this family also included detailed accounts of all episodes of possible infantile cortical hyperostosis (7, 8). These sources of information were combined in order to validate disease assignments within the pedigree. For the purposes of genetic linkage analysis, individuals in this family were designated as affected if they had radiographically proven Caffey disease (affected members) or if they had children diagnosed with Caffey disease (obligate carriers). Genomic DNA from 24 such individuals was available for study. Unrelated spouses were designated as unaffected.

Besides family 1, two additional small kindreds (families 2 and 3) were ascertained, which had 3 and 2 affected members, respectively. The small Canadian kindred (family 2) included the mother and her 2 children (see Figure Figure2C),2C), who were clinically and radiographically affected by Caffey disease (see Figure Figure1),1), while the small Australian family (family 3) consisted of affected monozygotic twins, a healthy brother, and healthy parents (see Figure Figure2D)2D) (19). A single sporadic case had hyperostosis of a rib, which was possibly due to ADC. Furthermore, 2 sporadic cases of the more severe prenatal form of Caffey disease were studied (20, 21). Autosomal recessive inheritance was postulated for the prenatal cases (21).

Detailed information was obtained from all families concerning possible events that may have precipitated episodes of infantile cortical hyperostosis. These enquiries were undertaken soon after the onset of the episodes of cortical hyperostosis in the affected children in families 2 and 3 as well as in some of the recently born affected members of the large family 1. The long-term sequelae of the condition in clinically affected individuals and in obligate carriers were determined. The long-term clinical features of the individuals in each family that did not bear the Caffey allele were also recorded.

Genetic screening and DNA analysis.

In family 1, we performed a genome-wide scan with microsatellite markers spaced at about 10-centimorgan intervals (Webber set 9; Invitrogen Corp.) followed by fine mapping using commercially available markers for the linked interval. We performed LOD score calculations using the Mlink program (http://linkage.rockefeller.edu/) assuming a disease frequency of 0.1%, equal allele frequencies, and autosomal dominant inheritance with full penetrance. Candidate genes in the linked region were identified and sequenced by the Massachusetts General Hospital Sequencing Core using Applied Biosystems Taq DyeDeoxy Terminator cycle sequencing kits and methods.

Once the putative Caffey gene and its mutation were identified, we screened genomic DNA from affected individuals and obligate carriers of the various families, as well as the sporadic cases and controls, by restriction mapping of PCR products. For these studies, we used the forward primer AGCAGGGGAATATGGGTCAG and the reverse primer GGCCCTGAGAAAAACCATC to generate a 495-bp PCR product. The mutant PCR product lacked 1 of the cleavage sites for the restriction endonuclease HpyCH4IV, which thus allowed detection of the mutation by agarose gel electrophoresis after enzymatic digestion of the amplified DNA (wild-type, bands of 259, 60, and 176 bp; mutant, bands of 319 and 176 bp; note that the 60-bp band is not shown in Figure Figure2B).2B). In individuals who did not bear the R836C mutation in COL1A1, mutations were sought in other parts of COL1A1 as well as in COL1A2, as described previously (53).

Informed consent was obtained from all study participants prior to their inclusion in these studies. These studies have been approved by the institutional review boards at the respective institutions and were performed in accordance with the guidelines of the Declaration of Helsinki.

Dermal histology and fibroblast cultures.

Skin biopsies were obtained from the proband (IV-2) of family 1. We processed 1 biopsy for electron microscopy using previously described methods (54). The same methods were used to process the patient and control samples for electron microscopy. The second biopsy specimen was used to establish fibroblast cultures, which were grown to confluency in the presence of β-aminopropionitrile, which blocks the formation of lysine-derived cross-linkages, and ascorbate, which is required for normal prolyl- and lysyl-hydroxylation of collagen. The cultures were analyzed 5–7 days after plating, as previously described (55, 56). Fibroblast cultures from an age- and sex-matched individuals served as controls. Cell layer and medium fractions were analyzed separately, and the procollagens were converted to collagen by limited pepsin digestion. The collagens were resolved by 1-dimensional and 2-dimensional SDS-PAGE and stained with Coomassie G-250 (Invitrogen Corp.) (28). Where applicable, disulfide bonds were reduced with DTT.

Acknowledgments

We thank the affected individuals and their families for their assistance. We also thank C.S. Houston for his assistance with the radiology of Caffey disease. This work was supported by grants from the Canadian Institutes of Health Research and the Canadian Arthritis Network (to W.G. Cole); grants from the Foundation for Pediatric Research and the Paivikki and Sakari Sohlberg Foundation and a Research Fellowship from the European Society for Paediatric Endocrinology, sponsored by Novo Nordisk A/S (to O. Mäkitie); and NIH grants R01 46718-10 (to H. Jüppner) and K08 HD41512 (to R.C. Gensure).

Footnotes

See the related Commentary beginning on page 1142.

Nonstandard abbreviations used: ADC, autosomal dominant form of Caffey disease; COL1A1, gene encoding the α1(I) chain of type I collagen; CB6, cyanogen bromide peptide 6; PGE1, prostaglandin E1.Conflict of interest: The authors have declared that no conflict of interest exists.

References

1. Caffey J. Infantile cortical hyperostosis; a review of the clinical and radiographic features. Proc. R. Soc. Med. 1957;50:347–354. [PMC free article] [PubMed]
2. Bernstein RM, Zaleske DJ. Familial aspects of Caffey’s disease. Am. J. Orthop. 1995;24:777–781. [PubMed]
3. Caffey J. On some late skeletal changes in chronic infantile cortical hyperostosis. Radiology. 1952;59:651–657. [PubMed]
4. Blank E. Recurrent Caffey’s cortical hyperostosis and persistent deformity. Pediatrics. 1975;55:856–860. [PubMed]
5. Heyman E, Laver J, Beer S. Prostaglandin synthetase inhibitor in Caffey disease. J. Pediatr. 1982;101:314. [PubMed]
6. Bush L, Merrell O. Infantile cortical hyperostosis. Report of a case responding to treatment with corticotropin. J. Pediatr. 1952;40:330–333. [PubMed]
7. Gerrard JW, Holman GH, Gorman AA, Morrow IH. Familial infantile cortical hyperostosis. J. Pediatr. 1961;59:543–548. [PubMed]
8. Maclachlan AK, Gerrard JW, Houston CS, Ives EJ. Familial infantile cortical hyperostosis in a large Canadian family. Can. Med. Assoc. J. 1984;130:1172–1174. [PMC free article] [PubMed]
9. Van Buskirk FW, Tampas JP, Peterson OS., Jr Infantile cortical hyperostosis; an inquiry into its familial aspects. Am. J. Roentgenol. Radium Ther. Nucl. Med. 1961;85:613–632. [PubMed]
10. Barba WP, Freriks DJ. The familial occurrence of infantile cortical hyperostosis in utero. J. Pediatr. 1953;42:141–150. [PubMed]
11. Saul RA, Lee WH, Stevenson RE. Caffey’s disease revisited. Further evidence for autosomal dominant inheritance with incomplete penetrance. Am. J. Dis. Child. 1982;136:55–60. [PubMed]
12. Parker S, Griffiths H. Prostaglandin-induced cortical hyperostosis. Orthopedics. 1990;13:243–244. [PubMed]
13. Kaufman M, El-Chaar G. Bone and tissue changes following prostaglandin therapy in neonates. Ann. Pharmacother. 1996;30:269–274, 277. [PubMed]
14. Woo K, Emery J, Peabody J. Cortical hyperostosis: a complication of prolonged prostaglandin infusion in infants awaiting cardiac transplantation. Pediatrics. 1994;93:417–420. [PubMed]
15. Snedecor S, Knapp R, Wilson H. Traumatic ossifying periostitis of the newborn. Surg. Gynecol. Obstet. 1935;61:385–387.
16. Rothman P, Leon E. Hypervitaminosis A. Report of two cases in infants. Radiology. 1948;51:368–374. [PubMed]
17. Talab Y, Mallouh A. Hyperostosis with hyperphosphatemia: a case report and review of the literature. J. Pediatr. 1988;114:1010–1013. [PubMed]
18. Caffey J. Infantile cortical hyperostosis. J. Pediatr. 1946;29:541–559. [PubMed]
19. Couper RT, McPhee A, Morris L. Indomethacin treatment of infantile cortical periostosis in twins. J. Paediatr. Child Health. 2001;37:305–308. [PubMed]
20. Dahlstrom JE, et al. Lethal prenatal onset infantile cortical hyperostosis (Caffey disease) Pathology. 2001;33:521–525. [PubMed]
21. Schweiger S, et al. Antenatal onset of cortical hyperostosis (Caffey disease): case report and review. Am. J. Med. Genet. 2003;120A:547–552. [PubMed]
22. Dalgleish R. The human type I collagen mutation database. Nucleic Acids Res. 1997;25:181–187. [PMC free article] [PubMed]
23. Drvaric DM, et al. Prostaglandin-induced hyperostosis. A case report. Clin. Orthop. 1989;246:300–304. [PubMed]
24. Beighton P, De Paepe A, Steinmann B, Tsipouras P, Wenstrup RJ. Ehlers-Danlos syndromes: revised nosology, Villefranche, 1997. Ehlers-Danlos National Foundation (USA) and Ehlers-Danlos Support Group (UK) Am. J. Med. Genet. 1998;77:31–37. [PubMed]
25. Byers PH, Steiner RD. Osteogenesis imperfecta. Annu. Rev. Med. 1992;43:269–282. [PubMed]
26. Cole WG. Advances in osteogenesis imperfecta. Clin. Orthop. 2002;401:6–16. [PubMed]
27. Chan D, Rogers JF, Bateman JF, Cole WG. Recurrent substitutions of arginine 789 by cysteine in pro-alpha 1 (II) collagen chains produce spondyloepiphyseal dysplasia congenita. J. Rheumatol. Suppl. 1995;43:37–38. [PubMed]
28. Chan D, Taylor TK, Cole WG. Characterization of an arginine 789 to cysteine substitution in alpha 1 (II) collagen chains of a patient with spondyloepiphyseal dysplasia. J. Biol. Chem. 1993;268:15238–15245. [PubMed]
29. Tomso DJ, Bell DA. Sequence context at human single nucleotide polymorphisms: overrepresentation of CpG dinucleotide at polymorphic sites and suppression of variation in CpG islands. J. Mol. Biol. 2003;327:303–308. [PubMed]
30. Persikov AV, Ramshaw JA, Kirkpatrick A, Brodsky B. Amino acid propensities for the collagen triple-helix. Biochemistry. 2000;39:14960–14967. [PubMed]
31. Nuytinck L, et al. Classical Ehlers-Danlos syndrome caused by a mutation in type I collagen. Am. J. Hum. Genet. 2000;66:1398–1402. [PubMed]
32. Beher D, Hesse L, Masters CL, Multhaup G. Regulation of amyloid protein precursor (APP) binding to collagen and mapping of the binding sites on APP and collagen type I. J. Biol. Chem. 1996;271:1613–1620. [PubMed]
33. Somasundaram R, et al. Collagens serve as an extracellular store of bioactive interleukin 2. J. Biol. Chem. 2000;275:38170–38175. [PubMed]
34. Di Lullo GA, Sweeney SM, Korkko J, Ala-Kokko L, San Antonio JD. Mapping the ligand-binding sites and disease-associated mutations on the most abundant protein in the human, type I collagen. J. Biol. Chem. 2002;277:4223–4231. [PubMed]
35. Persikov AV, Ramshaw JA, Brodsky B. Collagen model peptides: sequence dependence of triple-helix stability. Biopolymers. 2000;55:436–450. [PubMed]
36. Velaphi S, et al. Cortical hyperostosis in an infant on prolonged prostaglandin infusion: case report and literature review. J. Perinatol. 2004;24:263–265. [PubMed]
37. Kwon DS, Spevak MR, Fletcher K, Kleinman PK. Physiologic subperiosteal new bone formation: prevalence, distribution, and thickness in neonates and infants. AJR Am. J. Roentgenol. 2002;179:985–988. [PubMed]
38. Morris S, Cassidy N, Stephens M, McCormack D, McManus F. Birth-associated femoral fractures: incidence and outcome. J. Pediatr. Orthop. 2002;22:27–30. [PubMed]
39. Abernethy LJ, Lee YC, Cole WG. Ultrasound localization of subperiosteal abscesses in children with late-acute osteomyelitis. J. Pediatr. Orthop. 1993;13:766–768. [PubMed]
40. Front D, Hardoff R, Levy J, Benderly A. Bone scintigraphy in scurvy. J. Nucl. Med. 1978;19:916–917. [PubMed]
41. Ratanachu-Ek S, Sukswai P, Jeerathanyasakun Y, Wongtapradit L. Scurvy in pediatric patients: a review of 28 cases. J. Med. Assoc. Thai. 2003;86(Suppl. 3):S734–S740. [PubMed]
42. Cole WG, Dalziel RE, Leitl S. Treatment of acute osteomyelitis in childhood. J. Bone Joint Surg. Br. 1982;64:218–223. [PubMed]
43. Willing MC, Deschenes SP, Slayton RL, Roberts EJ. Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains. Am. J. Hum. Genet. 1996;59:799–809. [PubMed]
44. Willing MC, et al. Osteogenesis imperfecta type I: molecular heterogeneity for COL1A1 null alleles of type I collagen. Am. J. Hum. Genet. 1994;55:638–647. [PubMed]
45. Jones IE, Williams SM, Dow N, Goulding A. How many children remain fracture-free during growth? a longitudinal study of children and adolescents participating in the Dunedin Multidisciplinary Health and Development Study. Osteoporos. Int. 2002;13:990–995. [PubMed]
46. Byers, P.H., and Cole, W.G. 2002. Osteogenesis imperfecta. In Connective tissue and its heritable disorders molecular, genetic and medical aspects.P.M. Royce and B. Steinmann, editors. Wiley-Liss. New York, New York, USA. 385–430.
47. Cole WG, Chan D, Chambers GW, Walker ID, Bateman JF. Deletion of 24 amino acids from the pro-alpha 1(I) chain of type I procollagen in a patient with the Ehlers-Danlos syndrome type VII. J. Biol. Chem. 1986;261:5496–5503. [PubMed]
48. Byers PH, et al. Ehlers-Danlos syndrome type VIIA and VIIB result from splice-junction mutations or genomic deletions that involve exon 6 in the COL1A1 and COL1A2 genes of type I collagen. Am. J. Med. Genet. 1997;72:94–105. [PubMed]
49. Schwarze U, et al. Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway. Am. J. Hum. Genet. 2004;74:917–930. [PubMed]
50. Grant SF, et al. Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I alpha 1 gene. Nat. Genet. 1996;14:203–205. [PubMed]
51. Mayer SA, Rubin BS, Starman BJ, Byers PH. Spontaneous multivessel cervical artery dissection in a patient with a substitution of alanine for glycine (G13A) in the alpha 1 (I) chain of type I collagen. Neurology. 1996;47:552–556. [PubMed]
52. Simon MP, et al. Deregulation of the platelet-derived growth factor B-chain gene via fusion with collagen gene COL1A1 in dermatofibrosarcoma protuberans and giant-cell fibroblastoma. Nat. Genet. 1997;15:95–98. [PubMed]
53. Korkko J, Annunen S, Pihlajamaa T, Prockop DJ, Ala-Kokko L. Conformation sensitive gel electrophoresis for simple and accurate detection of mutations: comparison with denaturing gradient gel electrophoresis and nucleotide sequencing. Proc. Natl. Acad. Sci. U. S. A. 1998;95:1681–1685. [PubMed]
54. Cole WG, Evans R, Sillence DO. The clinical features of Ehlers-Danlos syndrome type VII due to a deletion of 24 amino acids from the pro alpha 1(I) chain of type I procollagen. J. Med. Genet. 1987;24:698–701. [PMC free article] [PubMed]
55. Chan D, Lamande SR, Cole WG, Bateman JF. Regulation of procollagen synthesis and processing during ascorbate-induced extracellular matrix accumulation in vitro. Biochem. J. 1990;269:175–181. [PubMed]
56. Hata R, Senoo H. L-ascorbic acid 2-phosphate stimulates collagen accumulation, cell proliferation, and formation of a three-dimensional tissuelike substance by skin fibroblasts. J. Cell. Physiol. 1989;138:8–16. [PubMed]

Articles from The Journal of Clinical Investigation are provided here courtesy of American Society for Clinical Investigation